pmc logo image
Logo of nihpaNIHPA bannerabout author manuscriptssubmit a manuscript

Formats:

Hum Gene Ther. Author manuscript; available in PMC 2008 November 25.
Published in final edited form as:
PMCID: PMC2587268
NIHMSID: NIHMS51686
RNA interference-mediated in vivo silencing of FasL as a strategy for the enhancement of DNA vaccine potency
Bruce Huang,1 Chih-Ping Mao,1 Shiwen Peng,1 Mei-Cheng Wang,5 Chien-Fu Hung,1,2 and T.-C. Wu1,2,3,4
1 Department of Pathology, The Johns Hopkins School of Medicine, Baltimore, MD, USA
2 Department of Oncology, The Johns Hopkins School of Medicine, Baltimore, MD, USA
3 Departments of Obstetrics and Gynecology, The Johns Hopkins School of Medicine, Baltimore, MD, USA
4 Departments of Molecular Microbiology and Immunology, The Johns Hopkins School of Medicine, Baltimore, MD, USA
5 Department of Biostatistics, The Johns Hopkins School of Medicine, Baltimore, MD, USA
Address correspondence to Dr. T-C Wu, M.D., Ph.D., Department of Pathology, The Johns Hopkins School of Medicine, CRB II Room 309, 1550 Orleans St., Baltimore, MD 21231. Tel: (410) 614-3899; Fax: (443) 287-4295; Email: wutc/at/jhmi.edu
Intradermal administration of DNA vaccines encoding luciferase represents a convenient method to assess gene expression in vivo. Gene silencing by intradermal gene gun administration of DNA encoding short hairpin RNA (shRNA) may represent an effective technique for the specific knockdown of gene expression in vivo. In the current study, we characterized luciferase gene expression over time in vivo using non-invasive bioluminescence imaging systems. Furthermore, we characterized in vivo luciferase gene silencing using DNA encoding shRNA targeting luciferase. We also characterized the human papillomavirus type 16 (HPV-16) E7-specific CD8+ T cell immune responses in mice immunized with E7 DNA and DNA encoding shRNA targeting Fas ligand (FasL), a key pro-apoptotic signaling protein. Our results indicated that co-administration of DNA encoding shRNA targeting luciferase significantly reduced luciferase expression in mice intradermally administered with luciferase DNA. Furthermore, we observed that mice vaccinated with E7-expressing DNA co-administered with DNA encoding shRNA targeting FasL generated significantly enhanced E7-specific CD8+ cytotoxic T cell responses as well as potent therapeutic antitumor effects against E7-expressing tumors. Thus, intradermal administration of DNA encoding shRNA represents a plausible approach to silence genes in vivo and a potentially useful tool to enhance DNA vaccine potency.
Keywords: RNA interference (RNAi), short hairpin RNA (shRNA), Fas ligand (FasL), luciferase (Luc), DNA vaccine, cancer immunotherapy
Over the past decade, vaccination with DNA encoding tumor- and/or viral-associated antigens has emerged as an especially promising strategy for generating therapeutic immunity against cancer. DNA is stable, simple to prepare, and safe relative to viral-based or bacterial-based vectors (for reviews, see (Donnelly et al., 1997; Gurunathan et al., 2000)). In addition, intradermal administration of DNA vaccines via gene gun represents an efficient method to deliver DNA to the key professional antigen-presenting cells, Langerhans cells, in the skin. Using this non-invasive vaccine delivery system, antigen-expressing dendritic cells (DCs) mature and become able to migrate to the draining lymph nodes, where they activate T cells, resulting in efficient elimination of infected and cancerous cells (for review, see (Guermonprez et al., 2002)). Nevertheless, the potency of these vaccines is often limited by signaling pathways that negatively regulate the adaptive immune response. Thus, the silencing of these immunosuppressive signals potentially represents a highly effective strategy for the enhancement of DNA vaccine potency.
RNA interference (RNAi) technology has developed into a powerful method for specific post-transcriptional gene silencing in vitro and may be applied to diminish the expression of immunosuppressive factors in vivo as a complement to traditional DNA vaccines. Multiple species of siRNA have been introduced into a variety of cells and have demonstrated that RNAi can be widely employed as a technique for specific gene knockdown (for reviews, see (Caplen, 2004; Leung and Whittaker, 2005; Shankar et al., 2005)). One approach to lead to gene silencing is by transfection of DNA encoding short hairpin RNA (shRNA) targeting the gene of interest. The transfected cell will be able to generate shRNA, resulting in silencing of the gene of interest.
Despite the great potential of RNAi technology to serve as a tool for therapeutic in vivo gene silencing, the issue of specific and efficient delivery of siRNA to target tissue in vivo poses a formidable obstacle to the implementation of this technique in the clinic. Previously, we have employed intradermal administration of DNA vaccine in conjunction with siRNA targeting the key pro-apoptotic proteins Bax and Bak (Kim et al., 2005). Using this approach, we observed prolonged survival of transfected DCs resulting in enhanced human papillomavirus type 16 (HPV-16) E7-specific CD8+ T cell responses against E7-expressing tumors in mice (Kim et al., 2005). Thus, intradermal administration using gene gun represents an efficient method to deliver siRNA targeting molecules of interest into the DCs in vivo and thus effectively knock down the expression of specific genes.
