• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Hepatol. Author manuscript; available in PMC Oct 28, 2008.
Published in final edited form as:
PMCID: PMC2574998
NIHMSID: NIHMS59493

The JNK inhibitor SP600129 enhances apoptosis of HCC cells induced by the tumor suppressor WWOX

Abstract

Background/Aims

The FRA16D fragile site gene WWOX is a tumor suppressor that participates in p53-mediated apoptosis. The c-jun N-terminal kinase JNK1 interacts with WWOX and inhibits apoptosis. We investigated the function of WWOX in human hepatocellular carcinoma (HCC) and the effect of JNK inhibition on WWOX-mediated apoptosis.

Methods

Allelic imbalance on chromosome 16 was analyzed in 73 HCCs using 53 microsatellite markers. WWOX mRNA in HCC cell lines and primary HCCs was measured by real-time RT-PCR. Effects of WWOX on proliferation and apoptosis and the interaction between WWOX and JNK inhibition were examined.

Results

Loss on chromosome 16 occurred in 34 of 73 HCCs. Of 11 HCC cell lines, 2 had low, 7 intermediate, and 2 had high WWOX mRNA. Of 51 primary tumors, 23 had low WWOX mRNA. Forced expression of WWOX in SNU387 cells decreased FGF2-mediated proliferation and enhanced apoptosis induced by staurosporine and the JNK inhibitor SP600129. Conversely, knockdown of WWOX in SNU449 cells using shRNA targeting WWOX increased proliferation and resistance to SP600129 induced apoptosis.

Conclusions

WWOX induces apoptosis and inhibits human HCC cell growth through a mechanism enhanced by JNK inhibition.

Keywords: WWOX, hepatocellular carcinoma, JNK, apoptosis

INTRODUCTION

Hepatocellular carcinoma (HCC) is the third most common cause of cancer death worldwide, with approximately 600,000 deaths in 2002(1). Risk factors for HCC include chronic hepatitis B and C virus infections, alcohol, non-alcoholic steatohepatitis, and dietary aflatoxins(2). The multi-kinase inhibitor sorafenib is currently the only approved agent for advanced HCC(3). Understanding the pathogenesis of HCC will allow the development of novel therapies.

Several genes within common fragile sites function as tumor suppressors in HCC, including FHIT (FRA3B), Parkin (FRA6E) and M6P/IGF2R (FRA6E) (49). Chromosome 16q is often altered in HCC, with loss of part or the entire arm (10, 11) (12, 13). The WW-domain containing oxidoreductase (WWOX) gene spans 1.5 Mb within the FRA16D fragile site at 16q23 (1417). WWOX is highly expressed in secretory epithelial cells, endocrine and exocrine organs, and urinary epithelial cells (18). WWOX has tumor suppressor properties (19)(59) and has been implicated in breast (14, 2026), ovarian (2729), prostate (3032), oral (33, 34), gastric (35, 36), pancreatic (37), esophageal (38), cutaneous (39) (4042), thyroid (43) and lung carcinomas (25, 4448) and meningiomas(49).

Homozygous deletions in the WWOX gene have been detected in cancer (12, 29, 50, 51), but point mutations of WWOX are rare (21, 38). Multiple WWOX splice variants, some of which have a dominant negative function, are expressed in cancer (52). WWOX is downregulated by promoter methylation in hematopoietic, pancreatic, breast, bladder and lung cancers (25, 50). In knock-out mice, haploinsufficiency of WWOX is tumorigenic (47, 5355). These alterations are similar to those of the FRA3B gene, FHIT, in cancer (5, 25, 56).

Functionally, WWOX is essential for TNF, UV, staurosporine and p53 mediated cell death (20). WWOX is localized in the mitochondria, nucleus, and Golgi (57, 58). WWOX is released from mitochondria during the mitochondrial membrane permeability transition, translocates to the nucleus, and cooperates with p53 in mediating apoptosis (20, 57, 58). c-jun N-terminal kinase (JNK) interacts with WWOX, phosphorylating WWOX at Tyr33 and Tyr61 residues and inhibiting WWOX-mediated apoptosis (59, 60). Consequently, it appears that WWOX is important in the p53 and JNK1 pathways. Both p53 and c-jun are important growth regulators in HCC, therefore it is likely that WWOX plays an important role in the pathogenesis of HCC. Prior evaluation of WWOX mRNA expression in human HCC cell lines showed that 13 of the 18 cell lines examined expressed low levels of WWOX mRNA (61).

We report here an analysis of WWOX expression in primary HCCs and the functional effects of suppression or restoration of WWOX expression in HCC cells. To determine the role of WWOX in hepatocarcinogenesis, we investigated 1) WWOX expression in HCCs, 2) allelic imbalance (LOH) in the WWOX gene region, 3) homozygous deletions in the WWOX gene in HCC cell lines, 4) the effect of WWOX on FGF2 mediated cell proliferation and 5) the effect of WWOX on HCC cell apoptosis induced by the non-specific kinase inhibitor, staurosporine, and the JNK inhibitor, SP600129.

MATERIALS AND METHODS

HCC tissues and cell lines

Paired tumor and benign liver tissues were obtained from 109 patients undergoing resections for HCC at Mayo Clinic between 1987 and 2003, snap-frozen in liquid nitrogen and stored at −80C. The Mayo Clinic Institutional Review Board approved the study.

Clinical characteristics were ascertained from the medical record in February 2007 (Table 1). HBV and HCV status was confirmed by PCR. Of the 109 patients, 75 were Caucasians (68.80%), 4 Asians (3.66%), 1 Hispanic (0.91%), 1 Black (0.91%), 6 Pacific Islanders (5.50%) and 23 unknown race (21.10%).

Table 1
Clinical Characteristics of 109 Study Participants

DNA from 73 patients was used for LOH analysis. WWOX mRNA expression and splice variant analyses were performed on a subset of samples that yielded high-quality RNA: real time PCR, 51; Northern blotting, 11; and splice variant analysis, 33 (variants from 11 were sequenced).

