Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Osteoarthritis Cartilage. Author manuscript; available in PMC Sep 1, 2009.
Published in final edited form as:
Osteoarthritis Cartilage. Sep 2008; 16(9): 1110–1117.
Published online Feb 20, 2008. doi:  10.1016/j.joca.2007.12.011
PMCID: PMC2596998
NIHMSID: NIHMS69967

Enhance and Maintain Chondrogenesis of Synovial Fibroblasts by Cartilage Extracellular Matrix Protein Matrilins

Ming Pei, MD, PhD, Junming Luo, MD, and Qian Chen, PhD*

Summary

Objective

Cartilage-specific extracellular matrix (ECM) proteins have been proposed to play key roles in modulating cellular phenotypes during chondrogenesis of mesenchymal stem cells. Matrilin (MATN) 1 and 3 are among the most up-regulated ECM proteins during chondrogenesis. The aim of this study was to analyze their roles in chondrogenesis of mesenchymal fibroblasts from synovium.

Methods

Primary synovial fibroblasts (SFBs) were purified from porcine synovium and incubated in pellet culture for 18 days. Chondrogenesis of SFB was analyzed by histological staining with safranin-O/fast green, and by quantifying glycosaminoglycans with dimethylmethylene blue assay. The mRNA levels of chondrogenic markers including collagen II, aggrecan, and Sox 9 were quantified by real-time RT-PCR, while the protein levels of Col II and matrilins were determined by western blot analysis.

Results

SFBs underwent chondrogenesis after incubation with TGF-β1 for three days; however, this process was attenuated during the subsequent incubation period. Expression of a MATN1 or 3 cDNA maintained and further enhanced chondrogenesis of SFBs as shown by increased cartilaginous matrix areas, elevated amount of glycosaminoglycans, and stimulated expression of chondrogenic markers.

Conclusion

Our findings suggest a novel function for MATN1 and 3 to maintain and enhance chondrogenesis of mesenchymal fibroblasts initiated by TGF-β. Our results also support a critical role of cartilage-specific ECM proteins to modulate cellular phenotypes in the microenvironment during chondrogenic differentiation.

Keywords: Matrilin, Synovium, Mesenchymal stem cells, Chondrogenesis, TGF-β

Introduction

Differentiation of mesenchymal stem cells (MSCs) provides promise for cell therapy and regenerative medicine1,2. In addition to bone marrow3,4, MSCs can be isolated from various adult mesenchymal tissues such as synovium57, periosteum8, skeletal muscle7, and adipose tissue9. However, it is not completely understood how the MSCs from those tissues initiate, progress, and maintain a particular differentiated cell phenotype.

Compared to other sources, the synovium is an excellent source of MSCs from the standpoint of utility as well as its high differentiation ability1012. Recent studies suggest that the synovial fibroblast (SFB) is a strong candidate for chondrogenic differentiation. Studies of the ontogenetic development of synovial joints have revealed that articular chondrocytes and synovial cells originate from a common precursor pool13 and exist in a close functional relationship not only during fetal development but also in adult life14. Furthermore, synovial cells have been shown to possess tremendous chondrogenic potential under various pathological conditions in vivo. For example, synovial chondromatosis is observed in disease states in which human chondroprogenitor cells of synovial origin sustain their high proliferative potential and capacity to differentiate into chondrocytes irrespective of the individual’s age5,15,16. Importantly, synovial cells share several properties with chondrocytes, including the production of extracellular matrix (ECM) proteins including cartilage oligomeric matrix protein (COMP)1719, link proteins20, and sulfated glycosaminoglycans (sGAG)21.

Despite recent progress in MSC research, very little is known about how synovial fibroblasts initiate and maintain chondrogenic progression. Our hypothesis is that the microenvironment surrounding cells, including both growth factors and extracellular matrix, play an important role in modulating cell phenotypes during chondrogenic differentiation. In particular, in this study, we test the relationship between TGF-β1, which has previously been shown to induce chondrogenesis of MSCs, and cartilage-specific ECM proteins matrilin (MATN)1 and 3 in initiating and maintaining chondrogenesis of synovial fibroblasts.

Matrilins are a family of non-collagenous ECM proteins consisting of four known members. Among them, MATN1 and 3 are expressed specifically in cartilage. MATN3 (Fig. 1A) is composed of a single N-terminal vWFA domain followed by four EGF repeats and a coiled-coil domain, whereas MATN1 (Fig. 1A) is composed of two vWFA domains separated by one EGF-like domain. Microarray studies identified MATN1 and 3 among the most up-regulated ECM proteins during chondrogenesis of MSCs in micromass culture in the presence of transforming growth factor β (TGF-β), dexamethasone, and bone morphogenetic protein (BMP)22,23. We have shown that, while MATN1 is expressed by the post-mitotic pre-hypertrophic chondrocytes in embryonic chickens24, MATN3 is expressed by both proliferating and pre-hypertrophic chondrocytes25. This expression pattern suggests that MATN1 or 3 may play a role in modulating chondrogenesis during the chondrocyte differentiation process.