Fas ligand (FasL) is a pro-apoptotic molecule that is produced in abundant amounts by DCs (Lu et al., 1997). FasL may associate with its cognate death receptor, Fas, found on the surface of naïve T cells during antigen presentation, as an immunoregulatory mechanism. Fas-FasL interactions at the immunological synapse could then possibly initiate the extrinsic apoptosis pathway in these specific T cells during their activation (a type of activation-induced cell death). We reasoned that downregulation of FasL in DCs using shRNA may lead to improved T cell survival, thus enhancing DNA vaccine potency.
In the current study, we first characterized the expression of the gene-gun delivered luciferase over time in vivo using a non-invasive bioluminescence imaging system. Our results indicated that the expression of luciferase in vivo peaked at 24 hours following DNA administration. Furthermore, we observed that co-administration of DNA encoding shRNA targeting luciferase significantly reduced the expression of luciferase in mice intradermally administered with luciferase DNA. We then investigated the immunotherapeutic potential of co-administering DNA vaccines containing HPV-16 E7 (Sig/E7/LAMP-1) (Ji et al., 1998) in conjunction with DNA encoding shRNA targeting the apoptosis inducer Fas ligand (FasL). We observed that mice vaccinated with Sig/E7/LAMP-1 DNA co-administered with DNA encoding shRNA targeting FasL generated significantly enhanced E7-specific CD8+ cytotoxic T cell responses, which translated into improved tumor cell killing in vitro as well as potent therapeutic antitumor effects against E7-expressing tumors. Furthermore, we demonstrated that blocking of FasL on the E7 peptide-loaded DCs reduces the apoptosis of E7-specific CD8+ T cells in vitro. Thus, the employment of intradermal administration of DNA encoding shRNA targeting FasL represents an excellent approach to increase the potency of DNA vaccines.
Mice
Female C57BL/6J mice (6 to 8 weeks old) were purchased from the Jackson Laboratory (Bar Harbor, ME). Animals were maintained under specific-pathogen-free conditions at the Johns Hopkins Hospital (Baltimore, MD). All procedures were performed according to approved protocols and in accordance with recommendations for the proper care of laboratory animals.
Cell culture and antibodies
BHK21 cells (ATCC Cat. No. CCL-10) and explanted splenocytes were maintained in RPMI-1640 containing 2 mmol/L L-glutamine, 1mmol/L sodium pyruvate, nonessential amino acids, 100 IU penicillin/streptomycin, 50μmol/L β-mercaptoethanol and 10% fetal bovine serum in a 37°C incubator with 5% CO2. The HPV-16 E7-expressing murine tumor model TC-1 cell line, and its luciferase-expressing derivative line TC-1/Luciferase have been previously described (Lin et al., 1996; Huang et al., 2007). Briefly, primary lung epithelial cells of C57BL/6 mice were transformed with HPV-16 E6, E7, and an activated ras oncogene. These cells were then transduced with viral particles packaged with a Luciferase/Thy1.1 expression construct on the pMSCVpuro backbone (a kind gift from Hyam Levitsky). TC-1/Luciferase cells were cultured in the same media as BHK21 cells. Phycoerytherin-conjugated anti-mouse FasL antibody (clone MFL3; eBioscience, San Diego, CA) and isotype control (clone eBio299Arm, eBioscience) were used for cell surface staining of FasL, which was performed according to the vendor’s protocol. Phycoerythrin-conjugate monoclonal rat anti-mouse CD8 antibody and FITC-cojugated anti-mouse IFN-γ antibodies (BD Pharmingen, San Diego, CA) were used for intracellular cytokine staining of explanted splenocytes. For the FasL blocking experiments, antibodies used were the anti-mouse FasL (CD178.1) Ab (Kay-10 clone) (BioLegend, San Diego, CA) and the functional grade mouse IgG2b isotype control (eBioscience, San Diego, CA). The DC-1 dendritic cell line was kindly provided by Dr. Kenneth Rock (University of Massachusetts, Worcester, MA) (Kim et al., 2004).
Preparation of DNA plasmid constructs
Construction of the plasmid encoding Firefly luciferase (pcDNA3-Luc), as well as that encoding HPV-16 Sig/E7/LAMP-1 has been described previously. The shRNA constructs pRS-Luc (Cat. No. TR30002) and pRS empty vector control (Cat. No. TR20003) were purchased from OriGene (Rockville, MD). The FasL-GFP expression vector and GFP empty vector control were kind gifts from Drs. Linzhao Cheng and Xiaobing Yu. FasL Mission shRNA TRCN0000066640 (CCGGCTTCGTGTATTCCAAAGTATACTCGAGTATACTTTGGAATACACGAAG TTTTTG) and the Mission non target shRNA control vector (Cat. No. SHC002) (CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTCGGTGAAGATCACG TTTTT) were purchased from Sigma-Aldrich (St. Louis, MO). DNA plasmids were amplified in Escherichia coli DH5α (pcDNA3-Luc, pRS vector, pRS-Luc, and Sig/E7/LAMP-1) or STBL2 (FasL-GFP, GFP-empty vector, FasL Mission shRNA) and purified as reported by Chen et al. using an endotoxin-free plasmid purification kit (Qiagen, Valencia, CA) (Chen et al., 2000).