Eleven human HCC cell lines (Hep3B, HepG2, HUH7, PLC/PRF5, SKHep1, SNU182, SNU387, SNU398, SNU423, SNU449, and SNU475) obtained from the American Type Culture Collection were maintained in RPMI1640 with 10% fetal bovine serum (FBS) at 37C and 5% CO2.

Real-time PCR

RNA was purified using Trizol (Invitrogen) followed by RNAeasy column clean up (Qiagen Inc.)(62). Quantitative real-time PCR was performed using cDNA from 51 pairs of HCC tumor and benign tissue and 11 HCC cell lines on an ABI 7300 Sequence Detection System using 2X TaqMan Universal Master Mix and ABI Assay on Demand gene expression kits for WWOX and 18S ribosomal RNA (Hs_00249590_m1, Hs_00251319_m1 and 4333760). Primers were from both the 5’- and 3’-regions of the WWOX mRNA. A standard curve was prepared using WWOX cDNA cloned into the Topo-TA vector. Standards were measured in triplicate; test samples in duplicate.

WWOX splice variants

Analysis of splice variants was performed for 11 HCC cell lines and 33 benign and primary HCC tumor pairs. cDNA was prepared from 4 ug of total RNA using the Superscript III First Strand Synthesis System (Invitrogen Life Technologies Inc., Carlsbad, CA). 4 ug of commercial human liver RNA (Clontech Lab. Inc.) was used to prepare control cDNA for all the experiments performed. First and second nested PCR reactions were performed as previously described (29). PCR products were separated on 2% agarose gels, stained with ethidium bromide and photographed. For 11 of the primary HCCs, the 1.2 kb WWOX transcript and other smaller non-full length transcripts were subcloned into the TOPO TA plasmid vector (Invitrogen Life Technologies) and sequenced with appropriate primers on an ABI 377 DNA sequencing system.

LOH analysis

LOH analysis of DNA from 73 HCC and benign tissue pairs used 53 microsatellite markers on chromosome 16. Nine markers were within FRA16D, with four of the nine within the WWOX gene. LOH was performed as described previously(63).

Exon PCR and analysis for homozygous deletions

Exon screening using DNA extracted from 11 HCC cell lines was performed using primers for each of the 9 exons and standard PCR conditions as previously described (14). PCR products were separated on 2% agarose gels and examined for homozygous deletions.

Methylation specific PCR

DNA from 11 HCC cell lines was treated with sodium bisulfite using the EZ DNA methylation kit (Zymo Research, Orange CA), and eluted in 40 ul of elution buffer. One ul of bisulfite-modified DNA was amplified in a final reaction volume of 25 ul, using 1 X PCR buffer, 1.5 mM MgCl2 (Applied Biosystems), 200 uM each dNTP’s (Roche Diagnostics, Indianapolis, IN), 50 uM each of the methylation specific primers and 1.25 units of AmpliTaq Gold (Applied Biosystems). CpGenome Universal Methylated Bisulfite-treated human genomic DNA (Chemicon, Temecula, CA) was used as a positive control for methylation specific PCR. The amplification was performed using an initial hot-start step at 95C for 12 min, followed by 32 cycles of 95C for 45 s, annealing temperatures of either 65C or 58C for 45 s, extension at 72C for 45 s, and a final extension step at 72C for 10 min. The primers used for the methylation specific PCR were WWOX-M-F1 (5’ – TTTATTGTTCGTGTCGTTTAGTTTCGC – 3’) (+144 – +170) and WWOX-M-R1 (5’ – GCAATACGCAAACGTAAACGATCGA – 3’) (nucleotides +1 – +25 from the transcription start site) giving a 170 bp product and WWOX-M-F2 (5’ – GCCCCTACTCCGGCGAAACGGGAGCGGC -3’) (+488 – +516) and WWOX-M-R2 (5’ – GCGCACTCCAACGCAACGCGTACGA – 3’) (+310 – +334) giving a 207 bp product.

cDNA cloning

A 1,251 bp WWOX cDNA (bases 61 to 1311 of GenBank NM_016373, missing 13 amino acids at the C-terminal) was cloned into the Creator™ System plasmid, pDNR-1 (Clontech). Cre recombinase was used to place the WWOX sequence into the pLP-EGFP-C1 acceptor to produce plasmid pLP-WWOX-EGFP-C1, which expresses a WWOX-EGFP fusion protein.

shRNA targeting WWOX mRNA

An shRNA construct targeting WWOX mRNA was made by inserting the sequence 5’–AAGACTCAGTGGGAACATC–3’ into plasmid pSS-H1p, provided by Dr. Daniel D. Billadeau.

Transient and stable transfections of the SNU387 and SNU449 cell lines

HCC cell line SNU449, which has a high level of WWOX expression, and SNU387, which has a low level of WWOX expression, were selected for transfection. SNU449 carries a G to A substitution at nucleotide 481 of the p53 gene, leading to an alanine to threonine mutation at codon 161 which is associated with nuclear p53 accumulation, while SNU387 has a truncated p53 gene due to an A to T substitution at nucleotide 490 which leads to a stop codon at position 164.

SNU387 cells were transfected with control vector or the pLP-WWOX-EGFP-C1 plasmid. Cells were seeded at 100,000 cells per ml in 6 well plates, in RPMI1640 with 10% FBS. After overnight incubation, cells were transfected using 2 µg DNA and 3 ul Lipofectamine 2000 reagent (Invitrogen). 48 hours later selection was started using G418 (Invitrogen)(58c). Established clones (SNU387 Vector, SNU387 WWOX1 and SNU387 WWOX3) were grown in 150 µg/ml G418.

SNU449 cells were transfected with the WWOX-shRNA-pSS-H1p construct as above; established clones were grown in 350 µg/ml G418.

WWOX antibodies

Anti-WWOX monoclonal antibody H2267 was provided by Dr. Akira Watanabe (64).

Western immunoblotting

Twenty micrograms of total cellular protein from SNU449 stably transfected with shRNA targeting WWOX was resolved by SDS-PAGE (61). Blots were probed with WWOX monoclonal antibody H2267 and anti-phospho-ERK antibody (Cell Signaling Technologies Inc., MA). Anti-Actin and anti-total ERK were used to control for loading.