Figure 1
A. cDNA constructs of MATN1 and 3.

Because of the tremendous up-regulation of MATN1 and 3 during chondrogenesis, we hypothesize that MATN1 or 3 may promote and facilitate in vitro cartilage formation of MSCs. In the present study, we tested this hypothesis by expressing MATN1 or 3 in primary synovial fibroblasts during chondrogenesis initiated by TGF-β1.

Materials and Methods

Cell culture reagents, including Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were from Gibco (Grand Island, NY). Hoechst 33258 dye was from Polysciences (Warrington, PA). Dimethylmethylene blue dye was from Aldrich (Milwaukee, WI). Transforming growth factor β1 (TGF-β1) was from R&D Systems (Minneapolis, MN). All other reagents were from Sigma (St. Louis, MO) unless otherwise specified.

HARVEST OF SYNOVIAL TISSUE

Each group of random biopsies of synovial tissue was obtained aseptically from the knee joints of two pigs. The tissue was placed in cell culture medium at room temperature and subjected to tissue digestion within 2 h by following the reported method26. Briefly, synovial tissue was finely minced, digested for 30 min at 37°C in phosphate-buffered saline (PBS) containing 0.1% trypsin (Roche, Indianapolis, IN) and thereafter digested in 0.1% collagenase P (Roche, Indianapolis, IN) in DMEM/10%FBS for 2 h at 37°C. The cell suspension was then put through a 70-μm nylon filter and the cells were collected by centrifugation. Cells were kept in primary culture for 4 days (DMEM/10%FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, including removal of non-adherent cells on Days 2 and 4) and subsequently used for SFB isolation.

NEGATIVE ISOLATION OF SYNOVIAL FIBROBLASTS

Mixed populations of synovial cells (SCs) contain fibroblasts, monocytes, and macrophages. For negative isolation of synovial fibroblasts from primary culture27, adherent synovial cells were detached by short-term trypsinization for less than 1 min (0.25% trypsin/0.2%EDTA, Gibco, Grand Island, NY) and 107/mL SCs were incubated with washed 4 × 107/mL Dynabeads® M-450 CD14 (clone RMO52; Dynal Biotech, Oslo, Norway) in PBS/2%FBS for 1 hour at 4°C on an orbital shaker. Dynabeads® CD14 are superparamagnetic polystyrene beads coated with a primary monoclonal antibody (mAb) specific for the CD14 membrane antigen predominantly expressed on monocytes and macrophages. PBS/2%FBS was then added to a final volume of 10 mL and the conjugated cells (monocytes and macrophages) and the unbound Dynabeads were collected using the Dynal® Magnetic Particle Concentrator (Dynal Biotech, Oslo, Norway). The depleted supernatant with SFBs was transferred to a new tube for further study.

CLONING AND CONSTRUCTION OF MATN1 AND 3 CDNAS

Full-length cDNAs of chicken MATN1 and mouse MATN3 were cloned by reverse transcription (RT)-PCR from the RNA isolated from sternal cartilage of 17-day-old chicken embryos and newborn mice, respectively. Total RNA was isolated using the RNeasy kit (Qiagen, Valencia, CA). RT-PCRs of MATN1 and MATN3 were performed individually using the Titan one tube RT-PCR system (Boehringer Mannheim, Indianapolis, IN) according to manufacturer’s instructions. The nucleotide sequences of MATN1 and MATN3 cDNAs were confirmed individually by DNA sequencing. Those cDNAs were cloned into an expression vector pcDNA3.1/V5-His (Invitrogen, Carlsbad, CA).

TRANSFECTION OF MATN1 AND 3 CDNAS

SFBs were plated in DMEM containing 10% FBS at 1.8 × 106 cells per 25 cm2 tissue culture flask (about 70–80% confluent) the day before the FuGENE 6 Reagent (Roche, Indianapolis, IN) transfection experiment. Transfection of MATN1 and 3 was performed in serum-free medium according to the FuGENE 6 reagent protocol from Roche. The optimal working concentration was determined by using 8 μg of plasmid DNA and 12 μl of FuGENE 6 Transfection Reagent. The monolayer SFBs were incubated in the above mixture for five hours, followed by the addition of FBS (the final concentration of FBS was 5%) overnight. The next day the medium was changed into DMEM containing 10% FBS.