In vitro transfection
For the experiments with luciferase shRNA, BHK-21 cells were seeded in a 24-well plate at a density of 5×104 cells per well the day before transfection. Lipofectamine 2000 (Invitrogen, Carlsbad, CA) was used to transfect the cells with DNA plasmids (0.01 μg of pcDNA3-Luc, combined with a 0.81 μg mixture of pRS-Luc and pRS vector) in quadruplicate for each Luc shRNA dose. Cells were washed, and culture media was replaced subsequent to overnight incubation and daily luciferase-based bioluminescence imaging. For the experiments with FasL shRNA, BHK-21 cells were seeded in 10 cm dishes at 1.5×106 cells per dish. Eight hrs later, FasL-GFP expression vector (2.4 μg) combined with FasL shRNA or non-specific shRNA construct (21.6 μg each) were transfected into the cells using Lipofectamine 2000. Cell surface expression of FasL was assayed following overnight incubation.
Flow cytometry analysis for FasL expression
BHK-21 cells transfected with combinations of FasL-GFP expression vector and FasL shRNA were scraped after 24 hrs incubation at 37 °C, resuspended in FACscan buffer, and surface-stained in the dark with phycoerythrin-conjugated anti-mouse FasL antibody or isotype control for 30 min at 4°C. FasL expression analysis was performed on a Becton-Dickinson FACScan flow cytometer with CELL Quest software (Becton Dickinson Immunocytometry System, Mountain View, CA).
DNA vaccination
DNA-coated gold particles were prepared according to a previously described protocol (Chen et al., 2000), and delivered to the shaved abdominal region of C57BL/6 mice using a helium-driven gene gun (BioRad, Hercules, CA) with a discharge pressure of 400 p.s.i. For the kinetic measurement of epidermal luciferase expression, two DNA bullets were administered to non-contiguous areas per mouse (1 μg pcDNA3-Luc or pcDNA3 vector per bullet). For measurement of luciferase shRNA activity in vivo, one DNA bullet was administered per mouse (0.5 μg pcDNA3-Luc combined with 0.5 μg of pRS-Luc or pRS vector; 1 μg total DNA/bullet). For the FasL shRNA experiments, mice were primed with two bullets of DNA (0.1μg of Sig/E7/LAMP-1 combined with 0.9 μg of FasL shRNA or negative control shRNA per bullet; 2 μg total DNA/mouse) and boosted with the same dose one week later. For the FasL shRNA tumor treatment experiments, mice were vaccinated with two bullets of DNA (0.1μg Sig/E7/LAMP-1 combined with 0.9μg FasL shRNA or negative control shRNA per bullet, as per immune response experiment) eight days after tumor inoculation, and boosted three times with the same dose in four-day intervals.
Luciferase-based bioluminescence imaging
The expression of luciferase in cultured BHK-21 cells was detected using the Xenogen IVIS 200 system (Xenogen Corp., Alameda, CA) and quantitated with the Living Image software package (Xenogen Corp.) Briefly, cells were washed twice with PBS, then 1 ml of media with 39 μg/ml beetle luciferin (potassium salt; Promega Corp., Madison, WI) was added to the cells and followed immediately by bioluminescence imaging (1 sec exposure). The expression of luciferase in the skin of mice was visualized with the same apparatus and software. C57BL/6 mice were injected intraperitoneally with 0.2ml of 3.9mg/ml beetle luciferin in PBS and placed under general anesthesia using isoflurane for 10 min. Luciferase activity was recorded with the IVIS digital camera (30 sec exposure).
Intracellular cytokine staining and flow cytometry analysis for antigen-specific immune response
Splenocytes were harvested one week after the last vaccination from mice (3 per group) immunized with Sig/E7/LAMP-1 DNA in combination with DNA coding for FasL shRNA or nonspecific shRNA. 5×106 pooled splenocytes from each vaccination group were incubated overnight at 37°C with 1 μg/ml E7 peptide (RAHYNIVTF) in the presence of 1 μg/ml GolgiPlug (BD Pharmingen, San Diego, CA). Cells were then washed with FACScan buffer and co-stained with phycoerythrin-conjugated monoclonal rat anti-mouse CD8 antibody as well as FITC-conjugated IFN-γ antibody using the Cytofix/Cytoperm kit according to the manufacturer’s instructions (BD Pharmingen). Analysis was performed on a Becton-Dickinson FACScan flow cytometer with CELL Quest software.
Bioluminescent cytotoxicity assay
Splenocytes were harvested from mice immunized with Sig/E7/LAMP-1 DNA in combination with DNA coding for FasL shRNA or non-specific shRNA (3 per group) one week after the last vaccination. Splenocytes of mice from each treatment group were incubated in pools of five million cells with 1 μg/ml of E7 peptide (RAHYNIVTF) and 20 units/ml IL-2 for five days, then collected and combined with TC-1/Luciferase target cells in 10:1 effector:target ratios. After adjusting cell volumes by centrifugation and resuspension in equal volumes of media (to achieve 5×104 target cells/100 μl), cell mixtures were plated in 100μl quadruplicate aliquots to 96-well round-bottom plates, lightly centrifuged to bring cell mixtures to the bottom of wells, and incubated overnight. Following incubation, media was drawn from wells, briefly centrifuged to remove cells and cell debris, then quantitatively assayed in quadruplicate for luciferase activity by addition of Steady-Glo reagent (Promega, Madison, WI) in light-resistant black plastic 96-well plates. Visualization and signal quantitation was performed using the Xenogen IVIS system, and Living Image software package.