Cell proliferation and apoptosis assays

SNU449 cells and clones stably transfected with the pSSH1p vector or the WWOX-shRNA-pSS-H1p plasmid, were plated at 5,000 cells per well. SNU387 cells and clones stably-transfected with vector or pLP-WWOX- EGFP-C1 were plated at 10,000 cells per well in RPMI1640 with 10% FBS. Cells were treated with staurosporine, FGF2(65), or the JNK inhibitor SP600129(66). Cell proliferation was assessed by cell counting, MTT assay, or BrdU incorporation(67). Apoptosis was assessed by DAPI staining and fluorescence microscopy(68).

RESULTS

WWOX mRNA expression is decreased in 45% of HCCs

WWOX mRNA expression in 11 HCC cell lines and 51 tumor and benign tissue pairs was determined by real time RT-PCR using 18S ribosomal RNA as an internal control (Figure 1A and B). We found moderately high WWOX mRNA expression in SNU449 cells and essentially undetectable expression in SNU387 cells as previously reported (48). Of the 51 primary HCCs, WWOX was downregulated in 23 (45%) as compared to the adjacent benign tissue.

Figure 1
WWOX mRNA expression in HCC cell lines and primary tumors. WWOX mRNA expression of HCC cell lines and benign and tumor tissue pairs were evaluated by real-time PCR

45% of HCCs show allelic imbalance (LOH) on chromosome 16

The 73 tumors were designated as non-informative (homozygous) or informative (heterozygous). For informative samples, a ratio was determined between tumor and benign tissue based on relative peak fluorescence values. Samples were scored as negative (no LOH) or positive (LOH)(Figure 2). 39 (53%) showed no LOH, 13 (18%) showed partial LOH on chromosome 16q, 6 (8%) showed loss of the entire q arm, and 15 (21%) showed loss of both the p and q arms. There was no significant correlation between partial or complete loss of chromosome 16 and patient survival.

Figure 2
LOH analysis of chromosome 16 in 73 primary HCCs. Five of 73 HCCs analyzed showed loss of chromosome 16q only, an additional 15 showed loss of the entire chromosome; the peak LOH at the WWOX locus was 40%. LOH analysis of 73 HCCs chromosome 16 using 53 ...

WWOX splice variants occur more frequently in tumor than benign tissues

Of the 11 HCC cell lines, 4 expressed only the full-length WWOX mRNA transcript; the remaining 7 expressed only splice variants without the full-length transcript. Of the 33 pairs of benign and primary HCC tumors, the full-length 1.25 kb transcript was expressed by every benign and tumor tissue. In addition, several tumor and benign tissues expressed shorter splice variants. Seven of the 33 primary HCCs expressed only the full-length transcript, 10 expressed alternative splice variants in tumor but not in associated benign tissue, 15 expressed variants in both tumor and benign tissue, and one HCC expressed a smaller variant in benign tissue only. Therefore, 25 (76%) of the 33 tumors expressed splice variants, whereas only 14 (42%) of the 33 benign tissues expressed splice variants (p < 0.01). All the splice variants were previously described in other tumor types (29). The functional consequences of these splice variants are not completely elucidated, however some may have dominant negative effects on WWOX function and others may be resistant to degradation. In particular, the WWOXDelta5-8 variant missing exons 5–8 (encoding the oxidoreductase domain) lacks a phosphorylation site for the tyrosine kinase activated Cdc42-associated kinase (Ack1), which is critical for polyubiquitination and degradation of WWOX(69). Hence, it fails to undergo Ack1-induced degradation and may also have a dominant negative effect on WWOX function.

Analysis for homozygous deletions

None of the cell lines had homozygous deletions of the WWOX gene. As previously reported, the PLC/PRF/5 (Alexander) cell line showed an extra PCR fragment representing an additional exon (61).

No evidence of WWOX promoter methylation

None of the 11 HCC cell lines showed evidence of promoter methylation.

Downregulation of WWOX in SNU449 increases proliferation and decreases staurosporine-induced apoptosis

SNU449 cells were transiently-transfected with a WWOX shRNA plasmid construct or the control vector pSS-H1p. In control DMSO treated cells, suppression of WWOX expression significantly increased proliferation. Staurosporine significantly reduced cell viability to approximately 25% of control values in both vector-transfected and WWOX suppressed cells (Figure 3A). Suppression of WWOX expression resulted in a decrease in both baseline and staurosporine-induced apoptosis (Figure 3B and 3C).

Figure 3
shRNA-mediated knockdown of WWOX in SNU449 cells inhibits staurosporine-induced apoptosis and enhances FGF2-induced cell proliferation

In SNU449 cells stably-transfected with the WWOX shRNA plasmid, real-time PCR showed 40% lower WWOX mRNA than in vector-transfected controls; Western immunoblotting also showed a 30% decrease in WWOX protein (Figure 3D).

The proliferation rates of the Vector and WWOX shRNA-transfected cells were measured by cell counting and BrdU incorporation. Downregulation of WWOX increased SNU449 shRNA cells compared to SNU449 Vector cells by 2 days after cell plating, persisting to day 5 (Figure 3E). Downregulation of WWOX also significantly enhanced unstimulated and FGF2-stimulated cell proliferation (Figure 3F).

Restoration of WWOX expression markedly stimulates apoptosis and inhibits proliferation of SNU387 cells

SNU387 cells, which express low levels of WWOX, were transfected with pLP-WWOX-EGFP-C1 or the control pLP-EGFP-C1. After transient transfection, there was a profound change in cell morphology (Figure 4A), with development of nuclear condensation, cytoplasmic vacuolization and markedly increased cell death in WWOX-transfected cells, with up to 95% cell death at 72 hours (Figure 4B and C). With this profound degree of cell killing it was impossible to select SNU387 clones expressing WWOX at high levels.