PELLET TISSUE CULTURE SYSTEM

After a two-day incubation, SFBs transfected with MATN1 and MATN3 cDNAs were detached individually by trypsinization with 0.25% trypsin/0.2%EDTA. SFBs with mock transfection served as a control. The presence or absence of vector DNA in mock transfections did not affect chondrogenesis of SFBs. 0.3 × 106 cells were centrifuged at 500 g for 10 min in a 15 ml tube to form a pellet. The pellets were cultured in 24-well plates (2 ml medium per well) on a rotating shaker in a humid 5% CO2/95% air incubator with a defined medium, including High-Glucose DMEM, 40 μg/mL proline, 100 nM dexamethasone, 0.1 mM ascorbic acid 2-phosphate (Wako, Richmond, VA), 100 U/ml penicillin, 100 mg/L streptomycin, and 1× ITS+Premix (Collaborative Biomedical Products: insulin (6.25 μg/mL), transferrin (6.25 μg/mL), selenous acid (6.25 μg/mL), and linoleic acid (5.35 μg/mL), with bovine serum albumin (1.25 μg/mL)) with the supplementation of 10 ng/ml TGF-β1. SFBs without TGF-β1 treatment served as a control. The medium was changed every other day. The time points were days 0, 3, 11, and 18.

HISTOLOGY AND IMMUNOHISTOCHEMISTRY

Representative pellets (n=3 specimens per data point) were fixed for 24 h at 4°C in 4% paraformaldehyde in PBS (pH 7.4), dehydrated in a series of ethanols, cleared in xylene, embedded in paraffin, and sectioned to 5 μm. The sections were stained with safranin-O/fast green for GAG and counterstained with hematoxylin for the nucleus. The percentage of safranin-O positive areas was quantified under the microscope using NIH Imagine J.

Immunohistochemistry was carried out using the Histostain-SP Kits (Zymed, San Francisco, CA). Endogenous peroxidase was blocked by treating the sections with 1% hydrogen peroxide in methanol for 30 min. The sections were digested by 2 mg/mL hyaluronidase for 30 min. Nonspecific protein binding was blocked by incubation with 10% normal goat serum. The sections were incubated in affinity-isolated Ig G fractions of monoclonal mouse antibody against chicken MATN1 (1:200, 1H1) at 4°C overnight. The negative control sections were incubated with 0.01 M PBS. Thereafter, the sections were treated sequentially with ready-to-use biotinylated secondary antibody and streptavidin-perovidin conjugate (Invitrogen), followed by standardized development in diaminobenzidine (Invitrogen). The sections were counterstained with hematoxylin.

BIOCHEMICAL ANALYSES AND WESTERN BLOT

Representative pellets (n=3 specimens per data point) were digested for 4 hours at 60°C with 125 μg/mL of papain in PBE buffer (100 mM phosphate, 10 mM EDTA, pH 6.5) containing 10 mM cysteine. DNA content was measured with the use of Hoechst 33258 dye and a spectrofluorometer (QM-1; Photon Technology International, South Brunswick, NJ) with type I calf thymus DNA (Sigma) as a standard. GAG amount was measured by using dimethylmethylene blue dye28 and a spectrophotometer (Perkin Elmer, Norwalk, CT) with bovine chondroitin sulfate as a standard. Western blot analysis was performed using standard protocols. The primary antibodies used were a monoclonal antibody against collagen II (diluted 1:200, NeoMarkers, Fremont, CA), and a monoclonal antibody against V5 (diluted 1:5000, Invitrogen). Horseradish peroxidase conjugated goat anti-mouse or goat anti-rabbit IgG (H+L) (Bio-Rad Laboratories, Melville, NY), diluted 1:5,000, was used as a secondary antibody.