In vivo tumor treatment experiment
Mice (five per group) were challenged with 5×104 TC-1/Luciferase tumor cells/mouse by subcutaneous injection in the right flank. DNA vaccine treatments (2μg/dose) were initiated seven days after tumor inoculation, and boosted three times with the same dose in four-day intervals. Tumor growth was periodically visualized under general anesthesia using the Xenogen IVIS system, and quantitated using the Living Image software package. Mice were also observed for signs of morbidity (cachexia, failure to groom, decreased social interaction with cage-mates), and euthanized when overtly moribund.
Apoptosis assays
2 × 105 FasL-blocked E7-specific CD8+ T cells were incubated with or without 1 × 107 E7 peptide-loaded DC-1 cells transfected with FasL-GFP at a 1:50 ratio in the presence of the 5μg/ml of FasL blocking Ab or isotype control. The percentage of apoptotic cells were characterized using intracellular staining with antibodies specific for activated caspase-3 and analyzed by flow cytometry analysis.
Statistical analysis
All data expressed as means +/− standard deviation (S.D.) are representative of at least two different experiments. The statistical significance of group differences was measured using the Student’s t-test to generate p-values. p values less than 0.05 were considered to be significant.
Intradermal delivery of DNA encoding luciferase results in maximum levels of luciferase expression in mice 24 hours after DNA administration
We employed a non-invasive bioluminescence imaging system to characterize the expression of luciferase over time. C57BL/6 mice (2 per group) were intradermally administered luciferase DNA or control DNA via gene gun and the luciferase activity was monitored over a period of 5 days by bioluminescence imaging. As shown in Figure 1AFigure 1, the shaved abdominal region of luciferase-treated mice exhibited significant luminescent intensity (left panel) within 30 minutes after DNA administration, while luciferase activity was undetectable in animals treated with control DNA (right panel). We further characterized the kinetics of luciferase expression in luciferase-treated mice over a period of 5 days. As shown in Figure 1BFigure 1, luciferase expression peaked at 24 hrs following DNA administration and then gradually decreased. After 144 hrs, the level of luciferase expression becomes similar to that observed at 30 min. Taken together, these data indicate that luciferase serves as an excellent marker for monitoring gene expression in vivo using a non-invasive bioluminescence imaging system and that this expression reaches a maximal level 24 hrs after gene administration.
Figure 1
Figure 1
Figure 1
Bioluminescence imaging of C57BL/6 mice administered with DNA encoding the luciferase gene
Transfection of luciferase-expressing cells with DNA encoding shRNA targeting luciferase reduces levels of luciferase activity in vitro in a dose-dependent manner
We performed in vitro bioluminescence imaging to characterize luciferase expression in BHK-21 cells transfected with DNA encoding luciferase in combination with various amounts of DNA encoding shRNA targeting luciferase. As shown in Figure 2AFigure 2, expression of luciferase declined with increasing dose of DNA encoding shRNA targeting luciferase, indicating the silencing of luciferase gene increased in a dose-dependent manner. Luciferase activity becomes virtually undetectable in cells transfected with more than 0.09 μg of DNA encoding luciferase-specific shRNA. We further characterized the kinetics of silencing of the luciferase gene expression over a period of 5 days in cells transfected with different amounts of DNA encoding luciferase-specific shRNA. We observed a dose-dependent silencing of luciferase gene expression over time. Furthermore, luciferase activity remained substantially suppressed even after 120 hours (Figure 2BFigure 2). Thus, these data demonstrate that luciferase can be continuously silenced using DNA encoding shRNA targeting luciferase in a dose-dependent manner in vitro.
Figure 2
Figure 2
Figure 2
Detection of siRNA-mediated gene knockdown in vitro using the bioluminescence imaging system
DNA encoding shRNA targeting luciferase greatly decreases levels of luciferase expression in mice administered with luciferase-expressing DNA
We next sought to determine whether DNA encoding shRNA targeting luciferase could be intradermally administered by gene gun to knock down luciferase expression in vivo as assayed by noninvasive bioluminescence imaging. C57BL/6 mice (5 per group) were intradermally administered with DNA encoding luciferase and DNA encoding shRNA targeting luciferase (pcDNA3-Luc + pRS-Luc) or DNA encoding luciferase and empty vector DNA (pcDNA3-Luc + pRS-empty). The luciferase activity was monitored over time using bioluminescence imaging. As shown in Figure 3AFigure 3, representative bioluminescence images of mice administered with DNA encoding luciferase, combined with DNA encoding luciferase-specific shRNA, displayed significantly lower levels of luciferase expression compared to mice administered with DNA encoding luciferase combined with empty vector DNA at 24 hours. Furthermore, Figure 3BFigure 3 indicates the silencing of luciferase expression over time. We observed that the luminescent intensity in mice administered with pcDNA3-Luc + pRS-Luc was significantly lower compared to mice administered with pcDNA3-Luc + pRS-empty vector at 24 hours after DNA administration (~3-fold difference, p < 0.01). These results show that DNA encoding shRNA targeting luciferase can be efficiently administered intradermally with the gene gun to achieve efficient silencing of luciferase in vivo. These encouraging data suggest that we may be able to use intradermal administration via gene gun to modify the properties of DCs using DNA encoding shRNA targeting immunosuppressive molecules to enhance DNA vaccine potency.