Figure 4
Transient or stable forced expression of WWOX in SNU387 cells induced marked morphologic changes, increased staurosporine-induced apoptosis and inhibited FGF2-mediated cell proliferation

Twelve to sixteen weeks after beginning drug selection, we were able to isolate two WWOX-transfected clones resistant to G418. Both clones, SNU387 WWOX1 and SNU387 WWOX3, showed substantial inhibition of proliferation compared to vector-transfected cells (Figure 4D). The WWOX-transfected clones showed significantly increased staurosporine-induced apoptosis (Figure 4E). Finally, basal and FGF-stimulated proliferation were also decreased by WWOX transfection (Figure 4F).

The JNK inhibitor SP 600129 enhances WWOX-induced apoptosis and growth inhibition

Phosphorylation by JNK1 kinase appears to regulate WWOX function. To assess the interaction of JNK kinase with WWOX in HCC, we examined the effects of JNK kinase inhibition on apoptosis and cell proliferation in cells expressing WWOX at low or high levels. SNU387 Vector, SNU387 WWOX1 and SNU387 WWOX3 cells treated with SP600129 for 6 hours were examined by phase contrast and fluorescence microscopy after DAPI staining (Figure 5A). SNU387 WWOX1 and SNU387 WWOX3 cells showed increased apoptosis when compared to vector-transfected cells. Apoptosis was significantly enhanced by SP600129 (Figure 5B). SP600129 also enhanced the WWOX-induced decrease in cell proliferation (Figure 5C). Next, we examined the effect of WWOX and SP600129 on phosphorylation of ERK1/2 kinase, which is downstream of JNK kinase. As expected, treatment of SNU387 Vector cells with SP600129 substantially inhibited ERK phosphorylation. In addition, concurrent expression of WWOX further inhibited ERK phosphorylation (Figure 5D).

Figure 5
Effects of the JNK inhibitor, SP 600129, on apoptosis and proliferation in SNU387 and SNU449 HCC cell lines with forced expression or downregulation of WWOX expression

Finally, we examined the effect of treatment with SP600129 on apoptosis and proliferation in cells with shRNA-mediated downregulation of WWOX. After downregulation of WWOX, SP600129-induced apoptosis was significantly decreased (Figure 5E). Further, while down-regulation of WWOX increased cell proliferation, SP600129 significantly reduced the proliferation of SNU449 cells to about 25% of control (Figure 5F).

DISCUSSION

The WWOX gene spans the FRA16D fragile site at chromosome 16q23. WWOX has been implicated in p53-mediated apoptosis and functions as a tumor suppressor in several cancers. Mutations and deletions in the coding region of WWOX rarely occur in cancer (11). Suppression of WWOX expression by promoter hypermethylation has been demonstrated in squamous cell lung carcinomas, invasive breast carcinomas and transitional cell bladder carcinomas, with methylation frequencies of 62.5%, 53%, and 29%, respectively (24). In contrast, WWOX does not appear to be regulated by methylation in breast cancer cell lines (19).

Eleven (61%) of 18 human HCC cell lines showed downregulation of WWOX mRNA expression, and 75% showed low or undetectable levels of WWOX protein, suggesting the involvement of the gene in hepatocarcinogenesis (61). Therefore, we 1) determined WWOX expression in primary HCCs; 2) investigated the regulation of WWOX expression in HCC, 3) determined whether WWOX functions as a tumor suppressor in HCC cells, and 4) investigated the interaction of WWOX with JNK pathway inhibition.

We found that modulation of WWOX in HCC cells has a dramatic effect on cell morphology, proliferation, and apoptosis. Forced expression of WWOX produced significant morphologic changes, induced spontaneous apoptosis, and profoundly inhibited cell proliferation. Conversely, downregulation of WWOX led to increased cell proliferation, supporting the tumor suppressor role of WWOX in HCC.

To elucidate the mechanisms regulating inhibition of WWOX function in HCC, we analyzed mRNA expression, LOH, mRNA splice variants, and promoter methylation of the WWOX gene.

WWOX mRNA expression was decreased in 45% of HCCs when compared to surrounding benign tissue. LOH analysis showed that chromosome 16 is frequently lost in its entirety in HCC. Since the 16q arm also contains the E cadherin tumor suppressor at 16q22, there may be functional cooperativity between loss of WWOX and loss of E cadherin and other tumor suppressors on chromosome 16. E cadherin loss has been shown to predict aggressive clinical behavior of HCCs, including recurrence of disease after liver transplantation(7074).

WWOX promoter region methylation was not found in any of the 11 HCC cell lines tested by methylation-specific PCR. Treatment of HCC cell lines with the demethylating agent 5-aza-2’-deoxycytidine did not result in enhanced WWOX mRNA expression, confirming that WWOX is not regulated by methylation. It is possible that, similar to the observation in breast cancer, the WWOX promoter is regulated by methylation in primary HCCs, but not in cell lines.

Multiple splice variants of the WWOX gene have been described, some of which may have a dominant negative function, suggesting that WWOX function is regulated by alternative splicing. Tumors were significantly more likely than benign tissues to have splice variants, but no statistically significant correlation was found between the presence or the absence of splice variants and any clinical variables. This may have been due to the relatively small number of tumors examined.

WWOX profoundly enhanced both spontaneous and staurosporine-induced apoptosis and inhibited HCC cell proliferation. JNK1 kinase phosphorylates WWOX and antagonizes its p53-mediated effects on apoptosis and the cell cycle. To elucidate the potential role of JNK kinase in WWOX-mediated effects in HCC and the potential for inhibition of JNK as a therapeutic modality, we treated HCC cells with the JNK inhibitor SP600129. SP600129 enhanced WWOX-induced apoptosis and also cooperated with WWOX in suppressing HCC cell proliferation. This is consistent with the reported effect of JNK in driving cyclin D1 expression and cell proliferation during liver regeneration and during stimulation of liver cell growth by the HCV non-structural protein 3(75), but contrasts with evidence that phosphorylation and activation of JNK in both non-transformed and transformed hepatocytes promotes apoptosis induced by oxidative stress, death receptor signaling, acetaminophen and troglitazone(7679). Thus, JNK appears to mediate either pro-apoptotic or pro-survival effects depending on the cell type and system studied.

