• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Mol Microbiol. Author manuscript; available in PMC Aug 1, 2009.
Published in final edited form as:
PMCID: PMC2597432
NIHMSID: NIHMS65515

EsaC substrate for the ESAT-6 Secretion Pathway and its role in persistent infections of S. aureus

Summary

Staphylococcus aureus encodes the specialized secretion system Ess (ESAT-6 secretion system). The ess locus is a cluster of eight genes (esxAB, essABC, esaABC) of which esxA and esxB display homology to secreted ESAT-6 proteins of Mycobacterium tuberculosis. EsxA and EsxB require EssA, EssB and EssC for transport across the staphylococcal envelope. Herein, we examine the role of EsaB and EsaC and show that EsaB is a negative regulator of EsaC. Further, EsaC production is repressed when staphylococci are grown in broth and increased when staphylococci replicate in serum or infected hosts. EsaB is constitutively produced and remains in the cytoplasm whereas EsaC is secreted. This secretion requires an intact Ess pathway. Mutants lacking esaB or esaC display only a small defect in acute infection, but remarkably are unable to promote persistent abscesses during animal infection. Together, the data suggest a model whereby EsaB controls the production of effector molecules that are important for host pathogen interaction. One such effector, EsaC, is a secretion substrate of the Ess pathway and implements its pathogenic function during infection.

Keywords: WXG100 proteins, virulence, abscess formation

Introduction

S. aureus secretes a plethora of virulence factors into the extracellular milieu (Archer, 1998; Dinges et al., 2000; Foster, 2005; Shaw et al., 2004; Sibbald et al., 2006). Like most secreted proteins, these virulence factors are translocated by the Sec machinery across the plasma membrane. Proteins secreted by the Sec machinery bear an N-terminal leader peptide that is removed by leader peptidase once the pre-protein is engaged in the Sec translocon (Dalbey and Wickner, 1985; van Wely et al., 2001). Recent genome analysis suggests that Actinobacteria and members of the Firmicutes encode an additional secretion system that recognizes a subset of proteins in a Sec-independent manner (Pallen, 2002). Recently, this secretion system has been labeled type VII secretion system (Abdallah et al., 2007). ESAT-6 (early secreted antigen target 6 kDa) and CFP-10 (culture filtrate antigen 10 kDa) of Mycobacterium tuberculosis represent the first substrates of this novel secretion system termed ESX-1 or Snm in M. tuberculosis (Andersen et al., 1995; Hsu et al., 2003; Pym et al., 2003; Stanley et al., 2003). In S. aureus, two ESAT-6 like factors designated EsxA and EsxB are secreted by the Ess pathway (ESAT-6 secretion system) (Burts et al., 2005).

M. tuberculosis variants lacking ESAT-6 (esxA) or CFP-10 (esxB) display severe defects in the establishment of tuberculosis (Guinn et al., 2004; Hsu et al., 2003; Sorensen et al., 1995; Stanley et al., 2003). In S. aureus, failure to produce EsxA and EsxB leads to decreased virulence in a murine abscess model of infection, suggesting that the Ess pathway is involved in the pathogenesis of acute staphylococcal infections (Burts et al., 2005). Thus far, three genes, essA, essB, and essC, appear to be important for production of EsxA and EsxB and possibly secretion across the staphylococcal envelope. The genes are encoded within an eight gene cluster conserved in other Gram positive bacteria (Fig. 1). Of those only esxA, esxB, and essC, share homologs with genes of M. tuberculosis (Burts et al., 2005; Pallen, 2002). The remaining genes in the cluster, esaA, esaB, and esaC, are dispensable for secretion of EsxA and EsxB and are referred as “accessory” factors for lack of attributable function (esa, ESAT-6 secretion accessory) (Burts et al., 2005). The present study examines the role of esaB and esaC in this secretion system and their contribution to host pathogen interaction.

Fig. 1
Schematic drawing of the ess cluster found in various Gram-positive bacteria as well as M. tuberculosis. Color of genes and proteins indicates: FtsK-SpoIIIE ATPases (FSD factors), yellow color; ESAT-6 like protein, red color; conserved proteins, grey ...

Results

Sequence analysis of EsaB and EsaC

esaB encodes an 80 amino acid protein that is conserved in the genome of many Gram-positive bacteria. Further, esaB- like genes are always found closely associated on the chromosome of Gram-positive bacteria with esxA- and essC-like genes (Fig. 1). The crystal structure of B. subtilis YukD (EsaB homologue) was recently solved and shown to adopt a fold that is closely related to ubiquitin. YukD lacks the C-terminal peptide that is crucial for the activity of ubiquitin, suggesting that YukD is unlikely to modify other polypeptides by covalent linkage (van den Ent and Lowe, 2005). EsaB is a predicted soluble protein without a canonical signal peptide. esaC encodes a predicted soluble 130 amino acid protein that is conserved in the genomes of staphylococci, but absent from the genomes of other bacteria. In all staphylococcal genomes sequenced thus far, esaC is located between essC and esxB on the staphylococcal chromosome, with the exception of USA200, a strain that harbors an inversion of esaC and esxB. An unrelated gene, also of unknown function, occupies the position analogous to that of EsaC in the genomes of other Gram-positive bacteria (Fig. 1). Although these genes share no homology with staphylococcal EsaC, they are of similar size and their individual products also lack amino acid sequence homology. Together these data suggest that a species specific gene occupies the position between essC- and esxB-homologues of Gram-positive Ess clusters, while esaB is conserved amongst these species (Fig. 1).