Figure 3
Figure 3
Figure 3
Bioluminescence imaging of luciferase activity in vivo
Transfection of Fas ligand (FasL)-expressing cells with DNA encoding shRNA targeting FasL substantially downregulates FasL in vitro
The apoptosis inducer FasL, a protein abundantly expressed on the surface of DCs, may serve as an ideal target for gene silencing to enhance DNA vaccine potency by potentially reducing DC-induced T cell death (Lu et al., 1997). During antigen presentation, FasL expressed by DCs may induce apoptosis in some T cells through association with the Fas death receptor present on the surface of T cells, concomitant with MHC-T cell receptor interactions at the immunological synapse. In order to determine whether transfection of FasL-expressing cells with DNA encoding shRNA targeting FasL could lead to downregulation of FasL in vitro, we transfected BHK-21 cells with plasmid DNA encoding FasL and DNA encoding shRNA specific for FasL. We then performed flow cytometry analysis to characterize the expression of FasL in transfected cells. As shown in Figure 4Figure 4, cotransfection of cells with DNA encoding FasL and DNA encoding FasL-specific shRNA led to significant reduction of FasL expression compared to the cells cotransfected with DNA encoding non-specific shRNA (p < 0.05 by Student’s t test). Thus, our data indicate that transfection of FasL-expressing cells with DNA encoding shRNA specific for FasL substantially downregulates FasL expression in vitro.
Figure 4
Figure 4
Figure 4
Flow cytometry analysis demonstrating expression of FasL in BHK21 cells in vitro
Intradermal administration of Sig/E7/LAMP-1 DNA with DNA encoding shRNA targeting FasL results in a significant increase in the number of E7-specific CD8+ T cells in vaccinated mice
We have previously generated a DNA construct containing the HPV-16 E7 linked to the sorting signal of the lysosome-associated membrane protein (LAMP-1) to form a chimeric protein Sig/E7/LAMP-1. We found that intradermal administration of DNA encoding Sig/E7/LAMP-1 could generate enhanced E7-specific CD8+ T cell immune responses in vaccinated mice (Chen et al., 1999). We then sought to determine whether the intradermal administration of Sig/E7/LAMP-1 DNA could be further enhanced by co-administration with DNA encoding shRNA targeting FasL. C57BL/6 mice (3 per group) were vaccinated intradermally via gene gun with Sig/E7/LAMP-1 DNA and DNA encoding shRNA targeting FasL, and boosted with the same dose one week later. One week after the last vaccination, splenocytes were harvested and characterized for E7-specific CD8+ T cells by intracellular cytokine staining followed by flow cytometry analysis. As shown in Figure 5AFigure 5Figure 5, a significantly enhanced E7-specific CD8+ T cell immune response was observed in mice vaccinated with Sig/E7/LAMP-1 DNA and DNA encoding FasL shRNA compared to mice vaccinated with Sig/E7/LAMP-1 DNA and DNA encoding nonspecific shRNA. A graphical representation of the number of E7-specific IFN-γ+ CD8+ T cells in each group is depicted in Figure 5BFigure 5Figure 5 (p < 0.005 by Student’s t test). Thus, our data indicate that intradermal administration of Sig/E7/LAMP-1 DNA with DNA encoding shRNA targeting FasL results in a significant increase in the number of E7-specific CD8+ T cells in vaccinated mice and suggests that RNAi-mediated knockdown of FasL expression in DCs may represent an effective strategy for augmenting vaccine potency.
Figure 5Figure 5
Figure 5
Figure 5
Figure 5
Analysis of IFNγ-secreting E7-specific CD8+ T cells in mice vaccinated with Sig/E7/LAMP-1 DNA and DNA encoding shRNA targeting FasL
Splenocytes from mice vaccinated with Sig/E7/LAMP-1 DNA combined with DNA encoding FasL shRNA generate potent cytotoxic activity against E7-expressing tumors
To evaluate if the increase in the number of E7-specific CD8+ T cells generated by vaccination of Sig/E7/LAMP-1 DNA vaccines in combination with FasL shRNA translate into a potent cytotoxic activity against E7-expressing tumors, we performed in vitro cytotoxicity assays using in vitro stimulated splenocytes from vaccinated C57BL/6 mice with a luciferase expressing TC-1 tumors (TC-1/luciferase). An E7-specific T cell line was used as a positive control and TC-1/Luciferase tumor cells without T cells were used as a negative controls. As shown in Figure 5CFigure 5Figure 5, splenocytes obtained from animals vaccinated with Sig/E7/LAMP-1 DNA vaccines in combination with DNA encoding FasL shRNA demonstrated significantly enhanced cytolytic activity compared to splenocytes obtained from animals vaccinated with Sig/E7/LAMP-1 DNA vaccines with DNA encoding non-specific shRNA (p<0.001). Thus, our data suggest that the enhanced E7-specific CD8+ T cells observed in mice vaccinated with Sig/E7/LAMP-1 DNA with DNA encoding FasL-specific shRNA also demonstrated leads potent cytolytic activity against an E7-expressing model tumor cell line.