In summary, forced expression of WWOX in HCC cell lines by transient or stable transfection induces profound changes in cell morphology, a high rate of spontaneous apoptosis, and increased sensitivity to apoptosis induced by the JNK inhibitor SP600129, supporting the tumor suppressor function of WWOX in HCC. Measures to enhance WWOX expression or WWOX dependent pathways in HCCs with low WWOX expression may be of therapeutic importance. The available data suggests that WWOX is a critical regulator of the p53 and JNK1 kinase stress response pathways. Additional studies to explore the role of these pathways in WWOX-function are anticipated.

ACKNOWLEDGEMENTS

The authors are grateful to Erin Nystuen-Bungum, Stacy Roberson, and Vicki Campion for secretarial assistance. The authors also thank Drs. James Tarara, Dr. Akira Watanabe, Amy French, Jennifer Schroeder, Regenia Smalley, Megan Garrity-Park, Linda M. Stadheim, Linda M. Murphy and Ross Aleff for technical assistance; and Drs. Gregory Gores and Rosebud Roberts for critical review of the manuscript.

This study was supported by National Institutes of Health grants CA82862 and CA100882, an Industry Research Scholar Award from the Foundation for Digestive Health and Nutrition, a Harold Amos Medical Faculty Development Award from The Robert Wood Johnson Foundation, a generous gift from The Richard M. Schulze Family Foundation, the Miles and Shirley Fiterman Center for Digestive Diseases at the Mayo Clinic, Rochester, MN, the Mayo Clinic Cancer Center and the Mayo Foundation (to LRR).

Abbreviations

HCC
hepatocellular carcinoma
LOH
loss of heterozygosity
WWOX
WW domain containing oxidoreductase gene
FHIT
fragile histidine triad gene
FBS
fetal bovine serum

REFERENCES

1. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin. 2005 Mar–Apr;55(2):74–108. [PubMed]
2. El-Serag HB, Rudolph KL. Hepatocellular carcinoma: epidemiology and molecular carcinogenesis. Gastroenterology. 2007 Jun;132(7):2557–2576. [PubMed]
3. Llovet JRS, Mazzaferro V, Hilgard P, Raoul J, Zeuzem S, Poulin-Costello M, Moscovici M, Voliotis D, Bruix J. For the Sharp Investigators Study Group. Sorafenib improves survival in advanced Hepatocellular Carcinoma (HCC): Results of a Phase III randomized placebo-controlled trial (SHARP trial); ASCO Annual Meeting 2007; 2007.
4. Yamada T, De Souza AT, Finkelstein S, Jirtle RL. Loss of the gene encoding mannose 6-phosphate/insulin-like growth factor II receptor is an early event in liver carcinogenesis. Proc Natl Acad Sci U S A. 1997 Sep 16;94(19):10351–10355. [PMC free article] [PubMed]
5. Yuan BZ, Keck-Waggoner C, Zimonjic DB, Thorgeirsson SS, Popescu NC. Alterations of the FHIT gene in human hepatocellular carcinoma. Cancer Res. 2000 Feb 15;60(4):1049–1053. [PubMed]
6. Kishimoto Y, Morisawa T, Kitano M, Shiota G, Horie Y, Suou T, et al. Loss of heterozygosity of the mannose 6-phosphate/insulin-like growth factor II receptor and p53 genes in human hepatocellular carcinoma. Hepatol Res. 2001 May 1;20(1):68–83. [PubMed]
7. Oka Y, Waterland RA, Killian JK, Nolan CM, Jang HS, Tohara K, et al. M6P/IGF2R tumor suppressor gene mutated in hepatocellular carcinomas in Japan. Hepatology. 2002 May;35(5):1153–1163. [PubMed]
8. Denison SR, Callahan G, Becker NA, Phillips LA, Smith DI. Characterization of FRA6E and its potential role in autosomal recessive juvenile parkinsonism and ovarian cancer. Genes Chromosomes Cancer. 2003 Sep;38(1):40–52. [PubMed]
9. Wang F, Denison S, Lai JP, Philips LA, Montoya D, Kock N, et al. Parkin gene alterations in hepatocellular carcinoma. Genes Chromosomes Cancer. 2004 Jun;40(2):85–96. [PubMed]
10. Balsara BR, Pei J, De Rienzo A, Simon D, Tosolini A, Lu YY, et al. Human hepatocellular carcinoma is characterized by a highly consistent pattern of genomic imbalances, including frequent loss of 16q23.1–24.1. Genes Chromosomes Cancer. 2001 Mar;30(3):245–253. [PubMed]
11. Yakicier MC, Legoix P, Vaury C, Gressin L, Tubacher E, Capron F, et al. Identification of homozygous deletions at chromosome 16q23 in aflatoxin B1 exposed hepatocellular carcinoma. Oncogene. 2001 Aug 23;20(37):5232–5238. [PubMed]
12. Krummel KA, Roberts LR, Kawakami M, Glover TW, Smith DI. The characterization of the common fragile site FRA16D and its involvement in multiple myeloma translocations. Genomics. 2000 Oct 1;69(1):37–46. [PubMed]
13. Paige AJ, Taylor KJ, Stewart A, Sgouros JG, Gabra H, Sellar GC, et al. A 700-kb physical map of a region of 16q23.2 homozygously deleted in multiple cancers and spanning the common fragile site FRA16D. Cancer Res. 2000 Mar 15;60(6):1690–1697. [PubMed]
14. Bednarek AK, Laflin KJ, Daniel RL, Liao Q, Hawkins KA, Aldaz CM. WWOX, a novel WW domain-containing protein mapping to human chromosome 16q23.3–24.1, a region frequently affected in breast cancer. Cancer Res. 2000 Apr 15;60(8):2140–2145. [PubMed]
15. Krummel KA, Denison SR, Calhoun E, Phillips LA, Smith DI. The common fragile site FRA16D and its associated gene WWOX are highly conserved in the mouse at Fra8E1. Genes Chromosomes Cancer. 2002 Jun;34(2):154–167. [PubMed]
16. O'Keefe LV, Richards RI. Common chromosomal fragile sites and cancer: focus on FRA16D. Cancer Lett. 2006 Jan 28;232(1):37–47. [PubMed]
17. Ried K, Finnis M, Hobson L, Mangelsdorf M, Dayan S, Nancarrow JK, et al. Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells. Hum Mol Genet. 2000 Jul 1;9(11):1651–1663. [PubMed]
18. Nunez MI, Ludes-Meyers J, Aldaz CM. WWOX protein expression in normal human tissues. J Mol Histol. 2006 May;37(3–4):115–125. [PubMed]
19. Bednarek AK, Keck-Waggoner CL, Daniel RL, Laflin KJ, Bergsagel PL, Kiguchi K, et al. WWOX, the FRA16D gene, behaves as a suppressor of tumor growth. Cancer Res. 2001 Nov 15;61(22):8068–8073. [PubMed]
20. Chang NS, Doherty J, Ensign A, Schultz L, Hsu LJ, Hong Q. WOX1 is essential for tumor necrosis factor-, UV light-, staurosporine-, and p53-mediated cell death, and its tyrosine 33-phosphorylated form binds and stabilizes serine 46-phosphorylated p53. J Biol Chem. 2005 Dec 30;280(52):43100–43108. [PubMed]
21. Driouch K, Prydz H, Monese R, Johansen H, Lidereau R, Frengen E. Alternative transcripts of the candidate tumor suppressor gene, WWOX, are expressed at high levels in human breast tumors. Oncogene. 2002 Mar 14;21(12):1832–1840. [PubMed]
22. Guler G, Uner A, Guler N, Han SY, Iliopoulos D, Hauck WW, et al. The fragile genes FHIT and WWOX are inactivated coordinately in invasive breast carcinoma. Cancer. 2004 Apr 15;100(8):1605–1614. [PubMed]
23. Guler G, Uner A, Guler N, Han SY, Iliopoulos D, McCue P, et al. Concordant loss of fragile gene expression early in breast cancer development. Pathol Int. 2005 Aug;55(8):471–478. [PubMed]
24. Iliopoulos D, Fabbri M, Druck T, Qin HR, Han SY, Huebner K. Inhibition of breast cancer cell growth in vitro and in vivo: effect of restoration of Wwox expression. Clin Cancer Res. 2007 Jan 1;13(1):268–274. [PubMed]
25. Iliopoulos D, Guler G, Han SY, Johnston D, Druck T, McCorkell KA, et al. Fragile genes as biomarkers: epigenetic control of WWOX and FHIT in lung, breast and bladder cancer. Oncogene. 2005 Feb 24;24(9):1625–1633. [PubMed]
26. van Wezel T, Lombaerts M, van Roon EH, Philippo K, Baelde HJ, Szuhai K, et al. Expression analysis of candidate breast tumour suppressor genes on chromosome 16q. Breast Cancer Res. 2005;7(6):R998–R1004. [PMC free article] [PubMed]
27. Gourley C, Paige AJ, Taylor KJ, Scott D, Francis NJ, Rush R, et al. WWOX mRNA expression profile in epithelial ovarian cancer supports the role of WWOX variant 1 as a tumour suppressor, although the role of variant 4 remains unclear. Int J Oncol. 2005 Jun;26(6):1681–1689. [PubMed]
28. Nunez MI, Rosen DG, Ludes-Meyers JH, Abba MC, Kil H, Page R, et al. WWOX protein expression varies among ovarian carcinoma histotypes and correlates with less favorable outcome. BMC Cancer. 2005;5(1):64. [PMC free article] [PubMed]
29. Paige AJ, Taylor KJ, Taylor C, Hillier SG, Farrington S, Scott D, et al. WWOX: a candidate tumor suppressor gene involved in multiple tumor types. Proc Natl Acad Sci U S A. 2001 Sep 25;98(20):11417–11422. [PMC free article] [PubMed]
30. Chang NS, Schultz L, Hsu LJ, Lewis J, Su M, Sze CI. 17beta-Estradiol upregulates and activates WOX1/WWOXv1 and WOX2/WWOXv2 in vitro: potential role in cancerous progression of breast and prostate to a premetastatic state in vivo. Oncogene. 2005 Jan 20;24(4):714–723. [PubMed]
31. Qin HR, Iliopoulos D, Semba S, Fabbri M, Druck T, Volinia S, et al. A role for the WWOX gene in prostate cancer. Cancer Res. 2006 Jul 1;66(13):6477–6481. [PubMed]
32. Watson JE, Doggett NA, Albertson DG, Andaya A, Chinnaiyan A, van Dekken H, et al. Integration of high-resolution array comparative genomic hybridization analysis of chromosome 16q with expression array data refines common regions of loss at 16q23-qter and identifies underlying candidate tumor suppressor genes in prostate cancer. Oncogene. 2004 Apr 22;23(19):3487–3494. [PubMed]
33. Pimenta FJ, Gomes DA, Perdigao PF, Barbosa AA, Romano-Silva MA, Gomez MV, et al. Characterization of the tumor suppressor gene WWOX in primary human oral squamous cell carcinomas. Int J Cancer. 2006 Mar 1;118(5):1154–1158. [PubMed]
34. Pimenta FJ, Cordeiro GT, Pimenta LG, Viana MB, Lopes J, Gomez MV, et al. Molecular alterations in the tumor suppressor gene WWOX in oral leukoplakias. Oral Oncol. 2007 Nov 29; [PubMed]
35. Aqeilan RI, Kuroki T, Pekarsky Y, Albagha O, Trapasso F, Baffa R, et al. Loss of WWOX expression in gastric carcinoma. Clin Cancer Res. 2004 May 1;10(9):3053–3058. [PubMed]
36. Kuroki T, Tajima Y, Furui J, Kanematsu T. Common fragile genes and digestive tract cancers. Surg Today. 2006;36(1):1–5. [PubMed]
37. Kuroki T, Yendamuri S, Trapasso F, Matsuyama A, Aqeilan RI, Alder H, et al. The tumor suppressor gene WWOX at FRA16D is involved in pancreatic carcinogenesis. Clin Cancer Res. 2004 Apr 1;10(7):2459–2465. [PubMed]
38. Kuroki T, Trapasso F, Shiraishi T, Alder H, Mimori K, Mori M, et al. Genetic alterations of the tumor suppressor gene WWOX in esophageal squamous cell carcinoma. Cancer Res. 2002 Apr 15;62(8):2258–2260. [PubMed]
39. Lai FJ, Cheng CL, Chen ST, Wu CH, Hsu LJ, Lee JY, et al. WOX1 is essential for UVB irradiation-induced apoptosis and down-regulated via translational blockade in UVB-induced cutaneous squamous cell carcinoma in vivo. Clin Cancer Res. 2005 Aug 15;11(16):5769–5777. [PubMed]
40. Ishii H, Mimori K, Inageta T, Murakumo Y, Vecchione A, Mori M, et al. Components of DNA damage checkpoint pathway regulate UV exposure-dependent alterations of gene expression of FHIT and WWOX at chromosome fragile sites. Mol Cancer Res. 2005 Mar;3(3):130–138. [PubMed]
41. O'Keefe LV, Liu Y, Perkins A, Dayan S, Saint R, Richards RI. FRA16D common chromosomal fragile site oxido-reductase (FOR/WWOX) protects against the effects of ionizing radiation in Drosophila. Oncogene. 2005 Sep 29;24(43):6590–6596. [PubMed]
42. Thavathiru E, Ludes-Meyers JH, MacLeod MC, Aldaz CM. Expression of common chromosomal fragile site genes, WWOX/FRA16D and FHIT/FRA3B is downregulated by exposure to environmental carcinogens, UV, and BPDE but not by IR. Mol Carcinog. 2005 Nov;44(3):174–182. [PubMed]
43. Dias EP, Pimenta FJ, Sarquis MS, Dias Filho MA, Aldaz CM, Fujii JB, et al. Association between decreased WWOX protein expression and thyroid cancer development. Thyroid. 2007 Nov;17(11):1055–1059. [PubMed]
44. Cantor JP, Iliopoulos D, Rao AS, Druck T, Semba S, Han SY, et al. Epigenetic modulation of endogenous tumor suppressor expression in lung cancer xenografts suppresses tumorigenicity. Int J Cancer. 2007 Jan 1;120(1):24–31. [PubMed]
45. Donati V, Fontanini G, Dell'omodarme M, Prati MC, Nuti S, Lucchi M, et al. WWOX Expression in Different Histologic Types and Subtypes of Non-Small Cell Lung Cancer. Clin Cancer Res. 2007 Feb 1;13(3):884–891. [PubMed]
46. Fabbri M, Iliopoulos D, Trapasso F, Aqeilan RI, Cimmino A, Zanesi N, et al. WWOX gene restoration prevents lung cancer growth in vitro and in vivo. Proc Natl Acad Sci U S A. 2005 Oct 25;102(43):15611–15616. [PMC free article] [PubMed]
47. Yendamuri S, Kuroki T, Trapasso F, Henry AC, Dumon KR, Huebner K, et al. WW domain containing oxidoreductase gene expression is altered in non-small cell lung cancer. Cancer Res. 2003 Feb 15;63(4):878–881. [PubMed]
48. Zhou Y, Xu Y, Zhang Z. Deletion and mutation of WWOX exons 6–8 in human non-small cell lung cancer. J Huazhong Univ Sci Technolog Med Sci. 2005;25(2):162–165. [PubMed]
49. Aarhus M, Bruland O, Bredholt G, Lybaek H, Husebye ES, Krossnes BK, et al. Microarray analysis reveals down-regulation of the tumour suppressor gene WWOX and up-regulation of the oncogene TYMS in intracranial sporadic meningiomas. J Neurooncol. 2008 Mar 26; [PubMed]
50. Ishii H, Vecchione A, Furukawa Y, Sutheesophon K, Han SY, Druck T, et al. Expression of FRA16D/WWOX and FRA3B/FHIT genes in hematopoietic malignancies. Mol Cancer Res. 2003 Nov;1(13):940–947. [PubMed]
51. Alsop AE, Taylor K, Zhang J, Gabra H, Paige AJ, Edwards PA. Homozygous deletions may be markers of nearby heterozygous mutations: The complex deletion at FRA16D in the HCT116 colon cancer cell line removes exons of WWOX. Genes Chromosomes Cancer. 2008 May;47(5):437–447. [PubMed]
52. Ludes-Meyers JH, Bednarek AK, Popescu NC, Bedford M, Aldaz CM. WWOX, the common chromosomal fragile site, FRA16D, cancer gene. Cytogenet Genome Res. 2003;100(1–4):101–110. [PubMed]