RNA ISOLATION AND REAL-TIME QUANTITATIVE RT-PCR

Total RNA was extracted from pellets by homogenizing using an RNase-free pestle in TRIzol reagent (Life Technologies, Inc., Grand Island, NY) and RNeasy Mini Kit (Qiagen, Valencia, CA) according to manufacturer’s instructions. RNAs were used for oligo(dT)12-18-primed cDNA synthesis using SuperScript II RT (Invitrogen, Carlsbad, CA). Quantification of mRNAs was performed by real-time quantitative RT-PCR with DyNAmoSYBR Green qPCR Kit and DNA Engine Opticon system (MJ Research, Inc., Waltham, MA). Several gene markers of pig species were focused on, including aggrecan gene (forward primer is TGCAGGTGACCATGGCC and reverse primer is CGGTAATGGAACACAACCCCT), collagen I gene (forward primer is CTGGTGATGCTGGTCCTGTTG and reverse primer is CCTTGGGGTTCTTGCTGATGT), collagen II gene (forward primer is CCGCCTTTGCTGGCTTAGGCCCG and reverse primer is CCACCATTGATGGTTTCTCCAAACC), collagen X gene (forward primer is ACGGGCAACAGCACTATGACC and reverse primer is GCACTCCCTGAAGCCTGATCC), and Sox 9 gene (forward primer is GTGCTCAAGGGCTACGACTGG and reverse primer is CCGCTTCTCGCTCTCATTCAG). The cycle parameters were 95°C for 10 min to activate the Tbr DNA polymerase, then 39 cycles at 94°C for 10 sec denaturation, followed by 55°C for 20 sec annealing and 72°C for 20 sec extension. The last extension was 72°C for 5 min. The 18S RNA (forward primer is CGGCTACCACATCCAAGGAA and reverse primer is GCTGGAATTACCGCGGCT) was amplified at the same time and used as an internal control. The cycle threshold (Ct) values for 18S RNA and that of samples were measured and calculated by computer software (Perkin-Elmer, Wellesley, MA). Relative transcript levels were calculated as x = 2−ΔΔCt, in which ΔΔCt = ΔE − ΔC, and ΔE = Ctexp−Ct18s; ΔC = Ctct1−Ct18s29.

STATISTICAL ANALYSES

Statistics was assessed by one-way analysis of variance (ANOVA); p values less than 0.05 were considered statistically significant.

Results

IN VITRO CHONDROGENESIS OF SFBs

To study chondrogenesis of SFBs, we incubated purified SFBs in a pellet culture under serum-free conditions in a chemically defined medium with or without the supplementation of 10 ng/ml TGF-β1 for 18 days. In a parallel set of experiments, SFBs were transfected with a full-length MATN1 or 3 cDNA before culture incubation. The pellet culture was refreshed with medium containing TGF-β1 every other day in TGF-β1 supplementation groups. The SFB pellets were collected for histological, biochemical, and molecular analysis during the incubation period at day 0, 3, 11, and 18.

MATN1 AND 3 ENHANCE AND MAINTAIN CHONDROGENESIS OF SFBS

Histological analysis was performed with safranin O that stains highly sulfated cartilage proteoglycans (Fig. 1B). It indicated that SFBs underwent chondrogenesis in the peripheral regions of the pellet after three days incubation in the presence of TGF-β1 (Fig. 1B, A1). However, chondrogenic differentiation of SFBs was reduced by day 11 (Fig. 1B, A2), and further diminished by day 18 (Fig. 1B, A3), despite the presence of TGF-β1.

In contrast to the control SFBs, the SFBs expressing MATN1 or 3 maintained chondrogenesis throughout the incubation period (Fig. 1B, B1, B2, B3, and C1, C2, C3). Furthermore, both the overall sizes of the pellet and the chondrogenic areas in the pellet were larger in SFBs expressing MATN1 or 3 than in control SFBs (Fig. 1B).

Quantitative microscopic analysis indicated that while the safranin O positive areas decreased gradually in control SFB pellets during the incubation period, SFB pellets expressing MATN1 or 3 increased their chondrogenic areas from day 3 to day 11, and maintained their chondrogenic areas from day 11 to day 18 (Fig. 2A).

Figure 2
Enhancement of chondrogenesis by the expression of MATN1 or MATN3 in SFB pellet culture. (A) Quantification of the percentage of safranin O positive areas in SFB pellet sections. * significantly lower than the corresponding control group, * for p< ...

Biochemical analysis indicated that the total amount of sulfated glycosaminoglycans (sGAG) in the control SFB pellet decreased from day 3 to day 11, and from day 11 to day 18 during the incubation period (Fig. 2B). However, the total GAG amount increased in MATN1 or 3 expressing SFBs from day 3 to day 11, and maintained from day 11 to 18 during the incubation period. Biochemical quantification of the total DNA amount per pellet indicated that the cell number in all SFB pellets decreased over the incubation period (Fig. 2C). However, the SFB pellets expressing MATN1 or 3 consistently contained more than 20% of cells than the control SFBs.

MOLECULAR ANALYSIS OF CHONDROGENIC MARKERS

To determine the effect of matrilins on chondrogenesis of SFBs at the molecular level, we quantified the protein levels of matrilins and type II collagen using western blot analysis. Expression of MATN1 and 3 was demonstrated by the positive identification of recombinant matrilins in MATN1 or 3 expressing SFBs (Fig. 3A). The level of type II collagen was higher in MATN1 or 3 expressing cells than that from control cells (Fig. 3B, ,3D).3D). In contrast, the levels of housekeeping protein β-actin remain constant (Fig. 3C). Immunohistochemical analysis using a monoclonal antibody against MATN1 showed MATN1 was distributed throughout the pellet in MATN1 expressing SFBs (Fig. 3E).

Figure 3
Western blot analysis of expression levels of matrilins (A) and collagen type II (B) in the pelleted SFBs transfected with either MATN1 or MATN3 at day 11. β-actin served as an intrinsic housekeeping protein (C). An equal amount of protein was ...

Next, we quantified the relative mRNA levels of chondrogenic markers including collagen type II (α1), aggrecan core protein, and Sox 9 using real-time quantitative RT-PCR. The mRNA levels of all three chondrogenic markers were dramatically increased in MATN1 or 3 expressing SFBs than in control SFBs on day 11, although they were similar among different groups on day 3 and day 18 (Fig. 4, A,B,C). The extent of stimulation was different between MATN1 and 3 expressing cells, with MATN1 expressing cells exhibiting a higher extent of stimulation for chondrogenic markers. The extent of stimulation for chondrogenic markers by MATN1 and 3 was reduced in day 18 samples. The same trend existed to a smaller extent for the mRNA level of hypertrophic chondrocyte marker collagen type X (α1) (Fig. 4D). In contrast, only a small difference (< 2 fold) was observed among different SFB groups for the fibroblast marker collagen type I (α1) (Fig. 4E).

Figure 4
Real time RT-PCR analysis of chondrogenic markers Col II (A), aggrecan (B), and Sox 9 (C), and hypertrophic chondrocyte marker Col X (D), and fibroblast marker Col I (E). Compared to the control at day 3, expression of either MATN1 or MATN3 resulted in ...

MATRILIN ENHANCEMENT OF SFB CHONDROGENESIS IS TGF-β1 DEPENDENT

To study the effect of TGF-β in combination with matrilins in SFB chondrogenesis, we carried out two parallel SFB pellet culture incubations either in the presence or absence of 10 ng/mL TGF-β1. In the absence of TGF-β1 treatment, the GAG amount per pellet decreased 77.8% from day 3 to day 11, and decreased 33.3% from day 11 to day 18. Expression of MATN1 or 3 in SFBs could not reverse this trend (Fig. 5A). In the presence of TGF-β1 treatment, the GAG amount in the control group was decreased 4.3% from day 3 to day 11, and decreased 38.6% per pellet from day 11 to day 18 (Fig. 5B). However, in MATN1 or 3 expression groups, the GAG amount increased 23% per pellet from day 3 to day 11 and maintained this level from day 11 to day 18.

Figure 5
Enhancement of chondrogenesis by the expression of MATN1 or MATN3 in SFB pellet culture requires the presence of TGF-β1. The amount of glycosaminoglycans (A, B) and the amount of DNA were quantified within the SFB pellets either in the absence ...

In the absence of TGF-β1 treatment, the cell number (DNA amount per pellet) decreased 78.8% from day 3 to 11, and decreased 50% from day 11 to day 18 (Fig. 5C). The MATN1 or 3 expression groups exhibited the same extent of cell number decrease as the control group (Fig. 5C). In the presence of TGF-β1, the cell number per pellet for the control group decreased 52.9% from day 3 to 11 and another 33.3% from day 11 to 18 (Fig. 5D). In comparison, the cell number per pellet in MATN 1 or 3 expressing SFBs decreased only 43% from day 3 to 11 and only 11.4% from day 11 to 18. Taken together, these data suggest that the pro-chondrogenic effect of matrilins on SFB proliferation and differentiation is dependent on the presence of TGF-β1.

Discussion

Chondrocytes are prone to de-differentiation to fibroblasts, especially under in vitro culture conditions. This poses a significant challenge to tissue engineering of stem cells for chondrogenesis. In this study, we show that initiation and maintenance of chondrogenesis of synovial fibroblasts in vitro requires both TGF-β1 treatment and the expression of cartilage matrix protein MATN1 or 3. Our study reveals that the actions of TGF-β1 and matrilins depend on each other and that they may play different roles during chondrogenesis of synovial fibroblasts.

Treatment with TGF-β1 alone initiates chondrogenesis, but is not sufficient to maintain chondrogenic differentiation of SFBs without the expression of MATN1 or 3. A previous study has shown that TGF-β1 induces in vitro cartilage formation from MSCs5. We show that TGF-β1 at 10ng/ml induced chondrogenesis in the peripheral region of the SFB pellet. This is a concentration dependent phenomenon, since TGF-β1 at higher concentrations (e.g. 30–40ng/ml) induced chondrogenesis throughout the pellet27. However, SFBs incubated in TGF-β1 at higher concentrations also had less DNA content in the pellet27. Subsequent investigations have also shown that TGF-β alone is not sufficient to fully differentiate MSCs into chondrocytes12,30. Other growth factors such as BMPs, in particular BMP-2, are necessary for the chondrogenic differentiation process10. It is not clear why other factors in addition to TGF-β are required to sustain the differentiation process, but one of the possible mechanisms is to provide a cartilage specific ECM environment to facilitate the chondrogenic differentiation process31.

We showed that the exogenous expression of MATN1 or 3, two ECM proteins expressed specifically in developing cartilage during endochondral bone formation25,32,33, not only maintains but also enhances SFB chondrogenesis initiated by TGF-β. This role may occur in the three periods of in vitro chondrogenesis of SFBs. In the early period (day 0 to 3 of pellet culture incubation), the presence of MATN1 or 3 increases the cell number per pellet to 120% of the control group (Fig. 2C). This difference of cell number is maintained throughout the entire pellet culture period (Fig. 2C). Thus, matrilins increase the cell number during the early period of chondrogenesis. In the middle period (between day 3 to 11), the presence of MATN1 or 3 increases the total GAG amount per pellet to 136% of the control group (Fig. 2B). Molecular analysis using real-time RT-PCR and western blot indicate that the synthesis of chondrogenic markers including aggrecan, collagen II, and Sox 9 is increased in the matrilin expressing SFB groups on day 11 (Fig. 3 and and4),4), which is supported by the data from the histological and biochemical analysis of chondrogenesis (Fig. 1 and and2).2). Thus, matrilins enhance expression of chondrogenic markers during this stage. In the late period (between day 11 and 18), there is a sharp decline of the GAG amount and the cartilage proteoglycan-positive areas in the control group pellets. However, in matrilin expressing pellets, the levels of the GAG amount and the cartilage proteoglycan positive areas remain constant between day 11 and day 18 (Fig. 1 and and2).2). Therefore, matrilins maintain chondrogenesis of SFBs in the late stage.

We have shown that enhancement and maintenance of SFB chondrogenesis by MATN1 and 3 are critically dependent on the presence of TGF-β1. Without TGF-β, neither MATN1 nor MATN3 can stimulate chondrogenesis by itself. Thus, we established a co-requirement of a growth factor (TGF-β) and a cartilage ECM molecule (MATN1 or 3) during in vitro chondrogenesis of SFBs. There are at least two possible mechanisms to explain why matrilins are required in chondrogenesis initiated by TGF-β. The first is their structural role and the second is their regulatory role in cartilage extracellular matrix.

Matrilins are putative adaptor proteins of the ECM in which they form both collagen dependent and independent filamentous networks34. MATN1 and 3 have been shown to stabilize the cartilage matrix structure by forming a filamentous network to connect different types of matrix ligands. Matrilins interact with collagen type II, type IX, aggrecan, small proteolycans, COMP, and integrin α1β135,36. Thus, the presence of MATN1 or 3 may maintain the chondrogenic phenotype of differentiated SFBs by stabilizing cartilage-specific matrix structures. Previous studies have shown that adhesiveness to various ECM determines the differentiation of embryonic stem cells in such a way that efficient cell-cell aggregation, together with less efficient cell attachment and spreading, results in more efficient cell differentiation37.

Matrilins may also play a regulatory role in chondrogenesis of SFBs by sustaining the transduction of TGF-β signals to these cells. It has been shown previously that ECM in cartilage may serve as a matrix reservoir of TGF-β. For example, small proteoglycans such as biglycan and decorins bind TGF-β thereby modulating its biological effects38,39. Although it is not known whether TGF-β is a ligand of the matrilin family, matrilins have been demonstrated to interact with small proteglycans that bind TGF-β35, which may in turn affect TGF-β signaling. Thus, matrilins may enhance the availability of TGF-β to the cells by regulating its presence in the pellet matrix during chondrogenesis of SFBs. These possible mechanisms remain to be tested in future studies.

In summary, our finding that MATN1 and 3 enhance and maintain chondrogenesis of SFBs induced by TGF-β supports the hypothesis that not only the inductive growth factors, but also the conductive ECM may be required for sustaining chondrogenic differentiation of MSCs. It reveals a novel function of MATN1 and 3 in modulating chondrogenesis of SFBs. It may have strong implications for the successful utilization of tissue engineering for inducing and maintaining cartilage formation from MSCs.

Supplementary Material

01

Acknowledgments

Supported by a Research Grant from the AO Foundation to M.P., and grants AG14399, AG17021, and RR024484 from NIH to Q.C.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Caplan AI. Review: mesenchymal stem cells: cell-based reconstructive therapy in orthopedics. Tissue Eng. 2005;11:1198–211. [PubMed]
2. Ringe J, Kaps C, Burmester GR, Sittinger M. Stem cells for regenerative medicine: advances in the engineering of tissues and organs. Naturwissenschaften. 2002;89:338–51. [PubMed]
3. Worster AA, Brower-Toland BD, Fortier LA, Bent SJ, Williams J, Nixon AJ. Chondrocytic differentiation of mesenchymal stem cells sequentially exposed to transforming growth factor-beta1 in monolayer and insulin-like growth factor-I in a three-dimensional matrix. J Orthop Res. 2001;19:738–49. [PubMed]
4. Goldberg VM, Caplan AI. Biological resurfacing: an alternative to total joint arthroplasty. Orthopedics. 1994;17:819–21. [PubMed]
5. Nishimura K, Solchaga LA, Caplan AI, Yoo JU, Goldberg VM, Johnstone B. Chondroprogenitor cells of synovial tissue. Arthritis Rheum. 1999;42:2631–7. [PubMed]
6. Hunziker EB, Rosenberg LC. Repair of partial-thickness defects in articular cartilage: cell recruitment from the synovial membrane. J Bone Joint Surg Am. 1996;78:721–33. [PubMed]
7. Iwata H, Ono S, Sato K, Sato T, Kawamura M. Bone morphogenetic protein-induced muscle- and synovium-derived cartilage differentiation in vitro. Clin Orthop. 1993;296:295–300. [PubMed]
8. O’Driscoll SW, Fitzsimmons JS. The role of periosteum in cartilage repair. Clin Orthop. 2001;391(Suppl):190–207. [PubMed]
9. Nathan S, Das De S, Thambyah A, Fen C, Goh J, Lee EH. Cell-based therapy in the repair of osteochondral defects: a novel use for adipose tissue. Tissue Eng. 2003;9:733–44. [PubMed]
10. Sakaguchi Y, Sekiya I, Yagishita K, Muneta T. Comparison of human stem cells derived from various mesenchymal tissues: superiority of synovium as a cell source. Arthritis Rheum. 2005;52:2521–9. [PubMed]
11. Mochizuki T, Muneta T, Sakaguchi Y, Nimura A, Yokoyama A, Koga H, et al. Higher chondrogenic potential of fibrous synovium- and adipose synovium-derived cells compared with subcutaneous fat-derived cells: distinguishing properties of mesenchymal stem cells in humans. Arthritis Rheum. 2006;54:843–53. [PubMed]
12. Shirasawa S, Sekiya I, Sakaguchi Y, Yagishita K, Ichinose S, Muneta T. In vitro chondrogenesis of human synovium-derived mesenchymal stem cells: optimal condition and comparison with bone marrow-derived cells. J Cell Biochem. 2006;97:84–97. [PubMed]
13. Pacifici M, Koyama E, Iwamoto M, Gentili C. Development of articular cartilage: what do we know about it and how may it occur? Connect Tissue Res. 2000;41:175–84. [PubMed]
14. Bandara G, Georgescu HI, Lin CW, Evans CH. Synovial activation of chondrocytes: evidence for complex cytokine interactions. Agents Actions. 1991;34:285–8. [PubMed]
15. De Bari C, Dell’Accio F, Vandenabeele F, Vermeesch JR, Raymackers JM, Luyten FP. Skeletal muscle repair by adult human mesenchymal stem cells from synovial membrane. J Cell Biol. 2003;160:909–18. [PMC free article] [PubMed]
16. Yokoyama A, Sekiya I, Miyazaki K, Ichinose S, Hata Y, Muneta T. In vitro cartilage formation of composites of synovium-derived mesenchymal stem cells with collagen gel. Cell Tissue Res. 2005;322:289–98. [PubMed]
17. Di Cesare PE, Carlson CS, Stollerman ES, Chen FS, Leslie M, Perris R. Expression of cartilage oligomeric matrix protein by human synovium. FEBS Lett. 1997;412:249–52. [PubMed]
18. Dodge GR, Hawkins D, Boesler E, Sakai L, Jimenez SA. Production of cartilage oligomeric matrix protein (COMP) by cultured human dermal and synovial fibroblasts. Osteoarthritis Cartilage. 1998;6:435–40. [PubMed]
19. Recklies AD, Baillargeon L, White C. Regulation of cartilage oligomeric matrix protein synthesis in human synovial cells and articular chondrocytes. Arthritis Rheum. 1998;41:997–1006. [PubMed]
20. Fife RS, Caterson B, Myers SL. Identification of link proteins in canine synovial cell cultures and canine articular cartilage. J Cell Biol. 1985;100:1050–5. [PMC free article] [PubMed]
21. Hamerman D, Smith C, Keiser HD, Craig R. Glycosaminoglycans produced by human synovial cell cultures. Coll Relat Res. 1982;2:313–29. [PubMed]
22. Stokes DG, Liu G, Coimbra IB, Piera-Velazquez S, Crowl RM, Jimenez SA. Assessment of the gene expression profile of differentiated and dedifferentiated human fetal chondrocytes by microarray analysis. Arthritis Rheum. 2002;46:404–19. [PubMed]
23. Sekiya I, Vuoristo JT, Larson BL, Prockop DJ. In vitro cartilage formation by human adult stem cells from bone marrow stroma defines the sequence of cellular and molecular events during chondrogenesis. Proc Natl Acad Sci USA. 2002;99:4397–402. [PMC free article] [PubMed]
24. Chen Q, Johnson DM, Haudenschild DR, Goetinck PF. Progression and recapitulation of the chondrocyte differentiation program: cartilage matrix protein is a marker for cartilage maturation. Dev Biol. 1995;172:293–306. [PubMed]
25. Zhang Y, Chen Q. Changes of matrilin forms during endochondral ossification - Molecular basis of oligomeric assembly. J Biol Chem. 2000;275:32628–34. [PubMed]
26. Zimmermann T, Kunisch E, Pfeiffer R, Hirth A, Stahl HD, Sack U, et al. Isolation and characterization of rheumatoid arthritis synovial fibroblasts from primary culture-primary culture cells markedly differ from fourth-passage cells. Arthritis Res. 2001;3:72–6. [PMC free article] [PubMed]
27. Pei M, Aaron RK, Ciombor DM. Engineered cartilage from synovium-A developmental approach. Trans Orthop Res Soc. 2004;29:720.
28. Farndale RW, Buttler DJ, Barrett AJ. Improved quantitation and discrimination of sulphated glycosaminoglycans by the use of dimethylmethylene blue. Biochim Biophys Acta. 1986;883:173–7. [PubMed]
29. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–8. [PubMed]
30. De Bari C, Dell’Accio F, Luyten FP. Failure of in vitro-differentiated mesenchymal stem cells from the synovial membrane to form ectopic stable cartilage in vivo. Arthritis Rheum. 2004;50:142–50. [PubMed]
31. Derfoul A, Perkins GL, Hall DJ, Tuan RS. Glucocorticoids Promote Chondrogenic Differentiation of Adult Human Mesenchymal Stem Cells by Enhancing Expression of Cartilage Extracellular Matrix Genes. Stem Cells. 2006;24:1487–95. [PubMed]
32. Wu JJ, Eyre DR. Matrilin-3 forms disulfide-linked oligomers with matrilin-1 in bovine epiphyseal cartilage. J Biol Chem. 1998;273:17433–8. [PubMed]
33. Deak F, Wagener R, Kiss I, Paulsson M. The matrilins: a novel family of oligomeric extracellular matrix proteins. Matrix Biol. 1999;18:55–64. [PubMed]
34. Chen Q, Johnson DM, Haudenschild DR, Tondravi MM, Goetinck PF. Cartilage matrix protein forms a type II collagen-independent filamentous network: analysis in primary cell cultures with a retrovirus expression system. Mol Biol Cell. 1995;6:1743–53. [PMC free article] [PubMed]
35. Wiberg C, Klatt AR, Wagener R, Paulsson M, Bateman JF, Heinegard D, et al. Complexes of matrilin-1 and biglycan or decorin connect collagen VI microfibrils to both collagen II and aggrecan. J Biol Chem. 2003;278:37698–704. [PubMed]
36. Makihira S, Yan W, Ohno S, Kawamoto T, Fujimoto K, Okimura A, et al. Enhancement of cell adhesion and spreading by a cartilage-specific noncollagenous protein, cartilage matrix protein (CMP/Matrilin-1), via integrin alpha1beta1. J Biol Chem. 1999;274:11417–23. [PubMed]
37. Chen SS, Fitzgerald W, Zimmerberg J, Kleinman HK, Margolis L. Cell-Cell and Cell-Extracellular Matrix Interactions Regulate Embryonic Stem Cell Differentiation. Stem Cells. 2007;25:553–61. [PubMed]
38. Hocking AM, Shinomura T, McQuillan DJ. Leucine-rich repeat glycoproteins of the extracellular matrix. Matrix Biol. 1998;17:1–19. [PubMed]
39. Takeuchi Y, Kodama Y, Matsumoto T. Bone matrix decorin binds transforming growth factor-beta and enhances its bioactivity. J Biol Chem. 1994;269:32634–8. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...