Intradermal administration of Sig/E7/LAMP-1 DNA with DNA encoding shRNA targeting FasL generates potent anti-tumor therapeutic effects against E7-expressing TC-1/Luciferase tumors in treated mice
In order to determine the therapeutic anti-tumor effects of intradermal administration of Sig/E7/LAMP-1 DNA with DNA encoding FasL shRNA, we performed in vivo tumor treatment experiments. C57BL/6 mice (5 per group) were challenged with 5×104 TC-1/Luciferase tumor cells/mouse by subcutaneous injection in the right flank, and monitored for tumor growth over time by non-invasive bioluminescence imaging. The luminescent intensity has been shown to correlate with tumor load (Hung et al., 2007a). Eight days after tumor challenge, tumor-bearing mice were treated with Sig/E7/LAMP-1 DNA vaccine combined with DNA encoding FasL shRNA, or non-specific shRNA via gene gun. The mice received three boosters with the same dose intradermally at four-day intervals. As shown in Figure 6Figure 6, while untreated tumor-bearing mice demonstrated continued increase in the tumor luminescence intensity over time (p=0.036), mice treated with Sig/E7/LAMP-1 DNA vaccine and DNA encoding FasL shRNA demonstrated continued decrease in the tumor luminescence intensity over time (p=0.042). Furthermore, mice treated with Sig/E7/LAMP-1 DNA vaccine and DNA encoding non specific shRNA demonstrated some therapeutic effect as shown by the decrease in tumor luminescence intensity over time, but the decrease in tumor luminescence intensity was not statistically significant (p=0.184). Taken together, our results suggest that the treatment with the DNA vaccine combined with DNA encoding FasL-specific shRNA generates potent therapeutic anti-tumor effects against E7-expressing tumors.
Figure 6
Figure 6
Figure 6
In vivo treatment experiment in tumor-challenged mice vaccinated with the combination of Sig/E7/LAMP-1 DNA and DNA encoding shRNAs
Blocking of FasL on the E7 peptide-loaded DCs reduces the apoptosis of E7-specific CD8+ T cells
We further characterized the role of FasL expressed on DCs in the induction of apoptotic cell death of E7-specific CD8+ T cells using an in vitro system. We incubated FasL-expressing E7 peptide-loaded DCs with E7-specific CD8+ T cells in the presence of FasL blocking Ab or isotype control. The E7-specific CD8+ T cells alone with FasL blocking Ab or isotype control were used as controls. The percentage of apoptotic cells were characterized using antibodies specific for activated caspase-3 and analyzed by flow cytometry analysis. As shown in Figure 7Figure 7, the E7-specific CD8+ T cells incubated with FasL-expressing E7 peptide-loaded DCs in the presence of the FasL blocking antibody demonstrated significantly lower percentage of apoptosis compared to cells incubated in the absence of the FasL blocking Ab (p < 0.005). Our data indicate that blocking of FasL on DCs leads to reduced apoptosis of E7-specific CD8+ T cells. Thus, this data supports our hypothesis that the downregulation of FasL in DCs using shRNA may lead to improved T cell survival, thus enhancing DNA vaccine potency.
Figure 7
Figure 7
Figure 7
Characterization of apoptotic cell death of E7-specific CD8+ T cells following incubation with E7 peptide-loaded DC-1 cells expressing FasL
In the current study, we have demonstrated an effective method for quantifying the kinetics of luciferase expression in vivo through a non-invasive bioluminescence imaging system. Our results indicated that the expression of luciferase in vivo peaked at 24 hours following DNA administration via gene gun. Furthermore, we observed that intradermal administration of luciferase DNA with DNA encoding shRNA targeting luciferase could significantly reduce the expression of luciferase in mice. In addition, we observed that mice vaccinated with Sig/E7/LAMP-1 DNA co-administered with DNA encoding shRNA targeting FasL generated significantly enhanced E7-specific CD8+ cytotoxic T cell responses as well as potent therapeutic antitumor effects against E7-expressing tumors. Furthermore, we demonstrated that blocking of FasL on the E7 peptide-loaded DCs reduces the apoptosis of E7-specific CD8+ T cells in vitro. Thus, we have shown that intradermal administration of DNA encoding shRNA is capable of silencing the gene of interest. This strategy can be potentially used to modify the properties of dendritic cells to enhance the potency of DNA vaccines.
The expression of FasL and its death receptor Fas has been reported in both T cells and DCs. Interactions between FasL expressed by DCs and Fas on the surface of T cells during antigen presentation may result in activation-induced T cell death through the extrinsic apoptosis pathway. This potentially represents a mechanism of immunological control to prevent hyperactivation of T cells in response to an infection or auto-antigen. In this event, knockdown of FasL in DCs might reduce signaling through Fas during antigen presentation, thereby protecting these T cells from DC FasL-mediated killing. We were unable to observe significant increases in the number E7-specific CD8+ T cells when mice were co-vaccinated with E7 DNA and DNA encoding shRNA targeting Fas (data not shown). These results suggest that downregulation of FasL in DCs strengthens the antigen-specific immune response predominately by preventing the death of T cells and not necessarily DCs themselves, since downregulation of Fas showed no such immune enhancement. It is has been suggested that DCs are not susceptible to the Fas-associated apoptotic pathway (Rescigno et al., 2000) and die mainly through the intrinsic apoptosis pathway and the action of granzymes and perforins secreted by T cells during antigen presentation.
The encouraging results from the current study suggest that RNAi methodology may be further applied in a similar context to inhibit the expression of molecules by DCs that suppress the generation of T cell-mediated immune responses (for review, see (Mao et al., 2007)). For example, the immunosuppressive tryptophan-degrading enzyme indoleamine-2, 3-dioxygenase (IDO) is secreted in considerable amounts by DCs (Munn et al., 2002; Lee et al., 2003). The presence of IDO in the tumor-draining lymph nodes depletes tryptophan availability in the local microenvironment, which may inhibit the mitosis and function of nearby T cells (Munn et al., 2002) or induce profound anergy in these cells (Munn et al., 2004). In addition, endogenous molecules produced by DCs may impair the activation of T cells, as has been recently shown for the suppressor of cytokine signaling 1 (SOCS1) protein. SOCS1 disrupts signaling pathways associated with IFN-γ, interleukin (IL)-2, IL-6, IL-7, IL-12, and IL-15 in T cells (Shen et al., 2004) and is also believed to suppress antigen presentation to T cells (Kubo et al., 2003). Several studies have shown that administration of siRNA targeting SOCS1 into DCs loaded with tumor antigen causes an increase in the number of tumor-specific T cells and inhibits the growth of established tumors in mice (Shen et al., 2004; Yang et al., 2006; Zhou et al., 2006). Thus, knockdown of such immunosuppressive molecules in DCs using RNA interference technology represents a potentially plausible approach to enhance the potency of DNA vaccines.