53. Aqeilan RI, Trapasso F, Hussain S, Costinean S, Marshall D, Pekarsky Y, et al. Targeted deletion of Wwox reveals a tumor suppressor function. Proc Natl Acad Sci U S A. 2007 Mar 6;104(10):3949–3954. [PMC free article] [PubMed]
54. Philipp-Staheli J, Payne SR, Kemp CJ. p27(Kip1): regulation and function of a haploinsufficient tumor suppressor and its misregulation in cancer. Exp Cell Res. 2001 Mar 10;264(1):148–168. [PubMed]
55. Zanesi N, Fidanza V, Fong LY, Mancini R, Druck T, Valtieri M, et al. The tumor spectrum in FHIT-deficient mice. Proc Natl Acad Sci U S A. 2001 Aug 28;98(18):10250–10255. [PMC free article] [PubMed]
56. Kannangai R, Sahin F, Adegbola O, Ashfaq R, Su GH, Torbenson M. FHIT mRNA and protein expression in hepatocellular carcinoma. Mod Pathol. 2004 Jun;17(6):653–659. [PubMed]
57. Chang NS. A potential role of p53 and WOX1 in mitochondrial apoptosis (review) Int J Mol Med. 2002 Jan;9(1):19–24. [PubMed]
58. Chang NS, Pratt N, Heath J, Schultz L, Sleve D, Carey GB, et al. Hyaluronidase induction of a WW domain-containing oxidoreductase that enhances tumor necrosis factor cytotoxicity. J Biol Chem. 2001 Feb 2;276(5):3361–3370. [PubMed]
59. Chang NS, Doherty J, Ensign A. JNK1 physically interacts with WW domain-containing oxidoreductase (WOX1) and inhibits WOX1-mediated apoptosis. J Biol Chem. 2003 Mar 14;278(11):9195–9202. [PubMed]
60. Chen ST, Chuang JI, Cheng CL, Hsu LJ, Chang NS. Light-induced retinal damage involves tyrosine 33 phosphorylation, mitochondrial and nuclear translocation of WW domain-containing oxidoreductase in vivo. Neuroscience. 2005;130(2):397–407. [PubMed]
61. Park SW, Ludes-Meyers J, Zimonjic DB, Durkin ME, Popescu NC, Aldaz CM. Frequent downregulation and loss of WWOX gene expression in human hepatocellular carcinoma. Br J Cancer. 2004 Aug 16;91(4):753–759. [PMC free article] [PubMed]
62. Jiang J, Gusev Y, Aderca I, Mettler TA, Nagorney DM, Brackett DJ, et al. Association of MicroRNA expression in hepatocellular carcinomas with hepatitis infection, cirrhosis, and patient survival. Clin Cancer Res. 2008 Jan 15;14(2):419–427. [PMC free article] [PubMed]
63. Lai JP, Chien JR, Moser DR, Staub JK, Aderca I, Montoya DP, et al. hSulf1 Sulfatase promotes apoptosis of hepatocellular cancer cells by decreasing heparin-binding growth factor signaling. Gastroenterology. 2004 Jan;126(1):231–248. [PubMed]
64. Watanabe A, Hippo Y, Taniguchi H, Iwanari H, Yashiro M, Hirakawa K, et al. An opposing view on WWOX protein function as a tumor suppressor. Cancer Res. 2003 Dec 15;63(24):8629–8633. [PubMed]
65. Shimoyama Y, Gotoh M, Ino Y, Sakamoto M, Kato K, Hirohashi S. Characterization of high-molecular-mass forms of basic fibroblast growth factor produced by hepatocellular carcinoma cells: possible involvement of basic fibroblast growth factor in hepatocarcinogenesis. Jpn J Cancer Res. 1991 Nov;82(11):1263–1270. [PubMed]
66. Bennett BL, Sasaki DT, Murray BW, O'Leary EC, Sakata ST, Xu W, et al. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):13681–13686. [PMC free article] [PubMed]
67. Lai JP, Sandhu DS, Yu C, Han T, Moser CD, Jackson KK, et al. Sulfatase 2 up-regulates glypican 3, promotes fibroblast growth factor signaling, and decreases survival in hepatocellular carcinoma. Hepatology. 2008 Apr;47(4):1211–1222. [PMC free article] [PubMed]
68. Lai J, Chien J, Staub J, Avula R, Greene EL, Matthews TA, et al. Loss of HSulf-1 up-regulates heparin-binding growth factor signaling in cancer. J Biol Chem. 2003 Jun 20;278(25):23107–23117. [PubMed]
69. Mahajan NP, Whang YE, Mohler JL, Earp HS. Activated tyrosine kinase Ack1 promotes prostate tumorigenesis: role of Ack1 in polyubiquitination of tumor suppressor Wwox. Cancer Res. 2005 Nov 15;65(22):10514–10523. [PubMed]
70. Frixen UH, Behrens J, Sachs M, Eberle G, Voss B, Warda A, et al. E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carcinoma cells. J Cell Biol. 1991 Apr;113(1):173–185. [PMC free article] [PubMed]
71. Shimoyama Y, Hirohashi S. Cadherin intercellular adhesion molecule in hepatocellular carcinomas: loss of E-cadherin expression in an undifferentiated carcinoma. Cancer Lett. 1991 May 1;57(2):131–135. [PubMed]
72. Nishida N, Fukuda Y, Kokuryu H, Sadamoto T, Isowa G, Honda K, et al. Accumulation of allelic loss on arms of chromosomes 13q, 16q and 17p in the advanced stages of human hepatocellular carcinoma. Int J Cancer. 1992 Jul 30;51(6):862–868. [PubMed]
73. Nishida N, Fukuda Y, Komeda T, Ito T, Nishimura T, Minata M, et al. Prognostic impact of multiple allelic losses on metastatic recurrence in hepatocellular carcinoma after curative resection. Oncology. 2002;62(2):141–148. [PubMed]
74. Fiorentino M, Altimari A, Ravaioli M, Gruppioni E, Gabusi E, Corti B, et al. Predictive value of biological markers for hepatocellular carcinoma patients treated with orthotopic liver transplantation. Clin Cancer Res. 2004 Mar 1;10(5):1789–1795. [PubMed]
75. Schwabe RF, Bradham CA, Uehara T, Hatano E, Bennett BL, Schoonhoven R, et al. c-Jun-N-terminal kinase drives cyclin D1 expression and proliferation during liver regeneration. Hepatology. 2003 Apr;37(4):824–832. [PubMed]
76. Czaja MJ. The future of GI and liver research: editorial perspectives. III. JNK/AP-1 regulation of hepatocyte death. Am J Physiol Gastrointest Liver Physiol. 2003 Jun;284(6):G875–G879. [PubMed]
77. Bae MA, Song BJ. Critical role of c-Jun N-terminal protein kinase activation in troglitazone-induced apoptosis of human HepG2 hepatoma cells. Mol Pharmacol. 2003 Feb;63(2):401–408. [PubMed]
78. Gunawan BK, Liu ZX, Han D, Hanawa N, Gaarde WA, Kaplowitz N. c-Jun N-terminal kinase plays a major role in murine acetaminophen hepatotoxicity. Gastroenterology. 2006 Jul;131(1):165–178. [PubMed]
79. Henderson NC, Pollock KJ, Frew J, Mackinnon AC, Flavell RA, Davis RJ, et al. Critical role of c-jun (NH2) terminal kinase in paracetamol- induced acute liver failure. Gut. 2007 Jul;56(7):982–990. [PMC free article] [PubMed]

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...