• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Dent Res. Author manuscript; available in PMC Dec 5, 2008.
Published in final edited form as:
PMCID: PMC2596760
NIHMSID: NIHMS71850

Overlapping DSPP Mutations Cause DD and DGI

Abstract

Dentinogenesis imperfecta (DGI) and dentin dysplasia (DD) are allelic disorders due to mutations in DSPP. Typically, the phenotype breeds true within a family. Recently, two reports showed that three different net -1 bp frameshift mutations early in DSPP's repeat domain caused DD whereas six, more 3′ frameshift mutations, were associated with DGI. Here we identify a DD kindred with a novel -1 bp frameshift (c.3141delC) that falls within the portion of the DSPP repeat domain previously associated solely with the DGI phenotype. This new frameshift mutation shows that overlapping DSPP mutations can give rise to either DGI or DD phenotypes. Furthermore, the consistent kindred presentation of the DD or DGI phenotype appears to be dependent on an as yet undescribed genetic modifier closely linked to DSPP.

Keywords: DSPP, dentinogenesis imperfecta, dentin dysplasia, DPP

Introduction

DSPP (dentin sialophosphoprotein) is the largest member of the SIBLING (Small, Integrin-Binding LIgand, N-linked Glycoprotein) gene family, due to the presence of ~250 tandem copies of a nominal 9-basepair repeat encoding the SerSerAsp tripeptide (Bellahcene et al., 2008; Fisher et al., 2001). DSPP encodes a ~1300 amino acid protein that is cleaved into the two major non-collagenous proteins found in human dentin, dentin sialoprotein (DSP) and the repeat-containing dentin phosphoprotein (or phosphophoryn, DPP) (George et al., 1999; MacDougall et al., 1997). Two classes of dentin disorders have been directly correlated with DSPP mutations. Dentinogenesis imperfecta (DGI types II, and III: OMIM 125490 and OMIM 125500) and dentin dysplasia (DD type II: OMIM 125420) are dominantly inherited, nonsyndromic diseases of dentin. Clinically, these diseases are characterized by opalescent, amber-brown teeth with enamel that has an increased propensity to fracture during mastication due to the defective underlying dentin and thus leaving the exposed dentin vulnerable to rapid wear and caries. Both diseases are also often characterized by the radiographic appearance of bulbous crowns and obliterated pulps. One major clinical difference between DGI and DD is that the visible portions of the crowns of the secondary teeth appear relatively normal in DD although thistle-shaped pulps, pulp stones, and pulpal obliteration may be observed radiographically.

Despite these two diseases having some distinguishing clinical characteristics, all mutations to date have been identified within the DSPP gene. Mutations in the signal peptide were shown to cause both DD and DGI phenotypes (Malmgren et al., 2004; Rajpar et al., 2002). Recently in two DD and five DGI families for which no mutations could be found within the DSP portion of the DSPP gene, we identified frameshift mutations in the ~2.4kb repeat domain of exon 5 (DPP) in all affected patients (McKnight et al., 2008). These -1 bp or -4 bp (i.e. net -1 bp) frameshift mutations did not result in premature truncation of the DSPP products but immediately changed its normally hydrophilic carboxy-terminal domain into one that was hydrophobic. This class of mutations was proposed to cause a dominant-negative disorder through disruption of the cell's protein trafficking system. Interestingly, the DD families had their frameshift mutations within the 5′ portion of the repeat resulting in the two longest hydrophobic domains while all of the DGI patients had more 3′ frameshifts with correspondingly shorter hydrophobic carboxy-termini. At the same time, Song et al. (2008) reported related (net -1 bp) frameshift mutations in one DD and four DGI families (Song et al., 2008). The combination of the two results continued to suggest that DD frameshifts were 5′ to all DGI mutations in DPP.

In this paper a new DD-causing -1 bp frameshift mutation is identified within the hypothesized DGI-associated portion of DSPP. This new mutation is discovered in a previously described four-generation DD family for whom the mutation was unknown (Beattie et al., 2006).

Methods

Patient information

The four-generation family segregating autosomal dominant DD was previously linked to the DSPP region of chromosome 4q21 but no specific mutation was identified (Beattie et al., 2006). Clinical findings for affected family members were a severe phenotype in the primary dentition including amber discoloration and coronal translucency of the crowns, as well as radiographic appearance of bulbous crowns with pulpal obliteration. The secondary dentition exhibited a much milder clinical presentation, with only a slight grey discoloration, and radiographic evidence of thistle shaped pulps and pulpal mineralization. One affected family member (III-9) was described as having a more severe DD phenotype in the secondary teeth but not severe enough to be considered DGI. DNA samples from one unaffected family member (III-8) and two affected family members (III-2 and III-9) were obtained in accordance with study protocols approved by Institutional Review Boards at the University of Michigan and the National Institutes of Health and informed consents were obtained.

Sequencing of the DSPP repeat (DPP portion)

The ~2.4 kb DPP and the 3′ hypervariable ~1.2 kb (DSPP HVRR) repetitive portions of exon 5 were separately amplified by PCR, cloned into pCR4-TOPO plasmids (Invitrogen) using MAX Efficiency® Stbl2™ cells (Invitrogen), sequenced and analyzed as previously described (McKnight et al., 2008).

Sequencing of DSPP promoter and 3′ untranslated region (UTR)

The DD patient (III-9) originally described in Beattie et al. (2006) as well as three previously described patients (DD-3, DGI-2 and DGI-3) from McKnight et al. (2008) were used to correlate the disease phenotype with normal variation in the DSPP promoter and 3′ UTR. The basic DSPP promoter (626 bp 5′ to exon 1) was amplified with oligonucleotides (Forward, 5′ GTCTTTATGCACCTTTGGAC 3′ and Reverse; 5′ GTTTGAAAGCCCAAGGTGG 3′) while 480 bp 3′ to the stop codon (UTR) were amplified using (Forward; 5′ AGTCCATGCAAGGAGATGATCC 3′ and Reverse; 5′ CAAGTTGGCTATCACAGTAC 3′) based on the DSPP (Genbank accession number NM_014208) and surrounding sequences on the UCSC Genome Browser (http://genome.ucsc.edu/). Both PCR conditions were 94°C for 5 min and then 35 cycles of 94°C for 30 sec, 55°C for 30 sec, and 3.5 min at 72°C and a final 5 min at 72°C. The amplicons were directly sequenced using the same oligonucleotides used for PCR and analyzed as described above.

Results

Complete sequence analysis of the DPP portion of the DSPP gene was performed for the DD patients and unaffected family member. The unaffected family member was homozygotic for DSPP HVRR haplotype 1 (Genbank accession no. EU278640) and had no frameshifts. Both DD patients were heterozygotic with a single normal DSPP HVRR haplotype (III-9: haplotype 1 and III-2: haplotype 2, Genbank accession no. EU278641) and a new variant of haplotype 1 (three additional SNPs) which included a novel -1 bp frameshift mutation (c.3141delC or p.S1047fsX223; Genbank accession no. EU709728). Human DPP is normally rich in serines (Ser) and aspartic acids (Asp) to form a nominal Ser-Ser-Asp repeat in which many of the serines are made fully hydrophilic by phosphorylation (Takagi and Veis, 1984). The loss of the single nucleotide results in a translated carboxy-terminal domain rich in hydrophobic amino acids (predominantly Val, Ile, and Ala) until a stop codon is reached 11 amino acids past the normal in-frame termination. The c.3141delC frameshift would encode a DPP-repeat with ~500 normal hydrophilic amino acids ending with ~200 new, hydrophobic ones (Figure 1). No frameshift mutations have been found in 160 previously reported normal controls (McKnight et al., 2008; Song et al., 2008).

Figure 1
Clinical Phenotype and Mutation Results

As shown in Figure 2 of the Beattie et al. (2006) paper, the haplotype 4-6-2 (markers D4S1534-D4S414-D4S1572) is associated with DD. This haplotype was present in all affected individuals, but not in unaffected individuals. DSPP is located in this non-recombinant region, specifically between markers D4S1534 and D4S414. Furthermore, incorporating the DSPP HVRR alleles identified by this study into the haplotypes demonstrates that the frameshift mutation occurs on the 4-1*-6-2 haplotype that is associated with DD (Figure 2).

Figure 2
Chromosome 4 haplotype analysis incorporating the DSPP HVRR haplotypes generated by this study

The 626 bp DSPP 5′ proximal promoter domain and the 480 bp 3′ UTR (extended by 199 bp to include a highly conserved motif 3′ to the polyA site) were analyzed for two DD and two DGI patients to find any variation in the promoter or message stability domains that may contribute to their different phenotypes. No sequence variation was observed in either domain (data not shown) suggesting that the hypothesized cis-acting, DSPP-linked genetic modifier causing the DD vs. DGI phenotypes resides elsewhere within this area of chromosome 4.

Discussion

DGI and the less severe DD have classically been considered two distinct dominant disorders of dentin based on consistent clinical/radiographic differences in the phenotype of the secondary teeth. While there have been occasional reports in the literature of a spectrum of clinical severity within a kindred, the final diagnoses remained uniform for all affected family members. For example, although one of the affected DD family members in our kindred (III-9) had gray-colored anterior secondary crowns, the authors specifically noted that the dental phenotype of this patient remains clearly DD (Beattie et al., 2006).

Studies have localized DD to the interval of chromosome 4q21 containing the DGI locus and it was proposed that DD and DGI represent allelic mutations of a common gene (Beattie et al., 2006; Dean et al., 1997). Identification of mutations in the DSP portion of the DSPP gene (i.e. in the first 2% of the translated gene product) confirmed the allelic nature of DD/DGI. However, in many cases, mutations could not be identified in these early DSPP exons. We found within our original cohort that complete analysis of the DSPP gene can account for mutation detection in most and perhaps all true cases of non-syndromic DGI and DD (McKnight et al., 2008).

DGI and DD mutations can be categorized into three types of dominant DSPP mutations: 1) changes in the signal peptide; 2) changes in the highly conserved first three amino acids of the mature protein, Ile-Pro-Val (including exon 3-skipping mutations); and 3) deletions resulting in net -1 bp frameshifts in the repetitive domain of DPP (McKnight et al., 2008). Both the signal peptide and the Ile-Pro-Val sequence appear to be important in the correct processing of the protein into and through the rough endoplasmic reticulum (rER), Golgi apparatus, and/or out of the odontoblast. Mutations in either of these motifs are hypothesized to interfere with the cell's normal protein processing. The -1 bp frameshift mutations cause a change of the normally soluble hydrophilic repeat into a large hydrophobic domain most likely resulting in self-aggregation and precipitation within the rER or subsequent processing organelles. These three classes of mutations are hypothesized to have dominant-negative effects on the dentin matrix assembly/mineralization because odontoblasts are unable to make and secrete normal DSPP and/or type I collagen in an organized fashion or perhaps even in sufficient quantities to make the rapidly forming and mineralizing matrix. Support for this hypothesis exists in the literature with Takagi et al. showing an extract of one DGI-II patient's tooth apparently lacked any identifiable DPP (Takagi et al., 1983). We also presented a corollary hypothesis that true null alleles of DSPP or nonsense mutations that result in non-functional DSP and/or DPP (for example, all net +1 bp frameshift mutations within the repeat immediately result in stop codons) are predicted to be extremely rare recessive mutations with a similar phenotype to that reported for homozygotic Dspp-null mouse (McKnight et al., 2008; Sreenath et al., 2003). The hypothesis that DSPP haploinsufficiency in humans will have no disease phenotype is consistent with the observed lack of phenotype in the heterozygotic Dspp-null mice.

While all identified mutations for non-syndromic DD and DGI in humans occur within the DSPP gene, the locations of these mutations are not specific to a particular phenotype (Figure 3). For example, a DD phenotype is caused by a change in the DSPP signal peptide at c.16T>G in a European case while a Central American DGI case had a c.44C>T signal peptide mutation (Malmgren et al., 2004; Rajpar et al., 2002). While both mutations change the DSPP signal peptide (presumably resulting in similar improper processing), they result in different phenotypes within these two unrelated kindreds. Another example of this interesting genotype/phenotype relationship is within the third class of DSPP mutations described in this report. Recently, two reports showed that three DD-associated frameshift mutations were 5′ to six DGI-associated frameshifts (McKnight et al., 2008; Song et al., 2008) suggesting that DD patients encoded longer stretches of mutant hydrophobicity than the more severely affected DGI patients. In this current report, a DD family was discovered to have a -1 bp frameshift mutation located much more 3′ than in previous DD kindreds and, more importantly, within the DGI cluster defined by the combined McKnight et al. (2008) and Song et al. (2008) data. Therefore, this classic DD family demonstrates that the length of mutation-derived hydrophobicity of DSPP does not correlate with the specific phenotype.

Figure 3
Similar DSPP mutations that are associated with both DD (top arrows) and DGI (bottom arrows)

These results raise an interesting question about why similar mutations in both the signal peptide of DSPP and -1 bp frameshift mutations within the repeat domain can result in either DD or DGI phenotypes that remain stable within extended kindreds. The presence of a distinct genetic modifying element very closely linked to DSPP that acts with or upon the DSPP mutation to determine the specific DD or DGI phenotype could explain this phenotypic variance. (A less closely linked or unlinked genetic modifier would result in both DD and DGI phenotypes appearing within extended kindreds.) One hypothesis is that this modifying element is directly involved in controlling the amount of DSPP expressed from the mutant allele. For example, one variant of the DSPP promoter within the normal population may result in higher levels of DSPP mRNA production. When a mutant DSPP is associated with this more active promoter variant, the increased amount of precipitating mutant protein may result in a more highly affected odontoblast population in that person/kindred. Any of the -1 bp frameshift mutations, for example, when made in larger quantities, may cause the more severe DGI phenotype. A corollary hypothesis can be made for normal variants in the 3′ UTR of the DSPP mRNA that may result in higher message stability and therefore more mutant protein production/accumulation. The hypothesized promoter, message-stability motif, or other unidentified linked modifier may or may not result in any observable phenotypic differences within the normal population. Our limited evaluation did not identify sequence differences between the basic promoters (626 bp 5′ to exon 1) or 3′ UTR of DSPP among a small set of DD and DGI patients. There are, however, many potential regulatory elements more 5′ to exon 1 or within the introns that remain to be investigated. It is also possible that the hypothesized DSPP-linked genetic modifier may involve another nearby gene (e.g. another SIBLING member) or even a currently unknown, non-coding functional RNA syntenic to DSPP. Since both DD and DGI phenotype are observed in many geoethnic areas, it is reasonable to conclude that both normal DSPP-linked variants exist in much of the human population.

In summary, a novel frameshift mutation (c. 3141delC) in a well documented DD family was described. When considered together with other previously reported mutations, we suggest that DGI and DD are the phenotypic result of a combination of similar or perhaps even identical mutations in DSPP and a yet to be described DSPP-linked genetic modifier.

Acknowledgments

This research was supported by the Intramural Research Program of the NIH, NIDCR and in part (for JPS) by USPHS Research Grant DE15846 also from the NIH, NIDCR.

References

  • Beattie ML, Kim JW, Gong SG, Murdoch-Kinch CA, Simmer JP, Hu JC. Phenotypic variation in dentinogenesis imperfecta/dentin dysplasia linked to 4q21. J Dent Res. 2006;85(4):329–33. [PMC free article] [PubMed]
  • Bellahcene A, Castronovo V, Ogbureke KU, Fisher LW, Fedarko NS. Small integrin-binding ligand N-linked glycoproteins (SIBLINGs): multifunctional proteins in cancer. Nat Rev Cancer. 2008;8(3):212–26. [PMC free article] [PubMed]
  • Dean JA, Hartsfield JK, Jr, Wright JT, Hart TC. Dentin dysplasia, type II linkage to chromosome 4q. J Craniofac Genet Dev Biol. 1997;17(4):172–7. [PubMed]
  • Fisher LW, Torchia DA, Fohr B, Young MF, Fedarko NS. Flexible structures of SIBLING proteins, bone sialoprotein, and osteopontin. Biochem Biophys Res Commun. 2001;280(2):460–5. [PubMed]
  • George A, Srinivasan RSR, Liu K, Veis A. Rat dentin matrix protein 3 is a compound protein of rat dentin sialoprotein and phosphophoryn. Connect Tissue Res. 1999;40(1):49–57. [PubMed]
  • Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol. 1982;157(1):105–32. [PubMed]
  • MacDougall M, Simmons D, Luan X, Nydegger J, Feng J, Gu TT. Dentin phosphoprotein and dentin sialoprotein are cleavage products expressed from a single transcript coded by a gene on human chromosome 4. Dentin phosphoprotein DNA sequence determination. J Biol Chem. 1997;272(2):835–42. [PubMed]
  • Malmgren B, Lindskog S, Elgadi A, Norgren S. Clinical, histopathologic, and genetic investigation in two large families with dentinogenesis imperfecta type II. Hum Genet. 2004;114(5):491–8. [PubMed]
  • McKnight DA, Hart PS, Hart TC, Hartsfield JK, Wilson A, Wright JT, Fisher LW. A Comprehensive Analysis of Normal Variation and Disease-Causing Mutations in the Human DSPP Gene. Human Mutation. 2008 In Press. [PubMed]
  • Rajpar MH, Koch MJ, Davies RM, Mellody KT, Kielty CM, Dixon MJ. Mutation of the signal peptide region of the bicistronic gene DSPP affects translocation to the endoplasmic reticulum and results in defective dentine biomineralization. Hum Mol Genet. 2002;11(21):2559–65. [PubMed]
  • Song YL, Wang CN, Fan MW, Su B, Bian Z. Dentin phosphoprotein frameshift mutations in hereditary dentin disorders and their variation patterns in normal human population. J Med Genet. 2008;45(7):457–64. [PubMed]
  • Sreenath T, Thyagarajan T, Hall B, Longenecker G, D'Souza R, Hong S, Wright JT, MacDougall M, Sauk J, Kulkarni AB. Dentin sialophosphoprotein knockout mouse teeth display widened predentin zone and develop defective dentin mineralization similar to human dentinogenesis imperfecta type III. J Biol Chem. 2003;278(27):24874–80. [PubMed]
  • Takagi Y, Veis A, Sauk JJ. Relation of mineralization defects in collagen matrices to noncollagenous protein components. Identification of a molecular defect in dentinogenesis imperfecta. Clin Orthop Relat Res. 1983;176:282–90. [PubMed]
  • Takagi Y, Veis A. Isolation of phosphophoryn from human dentin organic matrix. Calcif Tissue Int. 1984;36(3):259–65. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...