Another strategy to enhance DNA vaccine potency using intradermal administration via gene gun is the employment of RNAi targeting key pro-apoptotic proteins. We have previously shown that intradermal immunization of mice with E7 DNA together with DNA encoding several antiapoptotic proteins, including Bcl-2, Bcl-xL, XIAP, and SPI-6, could strongly protect DCs from T cell-induced apoptosis and generate potent immunity against E7-expressing tumors (Kim et al., 2003; Kim et al., 2004). To circumvent concerns of oncogenicity associated with the administration of DNA encoding antiapoptotic proteins, we have employed E7 DNA vaccines in conjunction with siRNA targeting key pro-apoptotic proteins, Bax and Bak to significantly enhance HPV E7-specific CD8+ T cell immune responses in vaccinated mice (Kim et al., 2005). Thus, it may be of interest to further investigate the knockdown of the other key pro-apoptotic proteins such as caspases-3, 8, and 9 in DCs to enhance DNA vaccine potency.
More recently, we have developed a strategy to enhance antigen-specific CD4+ T cell immune responses in mice by employing a DNA vaccine encoding the Invariant chain molecule (Ii chain), in which the CLIP region is replaced with a CD4+ T helper epitope, PADRE (Pan-DR-epitope) (Ii-PADRE DNA). We have demonstrated that co-administration of DNA vaccines with Ii-PADRE DNA led to enhancement of CD4+ T cells, resulting in enhanced antigen-specific CD8+ T cell immune responses and potent protective and therapeutic anti-tumor effects (Hung et al., 2007b). Since the strategy to enhance CD4+ T helper cells is different from the strategies to avoid apoptosis of T cells, such a strategy may potentially be used in combination with the current strategy in order to further enhance the potency of DNA vaccines.
In the future, it will be important to examine both the molecular mechanisms controlling T cell activation by DCs as well as the apoptotic process in DCs. It may also be of interest to couple these strategies with techniques for prolonging the lifespan of DCs and/or attenuating immunoinhibitory pathways that negatively regulate T cell activation. Thus, this study demonstrates the effectiveness and clinical feasibility of employing RNAi technology as an immunotherapeutic complement to enhance the potency of DNA vaccines.
Acknowledgments
We would like to thank Ms. Liangme He for assistance with plasmid construction, Dr. Richard Roden and Mr. Shaw-Wei Tsen for helpful discussion and critical review of the manuscript, and Drs. Xiaobing Yu and Linzhao Cheng for supplying the expression vectors for the FasL transfection experiments. We are also grateful to Ms. Lucy Wangaruro for excellent secretarial support and Ms. Archana Monie for preparation of the manuscript. This work was supported by National Cancer Institute SPORE in Cervical Cancer P50 CA098252 and the 1 RO1 CA114425-01 as well as the Johns Hopkins University Provost’s Undergraduate Research Awards program (CPM).
Footnotes
Author Disclosure Statement
No competing financial interests exist for any of the authors.
  • CAPLEN NJ. Gene therapy progress and prospects. Downregulating gene expression: the impact of RNA interference. Gene Ther. 2004;11:1241–1248. [PubMed]
  • CHEN CH, JI H, SUH KW, CHOTI MA, PARDOLL DM, WU TC. Gene gun-mediated DNA vaccination induces antitumor immunity against human papillomavirus type 16 E7-expressing murine tumor metastases in the liver and lungs. Gene Ther. 1999;6:1972–1981. [PubMed]
  • CHEN CH, WANG TL, HUNG CF, YANG Y, YOUNG RA, PARDOLL DM, WU TC. Enhancement of DNA vaccine potency by linkage of antigen gene to an HSP70 gene. Cancer Res. 2000;60:1035–1042. [PubMed]
  • DONNELLY JJ, ULMER JB, SHIVER JW, LIU MA. DNA vaccines. Annu Rev Immunol. 1997;15:617–648. [PubMed]
  • GUERMONPREZ P, VALLADEAU J, ZITVOGEL L, THERY C, AMIGORENA S. Antigen presentation and T cell stimulation by dendritic cells. Annu Rev Immunol. 2002;20:621–667. [PubMed]
  • GURUNATHAN S, KLINMAN DM, SEDER RA. DNA vaccines: immunology, application, and optimization. Annu Rev Immunol. 2000;18:927–974. [PubMed]
  • HUANG B, MAO CP, PENG S, HE L, HUNG CF, WU TC. Intradermal administration of DNA vaccines combining a strategy to bypass antigen processing with a strategy to prolong dendritic cell survival enhances DNA vaccine potency. Vaccine. 2007;25:7824–7831. [PubMed]