EsaC protein production is tightly controlled

Using EsaC specific rabbit antiserum for immunoblotting experiments, we failed to detect EsaC in total extracts of S. aureus strain Newman. We wondered whether EsaC may be produced in mutants of the Ess cluster and found that only the esaB mutant produced EsaC, whereas mutations in all other genes had no effect (Fig. 2A). The esaB phenotype was complemented by providing wild type esaB on a plasmid (Fig. 2B). EsaB was produced constitutively (Fig. 2A). We wished to examine whether the expression of esaC was negatively controlled in strain Newman. A quantitative RT-PCR analysis was used to compare esaC transcript levels in wild type Newman as well as an isogenic variant with transposon insertion in the esaB gene. This analysis revealed that esaC transcripts are increased 3-fold in an esaB mutant as compared to wild type S. aureus Newman (Fig. 2C). As a control, transcripts were analyzed from a strain lacking the complete open reading frame encoding EsaC. Neither the transposon insertion in esaB nor the deletion of esaC had polar effects on the expression of downstream genes essB and esxB, as verified by RT-PCR and immunoblot analyses (data not shown). Pulse labeling of staphylococci with [35S]-methionine was used to identify newly synthesized EsaC species via immunoprecipitation and autoradiography of proteins separated on SDS-PAGE. While esaC transcripts are observed both in wild type and isogenic esaB Newman strains, the EsaC polypeptide was only detected in a strain lacking esaB, but not in the wild type parent strain Newman (Fig. 2D). This result suggests that esaC regulation occurs by a post-transcriptional mechanism and can be relieved by mutations in esaB. When the minimal coding sequence of esaC was expressed under the control of the constitutive hprK gene promoter (pOS-esaC), a protein product could readily be detected by immunoblot with anti-EsaC antibodies (Fig. 3; TSB grown bacteria), implying that untranslated esaC sequences are required for EsaB-mediated regulation. An attempt to establish whether EsaB may interact with coding or untranslated esaC DNA and RNA sequences was unsuccessful. Further, purified EsaB was not found to interact with purified EsaC or stimulate EsaC hydrolysis when mixed with soluble crude extracts of staphylococci. Hence the mechanism whereby EsaB controls esaC expression or production remains unclear.

Fig. 2
EsaB regulates EsaC production. (A-B) Total cell cultures of strain Newman and variants were examined for production of EsaC. Staphylococci were grown in tryptic soy broth. Proteins in whole culture lysates were precipitated with TCA, separated by SDS-PAGE ...
Fig. 3
Staphylococci grown in serum produce EsaC. Staphylococci, Newman, esaC mutant with no vector (-), vector alone (pOS), vector carrying esaC (pOS-esaC), were grown in TSB or serum to the same density, washed and lysed with lysostaphin. Proteins in these ...

Serum grown staphylococci produce EsaC

We wondered whether EsaB-mediated repression of EsaC might be relieved when staphylococci are grown under conditions that mimic infection. Production of EsaC in S. aureus Newman was compared when bacteria were grown in tryptic soy broth (TSB) or serum by immunoblot analysis of whole culture lysates (Fig. 3). S. aureus Newman indeed produced EsaC when grown in human serum, suggesting that EsaB-mediated repression is reversible and may be modulated in response to host environmental factors. As noted above, when esaC was cloned on plasmid pOS1 and its expression driven by the hprK promoter (pOS-esaC), production of EsaC appeared to be constitutive (Fig. 3). Thus, production of EsaC is controlled by cis acting nucleic acid sequence elements, by EsaB and by host factors that must be present in human serum.

Clinical isolates grown in broth produce EsaC

We wondered whether EsaC production is also regulated in other staphylococcal strains and examined several isolates, including USA100, USA200, USA300, USA700, MW2, Mu50, and N315, all of which were grown to mid-log phase in TSB. Whole culture lysates (WC) were generated by lysostaphin digestion, normalized for total protein concentration, and examined by immunoblot using EsaC or ribosomal protein L6 specific antiserum. EsaC was readily detected in extracts of some staphylococcal strains, in particular strains USA300 and USA700 as shown in Fig. 4A (WC; left panel). Interestingly, DeLeo and colleagues reported that strain USA300 expressed greater amounts of various toxins and in particular exoproteins such as α-toxin, a phenomenon that could in part account for the increased virulence of the strain (Burlak et al., 2007). Unlike S. aureus Newman, USA300 strain LAC produced EsaC under normal growth conditions in TSB. We therefore sought to determine whether EsaC production was regulated by EsaB in S. aureus USA300. The genome sequences for S. aureus Newman and USA300 have been determined, and are closely related in overall sequence and structure (Baba et al., 2008; Diep et al., 2006b). Hence, [var phi]85 was used to transduce the esaB::erm allele into strain USA300. USA300 carrying the esaB::erm allele and its isogenic parent were grown to mid-log phase in TSB. Whole bacterial culture extracts were generated with lysostaphin digestion, and examined by immunoblot with EsaC or L6 specific antisera. EsaC was detected with increased abundance in the esaB variant of S. aureus USA300 (Fig. 4A). Thus, even though the more virulent S. aureus USA300 can produce EsaC when grown in TSB, disruption of esaB causes a similar increase in EsaC production as observed for S. aureus Newman.

Fig. 4
EsaC is a ubiquitous secreted antigen of the S. aureus Ess pathway. (A) S. aureus USA300 and USA700 secrete EsaC into the extracellular medium (MD). As control, regulation of EsaC expression in S. aureus Newman as well as USA300 is dependent on esaB as ...

EsaC is a secreted factor

Cultures of wild type S. aureus strains USA300 and USA700 were grown to mid-log phase and proteins in the medium were separated from staphylococci by removing intact cells by centrifugation. Proteins in the supernatants were concentrated ~125 fold and separated on SDS-PAGE. The samples were subjected to immunoblotting and probed with anti-EsaC or anti-L6 (for cell lysis control) antibodies. Data in Fig. 4A (right panel) indicate that EsaC is indeed secreted into the medium of S. aureus strains USA300 and USA700. Since EsaC does not carry a canonical signal sequence, we wondered whether it may represent a substrate of the Ess pathway. To test this, plasmid pOS-esaC which leads to constitutive EsaC production in S. aureus Newman was electroporated in an isogenic variant that cannot express essC. EssC is an essential component of the ESAT-6 secretion system. Disruption of the essC gene indeed abolished secretion of EsaC and the protein accumulated in the cytoplasm of staphylococci (Fig. 4B). In sum, EsaC appears to be a novel substrate for the non-canonical Ess secretion pathway.

To examine the subcellular localization and efficiency of secretion of EsaC, we took advantage of strain Newman lacking esaB and strain USA300, both of which produce EsaC from the chromosomal locus. Cultures of S. aureus were separated into cytoplasm, membrane, cell wall, and medium (Fig. 4C; fractions C, M, W, MD, respectively). A whole culture extract was added as control (Fig. 4C; WC). Proteins in all fractions were revealed by immunoblotting with specific antibodies. As expected, strain Newman did not produce EsaC. However, EsaC was found in the culture medium of strains Newman lacking esaB and USA300 but not in the cytoplasm, membrane or cell wall, a distribution previously reported for EsxA and EsxB (Burts et al., 2005). EsaC could not be detected in strain USA300 lacking esxB (Fig. 4C). Upon extended exposure of the immunoblot, a weak immuno-reactive EsaC species could be detected in the total culture sample but not in the conditioned medium (not shown), suggesting that EsxB is required for EsaC secretion (Fig. 4B). As a control, protein A (Spa) was detected in the cell wall fraction, whereas ribosomal protein L6 and membrane bound sortase A (SrtA) resided in the cytoplasm and the plasma membrane, as expected (Fig. 4C). Together, these results demonstrate that EsaC is secreted across the bacterial envelope into the culture medium in a manner requiring an intact type VII secretion system.

EsaC is produced during infection

Guided by our general hypothesis that the Ess pathway modulates host immune responses, we asked whether EsaC is produced during infection. Mice were infected with S. aureus Newman. Blood was collected from infected and control (mock infected) animals on days 0 and 30. The presence of anti-EsaC IgG in serum samples was tested in an ELISA using purified EsaC as immobilized antigen. Data in Fig. 5A show that animals infected with S. aureus Newman developed IgG type antibodies against EsaC, suggesting that the protein is synthesized by wild type Newman during infection and presented to the immune system. Further, human sera were collected from two patients that had been diagnosed with S. aureus infection and two healthy individuals. An ELISA revealed elevated anti-EsaC IgG in sera of acutely infected patients as compared to healthy individuals (Fig. 5B).

Fig. 5
Mice and humans infected with S. aureus generate EsaC IgG specific antibodies. (A) Three-week-old BALB/c mice were injected retro-orbitally with ~ 106 CFU of strain Newman. Sera were collected on day 0 and 30 days post infection and analyzed for the presence ...

To further evaluate the ubiquitous nature of this host response, we asked whether EsaC antibodies were produced upon infection of mice with S. aureus USA100, USA200, USA300, USA700, MW2, Mu50, or N315. Staphylococci were grown to mid-log phase and ~ 106 bacteria were used to infect groups of five three-week old mice. Blood was collected via retro-orbital bleeds on days 0 and 30. The presence of α-EsaC IgG was examined in an ELISA using purified EsaC as antigen (Fig. 5C; only data for day 30 are shown). Mice infected with S. aureus produced IgG antibodies against EsaC (Fig. 5C) but not against SrtA, the transmembrane protein responsible for protein sorting in the bacterial envelope (Fig. 5D). In sum, EsaC is encoded by all staphylococcal strains examined thus far and appears to be produced during host infection. Further, infected hosts develop an antibody response toward EsaC but not SrtA, suggesting that the EsaC antigen must be presented to the host’s immune system during infection and may be a secreted antigen in agreement with the general hypothesis that EsaC may be secreted during infection.

EsaB and EsaC are required for persistent infection

An intact type VII secretion system is required for host pathogen interaction both in staphylococci and pathogenic mycobacteria. We wondered whether the accessory factors EsaB and EsaC are also required for staphylococcal replication in infected hosts. To test this possibility, groups of 3-week old mice were challenged with 106 colony forming units (CFU) of wild type S. aureus Newman or isogenic variants lacking esaB or esaC. Animals (groups of 10-12) were killed five and thirty-six days after infection. Kidneys were removed post mortem. Tissue homogenate derived from the right kidney was spread on agar for colony formation and enumeration of staphylococcal load (Fig. 6), whereas the left kidney was fixed in formalin, thin sectioned and stained with hematoxylin and eosin for histopathology (Fig. 7). As compared to animals inoculated with wild-type S. aureus Newman, bacterial load five days following infection was reduced by 1.5 and 0.8 logs in abscesses of animals infected with esaB and esaC variants, respectively (Fig. 6). Histopathology of kidney tissue at the same time interval revealed that the total number of abscesses was reduced in organs from animals infected with esaB (2.1 ± 1.7) or esaC (1.5 ± 1.0) variants as compared to the wild-type parent (4.9 ± 2.2) (Fig. 7). Thus, although both esaB and esaC mutants appear to display virulence defects, these variants retain the ability of forming abscesses in infected host tissues.

Fig. 6
Virulence of S. aureus esaB and esaC mutants. BALB/c mice were infected retro-orbitally with ~ 106 CFU for each strain. Both kidneys were harvested from mock (PBS) infected animals or mice infected with Newman, esaB or esaC isogenic variants, for 5 and ...
Fig. 7
Pathological substrate of infection caused by S. aureus wild type and esaB or esaC mutants. Kidneys of mice infected as described in figure 6 were removed 5 and 36 days post infection. The right kidney was used for CFU counts and the left was fixed with ...

Earlier work suggested that virulent S. aureus strains may persist in tissues of infected mice for a prolonged period of time (Xu et al., 2004), similar to the clinicopathological features observed with human diseases caused by S. aureus (Musher et al., 1994). If so, chronic-persistent features of staphylococcal infections may resemble those observed for tuberculosis, where ESAT-6 secretion is a reported virulence factor for acute infection (Pym et al., 2003; Stanley et al., 2003). To test whether the accessory genes of the staphylococcal Ess pathway contribute to pathogen persistence, animals were infected with wild-type S. aureus Newman; bacterial load as well as histopathology were examined 36 days following inoculation (Fig. 6 & 7). The average number of abscesses indeed increased from 4.9 (± 2.2) on day five to 6.9 (± 2.4) on day thirty-six, and the size of abscesses increased over time, whereas bacterial load remained persistently high at 2-3 × 106 cfu. In contrast to wild-type staphylococci, the bacterial load for animals infected with the esaB mutant dropped from 5 × 104 cfu on day five to 1.5 × 101 cfu on day thirty-six, while abscesses were either not detectable or were found to occur at reduced frequency and size. Similar to esaB variants, deletion of esaC also reduced the bacterial load from 2.5 × 105 cfu on day five to 1 × 103 cfu on day thirty-six, with a concomitant reduction in abscess number to 1.8 (± 1.5) and in abscess size. Of note, esaC mutants formed more abscesses and persisted at a higher bacterial load than esaB mutants. This observation is in agreement with the conjecture that EsaB may regulate not only esaC but also additional staphylococcal genes during infection.

Discussion

Research over the past several decades identified S. aureus exotoxins, surface proteins and regulatory molecules as important virulence factors (Foster, 2005; Mazmanian et al., 2001; Novick, 2003). Much progress has been achieved regarding the regulation of these genes. For example, staphylococci perform a bacterial census via the secretion of auto-inducing peptides that bind to a cognate receptor at threshold concentration, thereby activating phospho-relay reactions and transcriptional activation of many of exotoxin genes (Novick, 2003). During infection, this bacterial census termed Agr ensures massive secretion of virulence factors when staphylococcal counts are high, increasing the likelihood of bacterial spread in infected tissues and/or systemic dissemination (Novick, 2003). In this study, we report that staphylococci produce and secrete EsaC under conditions that occur when bacteria enter host tissues. Production of EsaC is regulated by EsaB, a cytoplasmic conserved protein also encoded within the Ess cluster. EsaB appears to repress EsaC production in a post-transcriptional manner. Bacteria lacking EsaB overproduce EsaC while wild type bacteria do not, unless they are replicating in host tissues. How EsaB mediates repression and senses environmental signals remains unknown. Genes in the ess pathway do not appear to be regulated by Agr or staphylococcal counts (data not shown).

The Ess pathway is an alternate secretion system reminiscent of alternate secretion systems of many pathogens (Pugsley, 1993) that transport polypeptides across the bacterial envelope. Like most alternate secretion systems, the Ess pathway appears to transport a limited set of substrates. In mycobacteria and staphylococci, the ESX-1 and Ess pathways transport proteins that belong to the WXG100 family such as ESAT-6, CFP-10, EsxA and EsxB (Burts et al., 2005; Champion et al., 2006; Stanley et al., 2003). The genetic determinants of the ESX-1 and Ess pathways are clustered in discrete loci, dispensable for laboratory growth and essential for the pathogenesis of infectious diseases (Burts et al., 2005; Hsu et al., 2003; Pym et al., 2002; Stanley et al., 2003).

esaC is found only in the genomes of staphylococci, whereas other Gram positive bacteria encode a protein with similar predicted mass but unrelated sequence in the same genetic locus (Fig. 1). As EsaC is regulated and secreted by the Ess pathway, it may represent a unique effector of this secretion system that enables staphylococcal persistence in host tissues. Consistent with this conjecture is the finding that animals and humans mount a humoral immune response to EsaC during infection. During infection, all S. aureus strains secrete EsaC, and the more virulent clinical isolates have retained this activity even in vitro. EsaC does not bear any features of the WXG100 family of proteins and it is unclear how it is recognized by the Ess pathway. Secretion of non-WXG100 substrates by the ESX-1 pathway has also been reported for several antigens including EspA, EspB, Rv3483c, and Rv3615c (Fortune et al., 2005; MacGurn et al., 2005; McLaughlin et al., 2007; Xu et al., 2007). The alternate ESX-5 pathway has also been shown to secrete both WXG100 and non-WXG100 proteins in pathogenic mycobacteria (Abdallah et al., 2006; Abdallah et al., 2007). Tuberculosis is a chronic persistent bacterial infection that involves manipulation of host immune responses by the invading pathogen. M. tuberculosis esxA (ESAT-6) and esxB (CFP-10) are located within a segment of the genome named region of difference 1 (RD1), which was identified by comparative genomics of virulent, avirulent and vaccine strains of mycobacteria (Cole et al., 1998; Mahairas et al., 1996; Pym et al., 2002). Thus, RD1 (ESAT-6 secretion) is not only an important virulence pathway of mycobacteria, mutants in this pathway are also the single most prominent attenuating trait of vaccine strains such as BCG (Hsu et al., 2003; Pym et al., 2002; Pym et al., 2003). ESX-1 appears to be important for escape of mycobacteria from the phagolysosome compartments of infected macrophages (Abdallah et al., 2007). Exactly how ESX-1 secreted substrates contribute to escape is unknown.

S. aureus secretes two WXG100 proteins, EsxA and EsxB (Burts et al., 2005) as well as a third polypeptide, EsaC. The contribution of EsaC production and secretion during S. aureus infection was revealed by analyzing esaB and esaC mutants in a murine model of abscess formation. Our observations suggest that the accessory factor EsaB may contribute to staphylococcal persistence. The experiments involved measurements of bacterial load and histopathological lesions in renal tissues. We observed that staphylococci persist within abscesses of infected host tissues. Herein, we propose that the accessory factors EsaB and EsaC are critical for persistence in tissues. Indeed, bacteria lacking esaB or esaC are able to seed abscesses in tissues much like wild type staphylococci (Figs. 6 & 7, day 5). However the number of abscesses is reduced for both mutants and, in contrast to wild type infections, decreases over time, especially when bacteria lack esaB (Figs. 6 & 7, day 36). We hypothesize that during infection, EsaB-repression of EsaC is relieved. However, this cannot be the sole function of the EsaB protein since abscesses formed by esaB mutants fail to persist and are cleared more readily than abscesses resulting from infection with esaC variants. A molecular property for EsaB could not be deduced. Although the B. subtilis homologue YukD adopts a ubiquitin fold, it does not display ubiquitin-like activity (van den Ent and Lowe, 2005). Staphylococcal EsaB was not found to interact with, or modify EsaC or its corresponding coding sequence (data not shown). Although, a biochemical function for EsaB could not be described, EsaB must regulate not only EsaC but additional factors that also contribute to the establishment of persistent infections. Together, our observations point to the Ess locus as a novel secretion pathway of S. aureus that interferes with host immune responses and allows establishment of chronic persistent infections, similar to M. tuberculosis.

Experimental Procedures

Bacterial strains, plasmids and growth conditions

S. aureus cells were grown in tryptic soy broth at 37°C, respectively. Chloramphenicol and erythromycin were used at 10 mg l-1, for plasmid and allele selection, respectively, when necessary. S. aureus strains MW2, Mu50, N315, USA100, USA200, USA300, and USA700, were obtained through the Network on Antimicrobial Resistance in S. aureus (NARSA, NIAID). All mutants used in this study with the exception of esaC were obtained from the Phoenix (ΦNΞ) library (Bae et al., 2004). Each Phoenix isolate is a derivative of the clinical isolate Newman (Bae et al., 2004; Duthie and Lorenz, 1952). All bursa aurealis insertions were transduced into wild-type S. aureus Newman or USA300 using bacteriophage [var phi]85 and verified by immunoblot and PCR analysis. Most but not all USA300 isolates harbor three plasmids one of which encode the ermC gene (Diep et al., 2006a). This plasmid can be lost readily (Diep et al., 2006a), permitting the construction of mutants marked with the ermC allele.

For deletion of esaC, a 2-kbp DNA fragment flanking the esaC gene but carrying only the first and last four codons of esaC gene was amplified by PCR, with abutted BamHI-EcoRI restriction sites. The DNA fragment was cloned into pKOR1 for allelic replacement performed as described earlier (Bae and Schneewind, 2006). A second esaC allele was constructed by cloning a 2-kbp DNA fragment containing esaC and 1-kbp nucleotide sequence upstream and downstream of esaC respectively, into plasmid pTS1. In this case, a stop codon was introduced at position four of the esaC coding sequence. pTS1 carries a mutation that renders its DNA replication in staphylococci sensitive to temperature shift at 43°C. Allelic replacement was performed as described earlier (Burts et al., 2005). Both esaC mutant alleles behaved identically and did not prevent production and secretion of EsxB encoded by the gene immediately downstream of esaC. All data shown in this study use the mutant carrying the entire deletion of the esaC gene.

The E. coli – S. aureus shuttle vector pOS1 that carries the hprK promoter and Shine Dalgarno sequence (275bp upstream of the hprK lgt yvoF yvcD translational start site) and three cloning sites NdeI, XhoI, BamHI, as described earlier (Bubeck Wardenburg et al., 2006) was used for complementation studies. All cloning procedures were carried out in E. coli and ampicillin was used at 100 mg l-1 for plasmid selection. The complementation plasmids pOS-esaB and pOS-esaC were generated by amplifying the minimal coding sequence of each gene using primer pairs EsaB-XhoI-F aactcgagatgaatcagcacgtaaaagt and EsaB-BamHI-R aaggatccctatagtaacttcaaaatat for esaB and EsaC-NdeI-F aacatatgaattttaatgatattga and EsaC-XhoI-R aactcgagttaattcattgctttattaaaat for esaC.

Culture Fractionation and Western blot experiments

Bacterial cells were grown at 37°C to an optical density of 0.8 at 660 nm (OD660nm) in tryptic soy broth. 1.5 ml of culture was spun (10,000 × g for 4 min), and supernatants (1 ml) were transferred to a fresh tube. Proteins in the supernatant were precipitated with 7.5% trichloroacetic acid (TCA), and sedimented by centrifugation (10,000 × g for 10 min) (MD, medium fraction). For whole culture lysates (WC), cultures (1.5 ml) were incubated in the presence of lysostaphin (100 μg/ml) for 30 min at 37°C and a 1-ml aliquot was precipitated with TCA.

For experiments using serum, colony forming units were counted and approximately 2 × 104 bacteria were added to 1.5 ml freshly drawn human blood placed in a sterile polystyrene round bottom tube. The samples were allowed to incubate with shaking at 37°C for 5 h and spun at 10,000 × g for 4 min. Bacteria in the cell pellet were washed with TSM (Tris-HCl buffer 0.05 M, pH 8.0 containing 30% sucrose and 5 mM MgCl2) to remove any proteins in the serum that would interfere with western blotting analysis and suspended in 1.5 ml Tris-HCl buffer 0.05 M, pH 8.0 containing 100 μg/ml lysostaphin. 1 ml of the cell lysate was removed and precipitated with 7.5% TCA.

All TCA precipitates were washed with ice-cold acetone, solubilized in 50 μl of 0.5 M Tris-HCl (pH 8.0)/4% SDS and heated at 90°C for 10 min. Proteins were separated on SDS/PAGE and transferred to poly(vinylidene difluoride) membrane for immunoblot analysis with appropriate polyclonal antibodies. Immunoreactive signals were revealed by using a secondary antibody coupled to horseradish peroxidase and chemiluminescence.

Staphylococcal fractionation

Cultures were centrifuged as described above and supernatants TCA precipitated in the presence of deoxycholic acid (MD, medium fraction of a 5 ml culture). Cell pellets of a 5 ml culture were washed with TSM buffer, suspended in 5 ml TSM buffer containing 100 μg/ml lystostaphin and incubated at 37°C for 30 min. Protoplasts were collected by centrifugation at 10,000 × g for 10 min, and the supernatant (W, cell wall fraction) was precipitated with TCA. The protoplasts were suspended in 5 ml membrane buffer (0.1 M Tris·HCl, pH 7.5/0.1 M NaCl/10 mM MgCl2) and subjected to five rounds of freeze–thaw in a dry ice ethanol bath. Soluble proteins (C, cytoplasmic fraction) were separated from insoluble materials and membranes (M, membrane fraction) by centrifugation at 100,000 × g for 30 min. All samples were TCA-precipitated before immunoblotting.

Labeling experiments and immunoprecipitation

Staphylococcal cultures were grown overnight in minimal medium, diluted 1:100 into minimal medium to OD660nm 0.8 and metabolically labeled with 100 μCi [35S]methionine for 2 min. TCA (5% final concentration) was added to stop all biological processes. All precipitates were washed with cold acetone and digested with lysostaphin in a 1 ml reaction volume of Tris-HCl buffer 0.5 M, pH 8.0 containing 100 μg/ml of enzyme for 2 hours at 37°C. Digests were precipitated with TCA, washed with aceone and the samples were boiled in SDS (50 μl 4% SDS, 0.5 M Tris-HCl, pH 8.0). Insoluble materials were removed by sedimentation. Total radioactive counts were measured using 5 μl of each sample in a scintillation counter. The incorporation of radiolabeled amino acids was found to be similar between all the samples examined (~ 20 cpm/μl). Twenty μl of each sample were immuno-precipitated with protein-specific antiserum and protein A beads. The beads were washed five times in RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, pH 7.5) and boiled in sample buffer prior to separation on SDS-PAGE. The gels were dried for visualization of radiolabeled polypeptides by autoradiography.

Transcriptional analysis of esaC

RNA from approximately 5 × 107 cells grown in tryptic soy broth was isolated using the RNeasy Midi Kit (Qiagen). The RNA was used to generate cDNA with random oligos (Promega). The relative abundance of esaC transcripts detected in Newman, esaB and esaC strains was measured qualitatively by PCR, using TaqDNA polymerase (Promega) with primers EsaC-NdeI-F and EsaC-XhoI-R and sdrE130F (tcgattttagtaggtacgac) and sdrE640R (tctacttttgaaggcgttgg) for amplification of esaC and sdrE specific DNA fragments, respectively. Real-time PCR (RT-PCR) was performed using the 7300 Real time PCR System (Applied Biosystems) and data analyzed and interpreted using Relative quantification study (Sequence Detection 1.3.1).

Renal abscess

Overnight cultures of S. aureus strains were diluted 1:100 into fresh tryptic soy broth and grown for 3 h at 37°C. Staphylococci were centrifuged, washed twice, and diluted in PBS to yield an OD660nm of 0.4 (3–5 × 107 cfu per ml). Viable staphylococci were enumerated by colony formation on tryptic soy agar plates to quantify the infectious dose. Mice were anesthetized by intraperitoneal injection of 80–120 mg of ketamine and 3–6 mg of xylazine per kilogram of body weight. One hundred μl of bacterial suspension (0.5 × 106 colony forming units) was administered intravenously via retro-orbital injection into BALB/c mice (24-day-old female, 10 mice per group, Charles River Laboratories, Wilmington, MA). On days 5 and 36, groups of ten mice were euthanized by compressed CO2 inhalation. Kidneys were removed and homogenized in PBS containing 1% Triton X-100. Aliquots of homogenates were diluted and plated on agar medium for triplicate determination of CFU. Student’s t-test was performed for statistical analysis using the software Analyse-it™. For histology, kidney tissue was incubated at room temperature in 10% formalin for 24 h. Tissues were embedded in paraffin, thin-sectioned, stained with hematoxylin/eosin, and examined by microscopy.

ELISA

Sera from infected individuals were obtained from the University of Chicago Hospitals Clinical Laboratory. These studies were carried out in accordance with an IRB protocol approved for the collection of sera from infected and healthy individuals. BALB/c mice were infected with one hundred μl of bacterial suspension (0.5 × 106 colony forming units) as described above. Blood samples were drawn by retro-orbital bleeding on days 0 and 30. Sera were examined by ELISA for IgG titers with specific antigen-binding activity. Animal experiments were performed in accordance with institutional guidelines following experimental protocol review and approval by the Institutional Animal Care and Use Committee.

Acknowledgments

We thank Katie Overheim and Alice Cheng for technical assistance, Glenn Randal for assistance with quantitative PCR, Julie Bubeck Wardenburg and members of the laboratory for discussion and Olaf Schneewind for careful reading of the manuscript. Monica L. Burts and Andrea C. DeDent acknowledge support from the Molecular Cell Biology Training Grant T32GM007183 at the University of Chicago. Dominique Missiakas acknowledges membership within the Region V ‘Great Lakes’ Regional Center of Excellence in Biodefense and Emerging Infectious Diseases Consortium and technical support from the GLRCE Small Animal and Immunology Core (GLRCE, National Institute of Allergy and Infectious Diseases Award 1-U54-AI-057153). The work was supported by the American Heart Organization Grant 0555690Z to D.M.

References

  • Abdallah AM, Verboom T, Hannes F, Safi M, Strong M, Eisenberg D, Musters RJ, Vandenbroucke-Grauls CM, Appelmelk BJ, Luirink J, Bitter W. A specific secretion system mediates PPE41 transport in pathogenic mycobacteria. Mol Microbiol. 2006;62:667–679. [PubMed]
  • Abdallah AM, Gey van Pittius NC, Champion PA, Cox J, Luirink J, Vandenbroucke-Grauls CM, Appelmelk BJ, Bitter W. Type VII secretion--mycobacteria show the way. Nat Rev Microbiol. 2007;5:883–891. [PubMed]
  • Andersen P, Andersen AB, Sorensen AL, Nagai S. Recall of long-lived immunity to Mycobacterium tuberculosis infection in mice. J Immunol. 1995;154:3359–3372. [PubMed]
  • Archer GL. Staphylococcus aureus: a well-armed pathogen. Clin Infect Dis. 1998;26:1179–1181. [PubMed]
  • Baba T, Bae T, Schneewind O, Takeuchi F, Hiramatsu K. Genome sequence of Staphylococcus aureus strain Newman and comparative analysis of staphylococcal genomes: polymorphism and evolution of two major pathogenicity islands. J Bacteriol. 2008;190:300–310. [PMC free article] [PubMed]
  • Bae T, Banger AK, Wallace A, Glass EM, Aslund F, Schneewind O, Missiakas DM. Staphylococcus aureus virulence genes identified by bursa aurealis mutagenesis and nematode killing. Proc Natl Acad Sci USA. 2004;101:12312–12317. [PMC free article] [PubMed]
  • Bae T, Schneewind O. Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid. 2006;55:58–63. [PubMed]
  • Bubeck Wardenburg J, Williams WA, Missiakas D. Host defenses against Staphylococcus aureus infection require recognition of bacterial lipoproteins. Proc Natl Acad Sci U S A. 2006;103:13831–13836. [PMC free article] [PubMed]
  • Burlak C, Hammer CH, Robinson MA, Whitney AR, McGavin MJ, Kreiswirth BN, Deleo FR. Global analysis of community-associated methicillin-resistant Staphylococcus aureus exoproteins reveals molecules produced in vitro and during infection. Cell Microbiol. 2007;9:1172–1190. [PMC free article] [PubMed]
  • Burts ML, Williams WA, DeBord K, Missiakas DM. EsxA and EsxB are secreted by an ESAT-6-like system that is required for the pathogenesis of Staphylococcus aureus infections. Proc Natl Acad Sci U S A. 2005;102:1169–1174. [PMC free article] [PubMed]
  • Champion PA, Stanley SA, Champion MM, Brown EJ, Cox JS. C-terminal signal sequence promotes virulence factor secretion in Mycobacterium tuberculosis. Science. 2006;313:1632–1636. [PubMed]
  • Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, Eiglmeier K, Gas S, Barry CE, 3rd, Tekaia F, Badcock K, Basham D, Brown D, Chillingworth T, Connor R, Davies R, Devlin K, Feltwell T, Gentles S, Hamlin N, Holroyd S, Hornsby T, Jagels K, Krogh A, McLean J, Moule S, Murphy L, Oliver K, Osborne J, Quail MA, Rajandream MA, Rogers J, Rutter S, Seeger K, Skelton J, Squares R, Squares S, Sulston JE, Taylor K, Whitehead S, Barrell BG. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature. 1998;393:537–544. [PubMed]
  • Dalbey RE, Wickner W. Leader peptidase catalyzes the release of exported proteins from the outer surface of the Escherichia coli plasma membrane. J Biol Chem. 1985;260:15925–15931. [PubMed]
  • Diep BA, Carleton HA, Chang RF, Sensabaugh GF, Perdreau-Remington F. Roles of 34 virulence genes in the evolution of hospital- and community-associated strains of methicillin-resistant Staphylococcus aureus. J Infect Dis. 2006a;193:1495–1503. [PubMed]
  • Diep BA, Gill SR, Chang RF, Phan TH, Chen JH, Davidson MG, Lin F, Lin J, Carleton HA, Mongodin EF, Sensabaugh GF, Perdreau-Remington F. Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Lancet. 2006b;367:731–739. [PubMed]
  • Dinges MM, Orwin PM, Schlievert PM. Exotoxins of Staphylococcus aureus. Clin Microbiol Rev. 2000;13:16–34. table of contents. [PMC free article] [PubMed]
  • Duthie ES, Lorenz LL. Staphylococcal Coagulase: Mode of Action and Antigenicity. J Gen Microbiol. 1952;6:95–107. [PubMed]
  • Fortune SM, Jaeger A, Sarracino DA, Chase MR, Sassetti CM, Sherman DR, Bloom BR, Rubin EJ. Mutually dependent secretion of proteins required for mycobacterial virulence. Proc Natl Acad Sci U S A. 2005;102:10676–10681. [PMC free article] [PubMed]
  • Foster TJ. Immune evasion by staphylococci. Nat Rev Microbiol. 2005;3:948–958. [PubMed]
  • Guinn KM, Hickey MJ, Mathur SK, Zakel KL, Grotzke JE, Lewinsohn DM, Smith S, Sherman DR. Individual RD1-region genes are required for export of ESAT-6/CFP-10 and for virulence of Mycobacterium tuberculosis. Mol Microbiol. 2004;51:359–370. [PMC free article] [PubMed]
  • Hsu T, Hingley-Wilson SM, Chen B, Chen M, Dai AZ, Morin PM, Marks CB, Padiyar J, Goulding C, Gingery M, Eisenberg D, Russell RG, Derrick SC, Collins FM, Morris SL, King CH, Jacobs WR., Jr The primary mechanism of attenuation of bacillus Calmette-Guerin is a loss of secreted lytic function required for invasion of lung interstitial tissue. Proc Natl Acad Sci USA. 2003;100:12420–12425. [PMC free article] [PubMed]
  • MacGurn JA, Raghavan S, Stanley SA, Cox JS. A non-RD1 gene cluster is required for Snm secretion in Mycobacterium tuberculosis. Mol Microbiol. 2005;57:1653–1663. [PubMed]
  • Mahairas GG, Sabo PJ, Hickey MJ, Singh DC, Stover CK. Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. J Bacteriol. 1996;178:1274–1282. [PMC free article] [PubMed]
  • Mazmanian SK, Ton-That H, Schneewind O. Sortase-catalysed anchoring of surface proteins to the cell wall of Staphylococcus aureus. Mol Microbiol. 2001;40:1049–1057. [PubMed]
  • McLaughlin B, Chon JS, MacGurn JA, Carlsson F, Cheng TL, Cox JS, Brown EJ. A mycobacterium ESX-1-secreted virulence factor with unique requirements for export. PLoS Pathog. 2007;3:e105. [PMC free article] [PubMed]
  • Musher DM, Lamm N, Darouiche RO, Young EJ, Hamill RJ, Landon GC. The current spectrum of Staphylococcus aureus infection in a tertiary care hospital. Medicine (Baltimore) 1994;73:186–208. [PubMed]
  • Novick RP. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol Microbiol. 2003;48:1429–1449. [PubMed]
  • Pallen MJ. The ESAT-6/WXG100 superfamily -- and a new Gram-positive secretion system? Trends Microbiol. 2002;10:209–212. [PubMed]
  • Pugsley AP. The complete general secretory pathway in Gram-negative bacteria. Microbiol Rev. 1993;57:50–108. [PMC free article] [PubMed]
  • Pym AS, Brodin P, Brosch R, Huerre M, Cole ST. Loss of RD1 contributed to the attenuation of the live tuberculosis vaccines Mycobacterium bovis BCG and Mycobacterium microti. Mol Microbiol. 2002;46:709–717. [PubMed]
  • Pym AS, Brodin P, Majlessi L, Brosch R, Demangel C, Williams A, Griffiths KE, Marchal G, Leclerc C, Cole ST. Recombinant BCG exporting ESAT-6 confers enhanced protection against tuberculosis. Nat Med. 2003;9:533–539. [PubMed]
  • Shaw L, Golonka E, Potempa J, Foster SJ. The role and regulation of the extracellular proteases of Staphylococcus aureus. Microbiology. 2004;150:217–228. [PubMed]
  • Sibbald MJ, Ziebandt AK, Engelmann S, Hecker M, de Jong A, Harmsen HJ, Raangs GC, Stokroos I, Arends JP, Dubois JY, van Dijl JM. Mapping the pathways to staphylococcal pathogenesis by comparative secretomics. Microbiol Mol Biol Rev. 2006;70:755–788. [PMC free article] [PubMed]
  • Sorensen AL, Nagai S, Houen G, Andersen P, Andersen AB. Purification and characterization of a low-molecular-mass T-cell antigen secreted by Mycobacterium tuberculosis. Infect Immun. 1995;63:1710–1717. [PMC free article] [PubMed]
  • Stanley SA, Raghavan S, Hwang WW, Cox JS. Acute infection and macrophage subversion by Mycobacterium tuberculosis require a specialized secretion system. Proc Natl Acad Sci USA. 2003;100:13001–13006. [PMC free article] [PubMed]
  • van den Ent F, Lowe J. Crystal structure of the ubiquitin-like protein YukD from Bacillus subtilis. FEBS Lett. 2005;579:3837–3841. [PubMed]
  • van Wely KH, Swaving J, Freudl R, Driessen AJ. Translocation of proteins across the cell envelope of Gram-positive bacteria. FEMS Microbiol Rev. 2001;25:437–454. [PubMed]
  • Xu J, Laine O, Masciocchi M, Manoranjan J, Smith J, Du SJ, Edwards N, Zhu X, Fenselau C, Gao LY. A unique Mycobacterium ESX-1 protein co-secretes with CFP-10/ESAT-6 and is necessary for inhibiting phagosome maturation. Mol Microbiol 2007 [PubMed]
  • Xu Y, Rivas JM, Brown EL, Liang X, Hook M. Virulence potential of the staphylococcal adhesin CNA in experimental arthritis is determined by its affinity for collagen. J Infect Dis. 2004;189:2323–2333. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...