![]() | ![]() |
Formats:
|
||||||||||||||
Copyright © 2008 by The National Academy of Sciences of the USA Developmental Biology Regulation of zebrafish fin regeneration by microRNAs Department of Biological Sciences, Vanderbilt University, Nashville, TN 37235-1634 1To whom correspondence should be addressed. E-mail: james.g.patton/at/vanderbilt.edu Edited by Igor B. Dawid, National Institutes of Health, Bethesda, MD, and approved September 30, 2008 Author contributions: E.J.T. designed research; E.J.T., I.P., and K.K.A. performed research; J.G.P. contributed new reagents/analytic tools; E.J.T. analyzed data; and E.J.T. and J.G.P. wrote the paper. Received April 18, 2008. Abstract A number of genes have been implicated in regeneration, but the regulation of these genes, particularly pertaining to regeneration in higher vertebrates, remains an interesting and mostly open question. We have studied microRNA (miRNA) regulation of regeneration and found that an intact miRNA pathway is essential for caudal fin regeneration in zebrafish. We also showed that miR-203 directly targets the Wnt signaling transcription factor Lef1 during this process. Repression of Lef1 by miR-203 blocks regeneration, whereas loss of miR-203 results in excess Lef1 levels and fin overgrowth. Expression of Lef1 from mRNAs lacking 3′ UTR recognition elements can rescue the effects of excess miR-203, demonstrating that these effects are due to specific regulation of lef1 by miR-203. Our data support a model in which regulation of Lef1 protein levels by miR-203 is a key limiting step during regeneration. Keywords: lef1, miR-203 Most vertebrates, including humans, are unable to regenerate the majority of lost or damaged tissues. In contrast, zebrafish are able to regenerate various damaged tissues, including fins, hearts, retinas, and spinal cords (1). For fins, regeneration relies on the formation of blastema cells, stem cell-like cells that either are recruited to the damaged area or originate from the de-differentiation of cells in the area (2, 3). Zebrafish caudal fins undergo isometric growth (i.e., fin grows in proportion to body size) throughout life, and understanding the regulatory mechanisms for controlling such growth remains a key question. The fin is composed of multiple bony rays that grow autonomously and are made up of bony segments, termed lepidotrichia. Each ray is composed of two hemirays, which create a protective shell around nerves, blood vessels, and mesenchymal cells. Fins grow through the addition of bone to the distal tip of the fin. Regeneration proceeds through at least five steps: wound healing, mesenchymal disorganization or reorganization, blastema formation, outgrowth, and termination (1, 4). miRNAs are a recently discovered class of genes that regulate gene expression at the posttranscriptional level and are required for development, stem cell maintenance, and renewal (5–18). Recently, Yin et al. (19) showed that fibroblast growth factor (Fgf) signaling alters the expression of multiple miRNAs during regeneration. One of the miRNA targets of Fgf signaling, miR-133, targets mps1, which encodes a kinase that regulates blastemal proliferation. Interestingly, these authors also found that various other markers of regeneration were indirectly activated on the reduction of miR-133 levels, suggesting that overall regulation of regeneration by miRNAs might be quite complex. Here we show that an intact miRNA pathway indeed is essential for regeneration. Furthermore, we show that in addition to regulation of Fgf signaling during regeneration, Wnt signaling also subject is to miRNA regulation through miR-203 control of Lef1. To examine global miRNA expression patterns in regenerating fins, we first conducted microarrays. Caudal fins were amputated from adult fish, and RNA was isolated from three regenerative states: adult fins, fins undergoing active regeneration, and fins that appeared to be completely regenerated. Small RNAs from each stage were isolated, fluorescently labeled, and directly hybridized to microarrays to determine the expression patterns of 346 vertebrate miRNAs (20). To obtain sufficient RNA for three independent arrays, fins were amputated from 120 adult fish, which were then returned to the aquarium temperature of 27 °C, after which regeneration was allowed to proceed for 2 or 5 weeks at 27 °C before reamputation and another round of RNA isolation. At this temperature, and based on the position of amputation, regeneration was ≈30% complete by 2 weeks [supporting information (SI) Fig. S1] and was nearly complete by 5 weeks. Heat maps illustrating global changes in miRNA expression are given in Fig. S2; expression changes for individual miRNAs, along with corresponding fold changes and P values, are given in Fig. S3 and Table S1. Some miRNAs that change during regeneration did not appear to return to their previous expression levels after 5 weeks at 27 °C, possibly due to incomplete regeneration. We hypothesize that miRNAs exhibiting decreased expression during active regeneration enable expression of genes required for regeneration (19), whereas miRNAs that are up-regulated during regeneration repress genes that normally prevent proliferation and/or maintain terminal cell differentiation. To validate our approach, we chose to first focus on those miRNAs whose expression was altered most dramatically (either up or down) and that are predicted to target genes implicated in regeneration and/or genes whose expression changes during active regeneration (Table 1). For example, the arrays showed that expression of miR-200b increased during regeneration and that one of its predicted targets is bmp3, which has been shown to be correspondingly down-regulated (21). Similarly, miR-203 is down-regulated during regeneration and is predicted to target lef1. Regeneration requires up-regulation of lef1 in newly formed regenerative epithelia and can be used as a marker for the initiation of regeneration (21–23). Thus, significant down-regulation of miR-203 during regeneration is consistent with the up-regulation of lef1 that occurs during active regeneration. Furthermore, blastema formation and maintenance of blastema cells (24) requires an active form of the heat-shock protein 60 (hsp60) and two of the down-regulated miRNAs identified in our array (miR-2 and miR-338) are predicted to target hsp60. Finally, msxb has been postulated to regulate the rate of proliferation of blastema cells during regenerative outgrowth (25, 26), and expression of miR-301, which is predicted to target msxb, is down-regulated during regeneration. These results suggest that our array strategy was able to identify differentially expressed miRNAs that target genes involved in regeneration.
We next sought to test whether miRNAs directly regulate regeneration. First, we decided to block overall miRNA production in regenerating fins by introducing two different antisense morpholino oligonucleotides against Dicer, an enzyme required for cytoplasmic processing of miRNA precursors (27). The loss of Dicer is embryonically lethal in both fish and mice (15, 28, 29), and stem cell maintenance requires Dicer (16, 17, 30). To silence Dicer, we used a previously described antisense morpholino oligonucleotide complementary to the 5′ UTR of dicer mRNA (28) (Fig. 1
The morpholinos against dicer were injected into the lepidotrichia (bony rays) on the dorsal half of amputated fins, followed by electroporation to facilitate cellular uptake (25, 32) (Fig. 1 To investigate the function of miRNAs that are down-regulated during regeneration and to test the role of individual miRNAs, we focused on miR-203. miR-203 was found to be significantly down-regulated during regeneration and is predicted to target lef1 (Table 1), a Wnt signaling-regulated transcription factor, the transcription of which is induced during regeneration and serves as a marker of the basal epidermal layer during blastema formation (22). The 3′ UTR of lef1 contains two potential miRNA recognition elements (MREs) for miR-203 (Fig. 2
To test whether miR-203 regulates lef1 during actual regeneration, we amputated caudal fins and injected excess miR-203, then performed electroporation. Evaluation of fin regeneration under these conditions revealed a definite loss of regenerative outgrowth in the dorsal halves of fins injected with miR-203 compared with the control ventral halves (UICs) (Fig. 3
We next injected miR-203MO into regenerating fins to determine the effect of loss of miR-203 on regeneration. Two different morpholinos were used, the same miR-203MO as before and a second morpholino against the pre-miR-203 loop region. In both cases, we observed a dramatic and remarkable increase in fin growth (Fig. 3 To further test the hypothesis that miR-203 regulates lef1, we performed in situ hybridization experiments to localize miR-203 and lef1 RNAs on sections from a single bony ray flanked by adjacent mesenchymal tissue. We found a perfect correlation between the presence of miR-203 and the loss of lef1 (Fig. S4c). Normally, miRNAs repress translation, but continued repression can lead to mRNA decay (34, 35). We also sectioned fins and conducted immunostaining with antibodies against Lef1 or, as a control, β-catenin. As before, Lef1 levels increased during normal regeneration, decreased on co-injection of miR-203, and were greatly elevated by co-injection of miR-203MO, whereas the β-catenin levels did not change under the different conditions (data not shown). To ensure that the effect of miR-203 is direct, we evaluated whether the expression of Lef1 from mRNAs lacking a normal 3′ UTR would be able to rescue the repression observed in the presence of miR-203. Co-injection of miR-203 with lef1 mRNAs lacking MREs led to a substantial rescue of both fin regeneration and Lef1 protein levels (Fig. 3 Our gain-of-function and loss-of-function regeneration experiments validate our array data and also suggest that a possible mechanism for termination of regeneration may be the increased expression of specific miRNAs that control the genes essential for regeneration. Consistent with this, the microarray and northern blot analysis results (Fig. S4b) demonstrate that miR-203 is readily detectable in adult fins and postregeneration fins but mostly undetectable in regenerating fins, suggesting transcriptional regulation of miR-203. Our results point to a key limiting role for lef1 in regeneration, but the possibility remains that miR-203 regulates other genes involved in regeneration as well. Considering the Dicer experiments shown in Fig. 1
The goal of regenerative research is to decipher the underlying mechanisms that allow organisms to recover from loss or damage caused by tissue injury, disease, and aging. Functional studies examining gain and loss of function of differentially expressed miRNAs in regenerating fins raise the possibility that identification of specific miRNA targets could lead to therapeutic targets that might ultimately allow regeneration in higher organisms. In adult humans, miR-203 is expressed in all tissues except liver, which may be one reason why regeneration is largely restricted to the liver (1, 36). Beyond regeneration, it is possible that similar mechanisms and genes may play important roles in proliferation versus terminal differentiation. This is especially intriguing for miR-203, which has been shown to promote differentiation of stratified epithelial cells (37, 38). Maintenance of the epidermis requires a balance between the proliferative capacity of the innermost basal layer and the differentiation and stratification of outer layers. This process depends on the expression of p63, a member of the p53 family of transcription factors (37). Interestingly, p63 is a target of miR-203, and p63 and Lef1 co-localize in regenerating fin sections (data not shown). The role of p63 in fin regeneration is unknown, but the possible regulation of p63 by miR-203 in regenerating fins would be consistent with epithelial differentiation models in which miR-203 has been hypothesized to block proliferation and/or “stemness.” This also is consistent with the ideas that overall regulation of regeneration requires the action of multiple miRNAs and that individual miRNAs may regulate multiple targets. Methods Microinjections. Single-cell embryos were injected with 200 pg of miR-203, 5 ng of miR-203MO, and/or 50 pg of in vitro-transcribed, capped GFP reporter with or without the lef1 3′ UTR. Titrations were performed to determine the optimal amount of miR-203 and miR-203MO to use in the GFP experiments. Zebrafish lef1 3′ UTR sequences were amplified by RT-PCR and subcloned downstream of the GFP ORF inserted into pCS2+ (39). Western Blot Analyses. At 1 dpf, embryos were dechorionated, deyolked, and sonicated in lysis buffer as described previously (33). Then ≈30 embryos were pooled, and one-sixth of the resultant volume was loaded into each lane (Fig. 2 Regeneration Experiments. Caudal fins were amputated and allowed to regrow for 2 days at 33 °C. On the third day, each of the bony rays in the dorsal half of the fin were injected with 100 ng of dicerMO, dicer-mmMO (28), dicer-start (TCTTTCTCTTCATCTTCCTCCGATC), miR-203, miR-203MO, miR-203loopMO (TTGAGATAGAACTGTTGAACTGTTA), lef1MO (CTCCTCCACCTGACAACTGCGGCAT), or miR-15b or 30–150 ng of lef1-UTR (forward primer: CGGGATATCACTCAGCATAATG; reverse primer: TCGAGAACTTCTTTTAGGCCAG). After injection, electroporation was performed as described previously (25). The lef1 mRNA was transcribed from a construct provided by Dr. Richard Dorsky (40). Whole-Mount Immunofluorescence. Fins were fixed in 4% PFA overnight at 4 °C and washed in PBT before digestion with proteinase K for 10 min. The fins were then washed in PBT-DMSO before blocking for 1 h at room temperature (PBT-DMSO, 2% BSA, 5% goat serum). Primary Lef1 antibodies (Abcam, 1:100 dilution) were incubated for 4 h at room temperature, washed with PBT-DMSO, and then incubated with Cy5-conjugated donkey anti-goat antibodies (Jackson ImmunoResearch) for 4 h at room temperature. Before mounting and visualization, the fins were washed with PBT-DMSO. Statistics. Microarray data were analyzed using GeneSpring software. ANOVA using nonparametric parameters with unequal variances was used to determine P values. Paired Student t-tests were performed for the regrowth calculations (Fig. 2 .001 for miR-203, P < .001 for miR-203MO).Supporting Information
Acknowledgments. This work was supported by National Institutes of Health Grants GM 075790 (to J.G.P.) and Training Fellowship GM62758 (to E.J.T.). We thank Drs. Liliana Solnica-Krezel and Bruce Appel for their advice and critical reading of the manuscript. We also thank Jenifer Ferguson and Jennell Talley for their assistance with fish maintenance and regeneration experiments and Robert Taylor for his assistance with imaging. Footnotes The authors declare no conflict of interest. This article is a PNAS Direct Submission. This article contains supporting information online at www.pnas.org/cgi/content/full/0803713105/DCSupplemental. References 1. Stoick-Cooper CL, Moon RT, Weidinger G. Advances in signaling in vertebrate regeneration as a prelude to regenerative medicine. Genes Dev. 2007;21:1292–1315. [PubMed] 2. Johnson SL, Weston JA. Temperature-sensitive mutations that cause stage-specific defects in zebrafish fin regeneration. Genetics. 1995;141:1583–1595. [PubMed] 3. Poss KD, Wilson LG, Keating MT. Heart regeneration in zebrafish. Science. 2002;298:2188–2190. [PubMed] 4. Akimenko MA, Mari-Beffa M, Becerra J, Geraudie J. Old questions, new tools, and some answers to the mystery of fin regeneration. Dev Dyn. 2003;226:190–201. [PubMed] 5. Bartel DP, Chen CZ. Micromanagers of gene expression: The potentially widespread influence of metazoan microRNAs. Nat Rev Genet. 2004;5:396–400. [PubMed] 6. Carthew RW. Gene regulation by microRNAs. Curr Opin Genet Dev. 2006;16:203–208. [PubMed] 7. Hobert O. Common logic of transcription factor and microRNA action. Trends Biochem Sci. 2004;29:462–468. [PubMed] 8. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993;75:843–854. [PubMed] 9. Naguibneva I, et al. The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation. Nat Cell Biol. 2006;8:278–284. [PubMed] 10. O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005;435:839–843. [PubMed] 11. Pasquinelli AE, et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 2000;408:86–89. [PubMed] 12. Plasterk RH. Micro RNAs in animal development. Cell. 2006;124:877–881. [PubMed] 13. Reinhart BJ, et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 2000;403:901–906. [PubMed] 14. Voorhoeve PM, et al. A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell. 2006;124:1169–1181. [PubMed] 15. Bernstein E, et al. Dicer is essential for mouse development. Nat Genet. 2003;35:215–217. [PubMed] 16. Hatfield SD, et al. Stem cell division is regulated by the microRNA pathway. Nature. 2005;435:974–978. [PubMed] 17. Kanellopoulou C, et al. Dicer-deficient mouse embryonic stem cells are defective in differentiation and centromeric silencing. Genes Dev. 2005;19:489–501. [PubMed] 18. Wienholds E, Plasterk RH. MicroRNA function in animal development. FEBS Lett. 2005;579:5911–5922. [PubMed] 19. Yin VP, et al. Fgf-dependent depletion of microRNA-133 promotes appendage regeneration in zebrafish. Genes Dev. 2008;22:728–733. [PubMed] 20. Thatcher EJ, Flynt AS, Li N, Patton JR, Patton JG. . MiRNA expression analysis during normal zebrafish development and following inhibition of the Hedgehog and Notch signaling pathways. Dev Dyn. 2007;236:2172–2180. [PubMed] 21. Schebesta M, Lien CL, Engel FB, Keating MT. Transcriptional profiling of caudal fin regeneration in zebrafish. ScientificWorldJournal. 2006;6:38–54. [PubMed] 22. Poss KD, Shen J, Keating MT. Induction of lef1 during zebrafish fin regeneration. Dev Dyn. 2000;219:282–286. [PubMed] 23. Stoick-Cooper CL, et al. Distinct Wnt signaling pathways have opposing roles in appendage regeneration. Development. 2007;134:479–489. [PubMed] 24. Makino S, et al. Heat-shock protein 60 is required for blastema formation and maintenance during regeneration. Proc Natl Acad Sci U S A. 2005;102:14599–14604. [PubMed] 25. Thummel R, et al. Inhibition of zebrafish fin regeneration using in vivo electroporation of morpholinos against fgfr1 and msxb. Dev Dyn. 2006;235:336–346. [PubMed] 26. Poss KD, Nechiporuk A, Hillam AM, Johnson SL, Keating MT. Mps1 defines a proximal blastemal proliferative compartment essential for zebrafish fin regeneration. Development. 2002;129:5141–5149. [PubMed] 27. Bernstein E, Caudy A, Hammond S, Hannon G. Role for a bidentate ribonuclease in the intiation step of RNA interference. Nature. 2001;409:363–366. [PubMed] 28. Wienholds E, Koudijs MJ, van Eeden FJ, Cuppen E, Plasterk RH. The microRNA-producing enzyme Dicer1 is essential for zebrafish development. Nat Genet. 2003;35:217–218. [PubMed] 29. Giraldez AJ, et al. MicroRNAs regulate brain morphogenesis in zebrafish. Science. 2005;308:833–838. [PubMed] 30. Park JK, Liu X, Strauss TJ, McKearin DM, Liu Q. The miRNA pathway intrinsically controls self-renewal of Drosophila germline stem cells. Curr Biol. 2007;17:533–538. [PubMed] 31. Kloosterman WP, Lagendijk AK, Ketting RF, Moulton JD, Plasterk RH. Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development. PLoS Biol. 2007;5:e203. [PubMed] 32. Jazwinska A, Badakov R, Keating MT. Activin-betaA signaling is required for zebrafish fin regeneration. Curr Biol. 2007;17:1390–1395. [PubMed] 33. Flynt AS, Li N, Thatcher EJ, Solnica-Krezel L, Patton JG. Zebrafish miR-214 modulates Hedgehog signaling to specify muscle cell fate. Nat Genet. 2007;39:259–263. [PubMed] 34. Baek D, et al. . The impact of microRNAs on protein output. Nature. 2008;455:64–71. [PubMed] 35. Selbach M, et al. . Widespread changes in protein synthesis induced by microRNAs. Nature. 2008;455:58–63. [PubMed] 36. Barad O, et al. MicroRNA expression detected by oligonucleotide microarrays: System establishment and expression profiling in human tissues. Genome Res. 2004;14:2486–2494. [PubMed] 37. Lena AM, et al. miR-203 represses “stemness” by repressing DeltaNp63. Cell Death Differ. 2008;15:1187–1195. [PubMed] 38. Yi R, Poy MN, Stoffel M, Fuchs E. A skin microRNA promotes differentiation by repressing “stemness.” Nature. 2008;452:225–229. [PubMed] 39. Rupp RA, Snider L, Weintraub H. Xenopus embryos regulate the nuclear localization of XMyoD. Genes Dev. 1994;8:1311–1323. [PubMed] 40. Dorsky RI, et al. Maternal and embryonic expression of zebrafish lef1. Mech Dev. 1999;86:147–150. [PubMed] 41. Chen PY, et al. The developmental miRNA profiles of zebrafish as determined by small RNA cloning. Genes Dev. 2005;19:1288–1293. [PubMed] 42. Griffiths-Jones S. The microRNA registry. Nucleic Acids Res. 2004;32:D109–D111. (database issue). [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||
Genes Dev. 2007 Jun 1; 21(11):1292-315.
[Genes Dev. 2007]Genetics. 1995 Dec; 141(4):1583-95.
[Genetics. 1995]Science. 2002 Dec 13; 298(5601):2188-90.
[Science. 2002]Dev Dyn. 2003 Feb; 226(2):190-201.
[Dev Dyn. 2003]Nat Rev Genet. 2004 May; 5(5):396-400.
[Nat Rev Genet. 2004]Curr Opin Genet Dev. 2006 Apr; 16(2):203-8.
[Curr Opin Genet Dev. 2006]Trends Biochem Sci. 2004 Sep; 29(9):462-8.
[Trends Biochem Sci. 2004]Cell. 1993 Dec 3; 75(5):843-54.
[Cell. 1993]Nat Cell Biol. 2006 Mar; 8(3):278-84.
[Nat Cell Biol. 2006]Dev Dyn. 2007 Aug; 236(8):2172-80.
[Dev Dyn. 2007]Genes Dev. 2008 Mar 15; 22(6):728-33.
[Genes Dev. 2008]ScientificWorldJournal. 2006 Jun 2; 6 Suppl 1():38-54.
[ScientificWorldJournal. 2006]Dev Dyn. 2000 Oct; 219(2):282-6.
[Dev Dyn. 2000]Development. 2007 Feb; 134(3):479-89.
[Development. 2007]Proc Natl Acad Sci U S A. 2005 Oct 11; 102(41):14599-604.
[Proc Natl Acad Sci U S A. 2005]Dev Dyn. 2006 Feb; 235(2):336-46.
[Dev Dyn. 2006]Genes Dev. 2005 Jun 1; 19(11):1288-93.
[Genes Dev. 2005]Nucleic Acids Res. 2004 Jan 1; 32(Database issue):D109-11.
[Nucleic Acids Res. 2004]Nature. 2001 Jan 18; 409(6818):363-6.
[Nature. 2001]Nat Genet. 2003 Nov; 35(3):215-7.
[Nat Genet. 2003]Nat Genet. 2003 Nov; 35(3):217-8.
[Nat Genet. 2003]Science. 2005 May 6; 308(5723):833-8.
[Science. 2005]Nature. 2005 Jun 16; 435(7044):974-8.
[Nature. 2005]Dev Dyn. 2006 Feb; 235(2):336-46.
[Dev Dyn. 2006]Curr Biol. 2007 Aug 21; 17(16):1390-5.
[Curr Biol. 2007]Genes Dev. 2008 Mar 15; 22(6):728-33.
[Genes Dev. 2008]Dev Dyn. 2000 Oct; 219(2):282-6.
[Dev Dyn. 2000]PLoS Biol. 2007 Aug; 5(8):e203.
[PLoS Biol. 2007]Nat Genet. 2007 Feb; 39(2):259-63.
[Nat Genet. 2007]Nature. 2008 Sep 4; 455(7209):64-71.
[Nature. 2008]Nature. 2008 Sep 4; 455(7209):58-63.
[Nature. 2008]Genes Dev. 2008 Mar 15; 22(6):728-33.
[Genes Dev. 2008]Genes Dev. 2007 Jun 1; 21(11):1292-315.
[Genes Dev. 2007]Genome Res. 2004 Dec; 14(12):2486-94.
[Genome Res. 2004]Cell Death Differ. 2008 Jul; 15(7):1187-95.
[Cell Death Differ. 2008]Nature. 2008 Mar 13; 452(7184):225-9.
[Nature. 2008]Genes Dev. 1994 Jun 1; 8(11):1311-23.
[Genes Dev. 1994]Nat Genet. 2007 Feb; 39(2):259-63.
[Nat Genet. 2007]Nat Genet. 2003 Nov; 35(3):217-8.
[Nat Genet. 2003]Dev Dyn. 2006 Feb; 235(2):336-46.
[Dev Dyn. 2006]Mech Dev. 1999 Aug; 86(1-2):147-50.
[Mech Dev. 1999]