  • HUNG CF, TSAI YC, HE L, COUKOS G, FODOR I, QIN L, LEVITSKY H, WU TC. Vaccinia virus preferentially infects and controls human and murine ovarian tumors in mice. Gene Ther. 2007a;14:20–29. [PubMed]
  • HUNG CF, TSAI YC, HE L, WU TC. DNA Vaccines Encoding Ii-PADRE Generates Potent PADRE-specific CD4(+) T-Cell Immune Responses and Enhances Vaccine Potency. Mol Ther. 2007b;15:1211–1219. [PubMed]
  • JI H, CHANG EY, LIN KY, KURMAN RJ, PARDOLL DM, WU TC. Antigen-specific immunotherapy for murine lung metastatic tumors expressing human papillomavirus type 16 E7 oncoprotein. Int J Cancer. 1998;78:41–45. [PubMed]
  • KIM TW, HUNG CF, BOYD DA, HE L, LIN CT, KAISERMAN D, BIRD PI, WU TC. Enhancement of DNA vaccine potency by coadministration of a tumor antigen gene and DNA encoding serine protease inhibitor-6. Cancer Res. 2004;64:400–405. [PubMed]
  • KIM TW, HUNG CF, LING M, JUANG J, HE L, HARDWICK JM, KUMAR S, WU TC. Enhancing DNA vaccine potency by coadministration of DNA encoding antiapoptotic proteins. J Clin Invest. 2003;112:109–117. [PubMed]
  • KIM TW, LEE JH, HE L, BOYD DA, HARDWICK JM, HUNG CF, WU TC. Modification of professional antigen-presenting cells with small interfering RNA in vivo to enhance cancer vaccine potency. Cancer Res. 2005;65:309–316. [PubMed]
  • KUBO M, HANADA T, YOSHIMURA A. Suppressors of cytokine signaling and immunity. Nat Immunol. 2003;4:1169–1176. [PubMed]
  • LEE JR, DALTON RR, MESSINA JL, SHARMA MD, SMITH DM, BURGESS RE, MAZZELLA F, ANTONIA SJ, MELLOR AL, MUNN DH. Pattern of recruitment of immunoregulatory antigen-presenting cells in malignant melanoma. Lab Invest. 2003;83:1457–1466. [PubMed]
  • LEUNG RK, WHITTAKER PA. RNA interference: from gene silencing to gene-specific therapeutics. Pharmacol Ther. 2005;107:222–239. [PubMed]
  • LIN KY, GUARNIERI FG, STAVELEY-O’CARROLL KF, LEVITSKY HI, AUGUST JT, PARDOLL DM, WU TC. Treatment of established tumors with a novel vaccine that enhances major histocompatibility class II presentation of tumor antigen. Cancer Res. 1996;56:21–26. [PubMed]
  • LU L, QIAN S, HERSHBERGER PA, RUDERT WA, LYNCH DH, THOMSON AW. Fas ligand (CD95L) and B7 expression on dendritic cells provide counter-regulatory signals for T cell survival and proliferation. J Immunol. 1997;158:5676–5684. [PubMed]
  • MAO CP, HUNG CF, WU TC. Immunotherapeutic strategies employing RNA interference technology for the control of cancers. J Biomed Sci. 2007;14:15–29. [PubMed]
  • MUNN DH, SHARMA MD, HOU D, BABAN B, LEE JR, ANTONIA SJ, MESSINA JL, CHANDLER P, KONI PA, MELLOR AL. Expression of indoleamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor-draining lymph nodes. J Clin Invest. 2004;114:280–290. [PubMed]
  • MUNN DH, SHARMA MD, LEE JR, JHAVER KG, JOHNSON TS, KESKIN DB, MARSHALL B, CHANDLER P, ANTONIA SJ, BURGESS R, SLINGLUFF CL, JR, MELLOR AL. Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. Science. 2002;297:1867–1870. [PubMed]
  • RESCIGNO M, PIGUET V, VALZASINA B, LENS S, ZUBLER R, FRENCH L, KINDLER V, TSCHOPP J, RICCIARDI-CASTAGNOLI P. Fas engagement induces the maturation of dendritic cells (DCs), the release of interleukin (IL)-1beta, and the production of interferon gamma in the absence of IL-12 during DC-T cell cognate interaction: a new role for Fas ligand in inflammatory responses. J Exp Med. 2000;192:1661–1668. [PubMed]
  • SHANKAR P, MANJUNATH N, LIEBERMAN J. The prospect of silencing disease using RNA interference. Jama. 2005;293:1367–1373. [PubMed]
  • SHEN L, EVEL-KABLER K, STRUBE R, CHEN SY. Silencing of SOCS1 enhances antigen presentation by dendritic cells and antigen-specific anti-tumor immunity. Nat Biotechnol. 2004;22:1546–1553. [PubMed]
  • YANG R, YANG X, ZHANG Z, ZHANG Y, WANG S, CAI Z, JIA Y, MA Y, ZHENG C, LU Y, RODEN R, CHEN Y. Single-walled carbon nanotubes-mediated in vivo and in vitro delivery of siRNA into antigen-presenting cells. Gene Ther. 2006;13:1714–1723. [PubMed]
  • ZHOU H, ZHANG D, WANG Y, DAI M, ZHANG L, LIU W, LIU D, TAN H, HUANG Z. Induction of CML28-specific cytotoxic T cell responses using co-transfected dendritic cells with CML28 DNA vaccine and SOCS1 small interfering RNA expression vector. Biochem Biophys Res Commun. 2006;347:200–207. [PubMed]

See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph