• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Mol Pharmacol. Author manuscript; available in PMC Oct 1, 2009.
Published in final edited form as:
PMCID: PMC2574737
NIHMSID: NIHMS58606

Disregulation of Purine Nucleotide Biosynthesis Pathways Modulates Cisplatin Cytotoxicity in Saccharomyces cerevisiae

Abstract

We previously found that inactivation of the FCY2 gene, encoding a purine-cytosine permease, or the HPT1 gene, encoding the hypoxanthine guanine phosphoribosyl transferase, enhances cisplatin resistance in yeast cells. Here, we report that in addition to fcy2Δ and hpt1Δ mutants in the salvage pathway of purine nucleotide biosynthesis, mutants in the de novo pathway that disable the feedback inhibition of AMP and GMP biosynthesis also enhanced cisplatin resistance. An activity-enhancing mutant of the ADE4 gene, which constitutively synthesizes AMP and excretes hypoxanthine, and a GMP kinase mutant (guk1), which accumulates GMP and feedback inhibits Hpt1 function, both enhanced resistance to cisplatin. Additionally, over-expression of the ADE4 gene in wild-type cells, which increases de novo synthesis of purine nucleotides, also resulted in elevated cisplatin resistance. Cisplatin cytotoxicity in wild-type cells was abolished by low concentration of extracellular purines (adenine, hypoxanthine, and guanine), but not cytosine. Inhibition of cytotoxicity by exogenous adenine was accompanied by a reduction of DNA–bound cisplatin in wild-type cells. As a membrane permease, Fcy2 may mediate limited cisplatin transport since cisplatin accumulation in whole cells was slightly affected in the fcy2Δ mutant. However, the fcy2Δ mutant had a greater effect on the amount of DNA-bound cisplatin which decreased to 50-60% of that in the wild-type cells. Taken together, our results indicate that disregulation of the purine nucleotide biosynthesis pathways as well as addition of exogenous purines can modulate cisplatin cytotoxicity in S. cerevisiae.

Introduction

Cisplatin (cis-diammine-dichloro-platinum II, cDDP) is one of the most frequently used chemotherapeutic agents for treating a wide spectrum of solid tumors. However, intrinsic and acquired resistance are major obstacles for the clinical use of these drugs. The development of resistance to cDDP in cancer treatment is believed to be caused by multiple mechanisms, including decreased intracellular drug accumulation, inactivation by glutathione or metallothioneins, increased DNA repair, enhanced tolerance, increased replicative bypass, and defects in pathways modulating cell death (Niedner et al., 2001; Perez, 1998). However, these mechanisms cannot fully account for resistance to cDDP-based treatment in clinical settings. In an effort to identify additional mechanisms of cDDP resistance and associated genes, we screened the yeast gene deletion collection and found several mutants that were more drug resistant than wild-type cells (Huang et al., 2005). A deletion mutant of the FCY2 gene, a purine-cytosine permease which also transports protons through the plasma membrane was found most frequently and exhibited the strongest cDDP-resistant phenotype. A deletion mutant of a related gene, HPT1, encoding the hypoxanthine guanine phosphoribosyl transferase, was also identified (Huang et al., 2005). The fcy2Δ and hpt1Δ mutants also exhibit cross-resistance to 5-fluorouracil (5-FU) and doxorubicin. Since both Fcy2 and Hpt1 function in the nucleotide metabolism pathways, we sought to examine the possible involvement of these pathways in mediating cDDP-resistance.

AMP and GMP biosynthesis involves two interacting pathways, the de novo pathway and the salvage pathway. The de novo pathway synthesizes purine nucleotides from amino acids, carbon dioxide and ammonia, whereas the salvage pathway utilizes preformed nucleobases or nucleosides that are imported or present inside the cell. In S. cerevisiae, all the genes encoding enzymes required for de novo AMP synthesis (except ADE16) are repressed at the transcriptional level by the presence of extracellular adenine (Denis et al., 1998; Guetsova et al., 1997; Rebora et al., 2001). Both Fcy2 and Hpt1 function in the salvage pathway, and inactivation of either gene causes derepression of the de novo pathway even in the presence of extracellular adenine (Guetsova et al., 1997). As a result, de novo synthesis of the purine nucleotides is constitutively active in fcy2Δ or hpt1Δ mutant. It has been demonstrated that excess intracellular purines are present in the hpt1Δ mutant and that purines, in particular hypoxanthine, are excreted from the cells (Lecoq et al., 2000). It is possible that enhanced cDDP resistance in the fcy2Δ and hpt1Δ mutants is due to constitutive activation of the de novo purine nucleotide synthesis or to a higher level of intracellular purines which may prevent cDDP from binding DNA, since cDDP binds strongly to guanine and adenine, and their nucleotides (Franska et al., 2005; Reedijk and Lohman, 1985). Surprisingly, while fcy2Δ cells excrete much smaller amounts of purines (Daignan-Fornier unpublished observations), they exhibit higher resistance to cDDP than hpt1Δ cells (Huang et al., 2005), suggesting that factors other than, or in addition to, purine excretion may be important. It has been shown that mutation in the FCY2 gene results in resistance to purine and cytosine analogues and this was attributed to a defect in analogue influx (Guetsova et al., 1997). Thus, it is possible that Fcy2 may also transport cDDP. Another possibility is that mutation of FCY2 somehow facilitates DNA repair.

In this study we found that the cDDP-resistant phenotype of the fcy2Δ mutant is not primarily due to reduced cDDP import or enhanced Rad52-mediated DNA repair activity. Instead, analysis of additional yeast mutants suggests that disregulation of the de novo pathway leading to purine nucleotide synthesis protects the fcy2Δ mutant from cDDP cytotoxicity, likely by limiting the amount of cDDP reaching the DNA in a reactive form. Our results thus suggest that disregulation of specific genes involved in purine nucleotide synthesis and elevated intra- or extra-cellular purine levels contribute to cDDP resistance.

Material and Methods

Yeast Strains and Media

Yeast strains are listed in Table 1. Haploid deletion strains were obtained from Invitrogen (Carlsbad, California) or EUROSCARF (Frankfurt, Germany). Wild-type PLY122 strain and the AMP synthesis mutants were as described previously (Guetsova et al., 1997; Lecoq et al., 2000; Rebora et al., 2001). Standard yeast media and growth conditions (Sherman, 1991) were used with minor modification. Briefly, yeast cells were streaked in plates containing yeast extract peptone dextrose (YPD) media or synthetic defined yeast nitrogen base media (SDM) supplemented with dextrose and appropriate amino acids for the auxotrophic markers of the strains. Single colonies were inoculated overnight in SDM supplemented with amino acid. All media containing cDDP, purines and the control solvents were SDM and the tested agents were added immediately before pouring plates or treatment. We found no difference in the cisplatin resistance phenotype between cells pre-grown in YPD and SDM during the inoculation of single colony. For studies regarding pre-incubation of cisplatin with adenine, plates were prepared as described in the figure legend.

Table 1
Yeast strains used in this study.

Chemicals

Yeast nitrogen base, yeast extract, peptone and dextrose were purchased from DIFCO Laboratories (Detroit, MI). cDDP, adenine, cytosine, guanine and hypoxanthine were obtained from Sigma-Aldrich (St. Louis, MO). Stock solutions were prepared as follows. cDDP was prepared in DMSO (330 mM), stored as aliquots at −20°C, and used within 2 weeks. This was further diluted in 0.9% NaCl (3.3 mM) before adding to the medium. Adenine and hypoxanthine (200 mM in 0.5 N HCL) as well as cytosine and guanine (200 mM in 0.1 N NaOH) were made freshly. All plates were made in SDM, stored in the dark, and used within 2-24 hours.

Plasmids, over-expression and gene replacements

Plasmids containing the wild-type (WT) FCY2 gene and control constructs were generated as follows. The sequence containing the open reading frame and 100-bp 3’-flanking region of the FCY2 gene was PCR amplified and cloned into the BamHI and XbaI sites of the pYES2 vector to create pFCY2-BX plasmid using the following primers: 5’-FCY2-BamHI (5’-ATCCGGATCCTGGAAGAGGGAAATAATGTTT-3’) and 3’-FCY2-XbaI (5’-ATCCCTCTAGAAGCCGTGCAAATTGTCTT-3’). For monitoring the expression of the Fcy2 protein, the green fluorescence protein (GFP) gene containing a truncated cup1 promoter at the C-terminal was PCR amplified from the pRS-cp-GFP-HA-YAP1 plasmid (Furuchi et al., 2001) using primers, 5’-SacI-GFP (5’-AAGCTGGAGCTCTCTTTTGCTGGCA) and 3’GFP-BamHI (TTAACCCTGGATCCAGGGAACAAA AG-3’) and cloned into the pYES2 vector or fused to the start codon of the FCY2 gene in the pFCY2-BX plasmid to create a control (pYES2G) or WT-FCY2 (pFCY2G) plasmid, respectively. In addition, the GFP-containing fragment was amplified using a mutant primer with one base deletion in the 3’GFP-BamHI primer and create a frame-shift-containing construct (pfcy2m). The GFP-fusion constructs were overexpressed in the wild-type (BY4741) and fcy2Δ strains under the induction of galactose and monitored using a fluorescence microscope. Plasmids used for over-expression of ADE genes were derivatives of YEp13 (Broach et al., 1979). YEp13:(ADE1) 1 (Crowley and Kaback, 1984) and pPM13 (Mantsala and Zalkin, 1984) are LEU2 2 μm plasmids carrying ADE1 and ADE4 respectively. These plasmids were transformed into the BY4741 strain and selected on SDM plates without leucine. To create the rad52Δ fcy2Δ strain, a DNA fragment containing the LEU2 marker flanked by upstream and downstream sequences of the RAD52 ORF was PCR amplified using a plasmid containing the LEU2 gene as a template. This fragment was transformed into the fcy2Δ strain and the correct gene replacement was verified by PCR of the genomic DNA isolated from the LEU2+ colonies.

Spot assay for cDDP cytotoxicity

Single yeast colonies were picked and grown overnight in liquid SDM at 30°C. Cultures were then diluted to a concentration of 5 × 106 cells/ml, and additional 5-fold serial dilutions were made. One microliter of each dilution was spotted onto SDM plates with or without cisplatin or tested compounds and grown for 2-3 days at 30°C. The spot intensity at the second dilution for each strain was determined using densitometric analysis (Alpha Imager, Alpha Innotech) and was divided by the spot intensity of the corresponding untreated cells to determine the percent survival.

Platinum accumulation

For whole cell platinum accumulation, wild-type and Δfcy2 cells grown to log phase in SDM were treated with 100 μM cDDP for varying lengths of time and then washed 3 times with cold PBS. Whole cell extracts were prepared by the addition of 0.1% Triton X-100 and 0.01% SDS and vortexed with glass beads. Protein concentration was determined using Bradford assay and used for normalization. Platinum contents were measured by Atomic Absorption Spectrometry as described (Hector et al., 2001). For accumulation of DNA-bound platinum, cells were treated and washed as described above. DNA was isolated using yeast-breaking buffer [2%, (v/v) Triton X-100, 1% (w/v) SDS, 100 mM NaCl, 10 mM Tris-Cl, pH 8.0, 1 mM EDTA, pH 8.0] and phenol extraction. After removal of RNA by RNaseA, DNA was hydrolyzed with 5% HCl and platinum content was measured as described (Hector et al., 2001). The units of measurements were pg-cDDP/ug-protein for accumulation into cells and pg-cDDP/μg-DNA for accumulation of DNA-bound platinum.

Statistical analysis

The data are presented as means ± SD (standard deviation). For a comparison of two means, Student’s paired or unpaired t test (GraphPad Prism V4.03 software) was used. A probability value (p) of less than 0.05 was considered statistically significant.

Results

cDDP resistance of fcy2Δ is not primarily due to an enhanced Rad52-mediated DNA repair activity

We have previously shown that deletion of the yeast FCY2 or HPT1 gene confers resistance to cDDP (Huang et al., 2005). To test whether the cDDP-resistant phenotype is due to the deletion of the FCY2 gene, plasmid expressing the empty vector, wild-type Fcy2 or an inactive frameshift mutant, fcy2mg, was introduced into the fcy2Δ mutant. Figure 1A shows that the cDDP-resistant phenotype of the fcy2Δ mutant lacking the Fcy2 protein (Fcy2) can be greatly reduced by the expression of the wild-type protein, but not by expression of the inactive, mutated form, fcy2mg (see graph in Figure 1A). The data obtained in a spot assay quantified using densitometry were confirmed with a quantitative clonogenic survival assay (Supplemental Figure 1). Thus, the cDDP-resistant phenotype of the fcy2Δ strain is due to the absence of the Fcy2 protein. In addition, over-expression of the wild-type protein, but not the mutated form, is able to sensitize the wild-type cells to cDDP treatment. Thus, altering the level of Fcy2 protein can modulate cisplatin cytotoxicity.

Figure 1
(A) Over-expression of Fcy2 protein sensitizes wild-type and fcy2Δ cells to cDDP. Wild-type pFCY2G and its mutant form (pfcy2mg) fused to a green fluorescence protein carried on the pYES2 vector and the vector control (pYES2G) were expressed in ...

Since one of the mechanisms by which cells may become resistant to cDDP is enhanced DNA repair activity (Perez, 1998), and RAD52p has been shown to be required for recombination repair of cisplatin-DNA lesions (Durant et al., 1999), we sought to determine whether the reduced cDDP sensitivity of the fcy2Δ mutant was due to enhanced recombination-mediated repair. We examined cDDP sensitivity in a fcy2Δ derivative incapable of recombinational repair because of deletion of RAD52 (Shinohara and Ogawa, 1998). As expected, a yeast mutant lacking RAD52 was hypersensitive to cDDP (Figure 1B), suggesting that Rad52p does mediate repair of cDDP-induced DNA lesions. Figure 1B also shows that deletion of the RAD52 gene partially enhanced cDDP cytotoxicity in fcy2Δ cells; however, the fcy2Δrad52Δ strain was still more resistant than the wild-type strain. Densitometric analysis indicates that rad52Δ increased the sensitivity of WT and fcy2Δ cells by 3 and 2 fold, respectively (graph in Figure 1B). These results thus suggest that cDDP resistance of fcy2Δ mutants is not primary due to an enhanced Rad52-mediated recombination repair activity and other factors play a major role in Fcy2-mediated cisplatin cytotoxicity.

Mutations of genes in the de novo purine nucleotide biosynthesis pathway modulate cDDP cytotoxicity

Fcy2 and Hpt1 function in the salvage pathway which overlaps and interacts with the de novo pathway for AMP and GMP biosynthesis (Figure 2). In the presence of extracellular purines, the de novo pathway is repressed by the purine nucleotide end products of the salvage pathway. One of the phenotypes of strains with a mutation in either FCY2 or HPT1 genes is derepressed de novo synthesis of purine nucleotides (Guetsova et al., 1997). In addition, previous studies have shown that intracellular purines are present in strains with a mutation in FCY2 (Daignan-Fornier unpublished observations) or HPT1 gene (Denis et al., 1998) and that cDDP reacts with all nucleobases and nucleotides to varying degrees (Reedijk and Lohman, 1985). It is possible that cDDP cytotoxicity may be compromised by disregulated de novo nucleotide synthesis. To test this possibility, we examined previously identified mutants in the purine nucleotide biosynthesis pathway (Figure 2) that also derepresses ADE gene expression (Denis et al., 1998) to see whether they exhibit resistance to cDDP. One of these is ADE4D, which is an activity-enhancing mutation of the ADE4 gene encoding the glutamine PRPP amidotransferase (GPAT) and functions in the first step of the de novo pathway. The other mutant is guk1 which carries mutation in the GUK1 gene encoding GMP kinase and results in accumulation of GMP and feedback inhibition of the Hpt1 enzyme encoded by the HPT1 gene (Escobar-Henriques and Daignan-Fornier, 2001; Lecoq et al., 2000). Figure 3A shows that the ADE4D mutant exhibited resistance to cDDP to a degree similar to that of the hpt1Δ mutant. The guk1 mutant also exhibited a weak but significant resistant phenotype. Thus, activation of the de novo pathway through either the ADE4D mutant or the guk1 mutant leads to cDDP resistance. We also tested a mutant allele of the ADE13 gene encoding adenylosuccinate lyase (Figure 2). The ade13 mutant derepresses ADE gene expression but the de novo pathway is blocked at two steps (Figure 2) by the mutation, and purine nucleotides are not produced (Rebora et al., 2001). In contrast to the ADE4D and guk1 mutants that actively synthesize purine nucleotide via the de novo pathway, the ade13 mutant was not resistant to cDDP. Taken together, these data suggest that derepression of ADE gene expression alone is not sufficient to cause cDDP resistance, and that elevated production of purine nucleotides by the de novo pathway is also important.

Figure 2
Schematic representation of purine metabolism in S. cerevisiae. Abbreviations: PRPP, 5-phosphoribosyl-1-pyrophosphate; SAICAR, phosphoribosyl-aminoimidazole-succinocarboxamide; IMP, inosine 5’-monophosphate; SAMP, adenylosuccinate; XMP, xanthosine ...
Figure 3
(A) Certain mutants that activate ADE gene expression are resistant to cDDP. These mutants were generated through mutagenesis and selected via bypass of repression of ADE gene expression by adenine (Guetsova et al., 1997; Lecoq et al., 2000). PLY121 is ...

To further elucidate the role of the AMP biosynthesis pathway in modulating cDDP cytotoxicity, we tested additional mutants with defects in the de novo pathway for their sensitivity to cDDP. It has been shown that expression of the ADE genes is low in strains containing mutations that disable the first seven steps of the pathway (ade4 to ade1), while it is constitutively derepressed in strains with mutations that disable later steps [Figure 2, (Rebora et al., 2001)]. We reasoned that if cDDP cytotoxicity is reduced in strains with elevated ADE gene expression, such as the ADE4D mutant, mutants that disable later steps would exhibit resistance to cDDP while mutants that disable the first seven steps of the pathway would be expected to be sensitive. We tested several strains in this pathway. Deletion of the ADE4 gene causes adenine auxotrophy which makes it impossible to assess its sensitivity to cDDP under our conditions (Figure 3B). However, viable strains containing a single deletion of either ADE16 or ADE17, which encode isozymes that function in the last two steps of de novo IMP biosynthesis, were more resistant to cDDP than WT cells. Furthermore, it has been previously demonstrated that high expression of yeast AMP biosynthesis genes requires interaction between two transcription factors Bas1 and Bas2 (Rebora et al., 2001). Indeed, we found that mutants lacking either the Bas1 or Bas2 proteins were not significantly more resistant to cDDP than WT cells (Figure 3B).

To address the contribution of the ADE4 gene in cDDP cytotoxicity further, we examined in WT cells the effect of overexpressing the ADE4 gene, which also leads to derepression of the ADE-genes, increased de novo purine nucleotide production, and purine excretion (Rebora et al., 2001). As shown in Figure 3C, overexpressing the WT ADE4 gene also resulted in resistance to cDDP, at a level similar to that of the ADE4D dominant mutant. In contrast, over-expression of the ADE1 gene, which does not cause derepression of the ADE genes and increased purine nucleotide production (Rebora et al., 2001), did not exhibit cDDP-resistance. Thus these data indicate that mutations that result in increased de novo purine nucleotide synthesis also confer cDDP resistance. Together, these results further support our hypothesis that disregulation of the purine nucleotide biosynthesis pathway can modulate cDDP cytotoxicity in yeast.

Effects of alterations in the purine salvage pathway on cDDP cytotoxicity

It has been reported that the presence of extracellular purines has a cytoprotective for rat testes cells following cDDP-induced injury (Bhat et al., 2002) and platinum compounds bind to purine nucleobases (Franska et al., 2005; Kerr et al., 2008; Sigel et al., 2001). We tested the effect of exogenous purines on the cDDP-induced cytotoxicity in wild-type yeast cells. The wild-type, fcy2Δ, and hpt1Δ strains were grown to log phase and spotted on plates containing 120 μM cDDP supplemented with or without adenine, hypoxanthine, or guanine. Figure 4A shows that the cytotoxicity of cDDP to wild-type cells was remarkably diminished in the presence of adenine (12.5 μM) or hypoxanthine (12.5 μM) relative to fcy2Δ cells. cDDP is known to interact preferentially to guanine residues (Baik et al., 2003; Franska et al., 2005) and guanine is able to cause moderate transcriptional repression of adenine biosynthetic genes (Guetsova et al., 1997). cDDP cytotoxicity to WT cells was also found to be reduced by guanine (12.5 μM). In contrast, addition of cytosine, which is taken up by Fcy2 but is not involved in purine metabolism, had little or no effect on cDDP cytotoxicity in WT cells. These data confirm that addition of extracellular purines is able to protect yeast cells from cDDP-induced cell death. This effect is probably not due to feedback inhibition of de novo purine nucleotide synthesis since this would be expected to enhance sensitivity to cisplatin (Figure 3B). Instead, it is possible that exogenously supplied purines are sufficient to effectively neutralize cDDP either extra- or intracellularly before it binds to DNA. The ability of platinum to bind free nucleobases and the formation of resulting complexes has been previously analyzed (Kerr et al., 2008). Furthermore, when pre-complexed with nucleobases the cytotoxicity of platinum-adducts is reduced (Ali et al., 2005). To further confirm the deactivating effect of adenine on cDDP, increasing concentrations of cDDP were pre-incubated with adenine for 24 h before adding to the medium for making the plates. Similar to that shown in Figure 4A, the cytotoxicity of cDDP to wild-type cells was completely abrogated in the presence of both concentrations of adenine (12.5 and 50 μM) (Figure 4B). Together, these results indicate that cisplatin cytotoxicity is greatly compromised by exogenously supplied purines.

Figure 4
(A) Effects of purines and cytosine on cDDP cytotoxicity. The wild-type (WT) strain BY4741, fcy2Δ, and hpt1Δ strains were spotted on plates with or without 120 μM cDDP and in the presence or absence of different purines (Ade, adenine; ...

Within the cells, hypoxanthine is metabolized through Hpt1 to IMP then to AMP or GMP, and guanine is converted also through Hpt1 to GMP (see Figure 2). In contrast, adenine is metabolized directly into AMP by Apt1 (encoded by the APT1 gene), or deaminated to hypoxanthine by Aah1 (encoded by the AAH1 gene, Figure 2) and then transformed to IMP through Hpt1. We have demonstrated that mutation in Hpt1 reduced cDDP cytotoxicity. We next tested whether alterations at the steps in the conversion of salvaged adenine to nucleosides also protect yeast cells from cDDP toxicity. We compared cDDP sensitivity in three mutants: apt1, aah1 and a double aah1/apt1 mutant, which can take up adenine but cannot metabolize it. Figure 4C shows that neither single mutants nor the double mutant enhanced resistance to cDDP as compared with the fcy2Δ strain. These data were somewhat unexpected since it has been demonstrated while repression of de novo AMP synthesis by exogenous adenine is intact in the aah1 and apt1 mutants, the regulation is abolished in aah1/apt1 mutant strain (Guetsova et al., 1997). These data suggest that the major modulators for cDDP cytotoxicity in the yeast purine salvage pathway involve the Fcy2-Hpt1 route and provide possible explanation that fcy2Δ and hpt1Δ were found most frequently in our original cisplatin resistance screen (Huang et al., 2005).

Accumulation of DNA-bound cDDP but not whole-cell cDDP is significantly compromised in fcy2Δ mutants

Resistance to cDDP in mammalian cells is often accompanied by impaired drug accumulation. Since Fcy2 is a membrane protein functioning as a nucleobase permease and proton transporter and the fcy2Δ mutant exhibited higher resistance than that of the hpt1Δ cells, we suspected that fcy2Δ mutants may have defects in cDDP uptake. To test this possibility the levels of cDDP accumulation in wild-type and fcy2Δ cells treated with 100 μM cDDP for 4 h were compared. Figure 5A shows that the level of whole cell accumulation of cDDP in the fcy2Δ mutants was mildly reduced as compared with that in wild-type cells. Because of the high standard deviation, the data suggest that Fcy2 does not function as a major cDDP transporter. In addition, although both wild-type and fcy2Δ strains were sensitized to cDDP cytotoxicity by the forced expression of Fcy2 (Figure 1), cDDP accumulation was not significantly altered in the Fcy2-overexpressing cells (data not shown).

Figure 5
(A) Whole cell cDDP accumulation in wild-type and fcy2Δ strains. Wild-type (WT, BY4741) and fcy2Δ cells were treated with 100μM cDDP for 4 h. The amount of platinum in whole cell extracts was measured using atomic absorption spectrophotometry. ...

Because the formation of cDDP-DNA adducts is the major mechanism by which cDDP causes cytotoxicity (Zamble and Lippard, 1995), we then tested the possibility that cDDP-DNA adduct formation was reduced in the cDDP-resistant fcy2Δ mutant. As shown in Figure 5B, the amount of cDDP bound to DNA during a 4-h (white bars) or 8-h (grey bars) incubation with 100 μM cDDP in the mutant cells was in fact reduced. The level was only 54 ± 8 (SD) % of that in wild-type cells at 4 h and 27 ± 11 (SD) % at 8 h. Thus, reduced cDDP-DNA adduct formation in the fcy2Δ mutant provides one of the likely explanations for the enhanced resistance to cDDP.

Since exogenous purines had striking effects on cDDP sensitivity in wild-type cells, we tested whether extracellular purines might somehow prevent cDDP and DNA binding. We measured the amount of cDDP-DNA adduct formation in both wild-type and fcy2Δ cells in the presence or absence of 150 μM adenine. As shown in Figure 5C, adenine reduced the accumulation of DNA-bound cDDP in the wild-type cells to 59% of that in the absence of adenine while that bound in fcy2Δ cells remained at the same low level seen in the absence of adenine.

Discussion

Previously we identified the purine-cytosine permease gene, FCY2, and the hypoxanthine guanine phosphoribosyl transferase gene, HPT1, in a screen for yeast gene deletion strains that are more resistant than wild-type cells to cDDP (Huang et al., 2005). Inactivation of either of these salvage pathway genes derepresses expression of ADE genes, resulting in increased purine nucleotide synthesis via the de novo pathway (Denis et al., 1998; Guetsova et al., 1997; Rebora et al., 2001). Here we show that gene mutations in the de novo pathway that derepress ADE gene expression can also enhance cDDP-resistance, but only in mutants that increase production of purine nucleotides. Our results show that the cDDP-resistant phenotype caused by mutations in specific ADE genes (ADE4, ADE16, ADE17) is shared with mutations in particular salvage pathway genes (FCY2, HPT1). Also, overexpression of ADE4 causes resistance to cDDP, while overexpression of FCY2 has the opposite effect, causing sensitivity to the drug. Our data demonstrate that disregulation of specific genes in the purine nucleotide synthesis pathways by mutation or overexpression can modulate cDDP cytotoxicity in yeast.

How might activation of de novo purine nucleotide synthesis by gene disregulation enhance cDDP resistance of the cell? The fcy2Δ mutant is known to activate de novo purine nucleotide synthesis (Guetsova et al., 1997). We found that the level of cDDP-DNA adducts is substantially reduced in the fcy2Δ mutant (Figure 5). This suggests that reduced DNA-adduct formation contributes to cellular resistance because cDDP-DNA adducts are believed to be the main cause of cDDP cytotoxicity. cDDP can bind to purines and purine nucleotides (Chaney et al., 2005; Reedijk and Lohman, 1985). Thus, one possible mechanism is that intra-cellular purine nucleotides produced by the activated de novo pathway somehow interfere with cDDP binding to DNA. Whether this is a direct effect or whether it serves to activate additional cellular processes that interfere with cDDP binding to DNA is not clear (see below).

In addition to genetic alteration, we showed that cDDP cytotoxicity can be modulated by addition of exogenous purines. Wild-type cells became more resistant to cDDP in the presence of extracellular purines (Figure 4A and 4B). The effect is specific for purines since cytosine, which can also be transported into the cell by Fcy2 and can bind cDDP, had little or no effect. cDDP adduct formation with DNA was reduced significantly in wild-type cells treated with adenine, while the low level of adducts detected in the resistant fcy2Δ mutant in the absence of adenine was not further affected by its presence. The salvage pathway is activated in the wild-type cells by extracellular adenine but is inactive in the fcy2Δ mutant (Guetsova et al., 1997). Our findings suggest that activation of the salvage pathway in wild-type cells by extracellular adenine and the resulting formation of intracellular purine nucleotides can lead to cDDP resistance. cDDP activity might be deactivated intracellularly or extracellularly because the neutralizing effects of purines were seen in both experiments with (Figure 4B) and without (Figure 4B) pre-incubation of cDDP with adenine for 24 h before pouring the plates. In addition, the fact that the cDDP concentration (120 μM) used was in vast excess over that of the adenine (12.5 μM) suggest that the detoxification exerted by exogenous purines can not be completely attributed to interactions between cDDP and extracelllar purines alone. It is possible that purine-cDDP adducts activate additional processes in the cells that somehow limits the reaction of cDDP with DNA. It has been documented that binding of platinum to intra or extracellular molecules can affect platinum-DNA adduct formation. For example, glutathione binds platinum compounds (Jansen et al., 2002) and intracellular inactivation of cDDP by glutathione is one of the well-known mechanisms of platinum resistance (Ishikawa and Ali-Osman, 1993). In contrast, it has been recently demonstrated that extracellular carbonate interacts with carboplatin and enhances its activity (Di Pasqua et al., 2007). Our findings that exogeneous purines and intracellular production of puine nucleotides are capable of reducing cDDP cytotoxicity in yeast provide a novel direction for future mechanistic study of cisplatin resistance in human cells.

Purines regulate the concentration of PRPP (5-phosphoribosyl 1-pyrophosphate) (Yoshida and Hoshi, 1984) which is a substrate common to both de novo and salvage pathways. PRPP is vital for cell function and cell proliferation through effects on DNA and RNA syntheses and ATP. Anticancer drugs reduce ATP concentration (Martin et al., 2001), resulting in cell stress. Exogenous purines or constitutive adenine nucleotide synthesis enables the cells to quickly replenish the level of intracellular ATP which, in turn, protects cells from drug-induced stress. It is remarkable that fcy2Δ cells exhibit reduced DNA platination in the absence of marked change of whole cell uptake. In mammalian cells the major copper influx transporter appears to mediate cisplatin transport via an endocytic process resulting in the accumulation of cDDP in vesicles (Holzer and Howell, 2006). It is possible that purine/nucleotide level might modulate the extent of DNA platination without affecting whole cell accumulation by influencing intracellular transporters that move cDDP out of intracellular vesicles. In addition, the level of purines may affect dNTP pools which are critical for cisplatin-induced DNA repair activity involving DNA polymerases (Chaney et al., 2005). It has been previously shown that depletion of purines in the medium greatly decrease the dATP pool and DNA synthesis in the V79 pur1, a purine auxotrophic mutant of the Chinese hamster lung cell line (Zannis-Hadjopoulos et al., 1980). Others also showed that genes in the nucleotide metabolism, including purB, C/E, D, and H, are greatly induced by cisplatin in Dictyostelium (Van Driessche et al., 2007). Further, treatment with hydroxyurea, an inhibitor of dNTP synthesis and DNA repair (Collins and Oates, 1987), enhances cisplatin cytotoxicity (Albain et al., 1992). Interestingly, deletion of the P2Y purine receptor gene in Dictyostelium also results in resistance to cisplatin (Li et al., 2000). Taken together, these studies support our hypothesis that the level of purines or purine nucleotides is one of the important modulators of cisplatin cytotoxicity.

Our data showing that deletion of Fcy2 confers a weak protection against cDDP sensitivity of rad52Δ cells suggest that Fcy2 plays a minor role in Rad52-mediated DNA repair of cDDP-induced DNA damage. How mutations in the purine nucleotide synthesis pathway or purine levels affect other DNA repair pathways requires further study. Whether purine levels affect checkpoint responses is also unclear. We have previously shown that fcy2Δ mutant is mildly cross-resistant to 5-Fu and doxorubicin (1.5-2.5 fold). However, fcy2Δ cells are not sensitive or resistant to camptothecin or MNNG (Huang et al., 2005). In addition, the rates of cell cycle progression in WT and fcy2Δ cells in response to cisplatin treatment are similar (data not shown). The implication of these data is that checkpoint response to DNA damage is unlikely to be involved in the cDDP-resistant phenotype of fcy2Δ cells.

It has recently been reported that the SAGA/SNF chromatin remodeling complexes are required for the activation of the ADE genes (Koehler et al., 2007). Given that, one would expect that defects in the SAGA/SNF chromatin remodeling complexes would result in increased cDDP sensitivity. However, our published data indicate that deletion of the SNF6 gene also confers cDDP resistance (Huang et al., 2005). We also recently observed that defects in some other, but not all, genes coding for proteins in the SAGA/SNF complexes also confer resistance to cDDP (unpublished observations). Since the SAGA/SNF chromatin remodeling complexes are involved in many transcriptional processes, further studies will be required to delineate the exact roles played by this complex in cDDP cytotoxicity.

Purine nucleotide biosynthesis pathways are critically important for the normal functioning of cells and are conserved between yeast and humans. Whether there is an association between the level of purine nucleotide biosynthesis and resistance to cisplatin chemotherapy in human cancers is unknown. However, it is known that purine overproduction and defects of purine nucleotide biosynthesis enzymes lead to abnormal physical conditions. For example, purine overproduction and uric acid excretion occurs in about 20% of autistic patients (Page and Coleman, 2000) and could indeed be a consequence of purine nucleotide biosynthesis deregulation. Furthermore, human Lesch-Nyhan syndrome results from inactivation of HPRT, the human functional homologue of the yeast HPT1. Patients with a partial defect in HPRT develop hyperuricemia as a result of failure to salvage purine bases. The lack of salvage of hypoxanthine and guanine by HPRT results in increased levels of PRPP which then increases synthesis of purine nucleotides (Rosenbloom, 1968). Much has yet to be learned about whether purine metabolism can modulate cDDP cytotoxicity in cancer patients. Whether the activity of the human homologue of the yeast ADE4 gene, GPAT (glutamine PRPP amidotransferase), is higher in human cancer cells resistant to cDDP is also unknown. Ironically, the frequency of mutations in the HPRT gene has been often employed to measure the effects of chemotherapeutic agents used in the treatment of human malignancies including ovarian cancer (Gercel-Taylor et al., 2005). The cause-and-effect relationship of mutations in the HPRT gene and chemotherapeutic responses to cDDP merits further investigation.

Supplementary Material

Sup_Figure 1

Sup_figure Leg

Acknowledgments

We thank Wen-Qing Guo, Suzanne Hector, and Joshua Prey for technical assistance, and Dr. Akira Naganuma (Tohoku University, Japan) for the pRS-cp-GFP-containing plasmid.

This work was supported by National Institutes of Health Grants CA 107303-02 (to R. H.), and GM30614-19 (to D. K.).

Abbreviations

cDDP
cis-diammine-dichloro-platinum II (cisplatin)
ADE
adenine
PCR
polymerase chain reaction
YFG1
your favorite gene 1
yfg1Δ
gene deletion lacking Yfg1
Yfg1
protein encoded by YFG1
dNTP
deoxbonucleotide triphosphate
FBS
fetal bovine serum

References

  • Albain KS, Swinnen LJ, Erickson LC, Stiff PJ, Fisher SG, Fisher RI. Cytotoxic synergy of cisplatin with concurrent hydroxyurea and cytarabine: summary of an in vitro model and initial clinical pilot experience. Semin Oncol. 1992;19:102–109. [PubMed]
  • Ali MS, Khan SR, Ojima H, Guzman IY, Whitmire KH, Siddik ZH, Khokhar AR. Model platinum nucleobase and nucleoside complexes and antitumor activity: X-ray crystal structure of [PtIV(trans-1R,2R-diaminocyclohexane)trans-(acetate)2(9-ethylguanine)Cl]NO 3.H2O. J Inorg Biochem. 2005;99:795–804. [PubMed]
  • Baik MH, Friesner RA, Lippard SJ. Theoretical study of cisplatin binding to purine bases: why does cisplatin prefer guanine over adenine? J Am Chem Soc. 2003;125:14082–14092. [PubMed]
  • Bhat SG, Mishra S, Mei Y, Nie Z, Whitworth CA, Rybak LP, Ramkumar V. Cisplatin up-regulates the adenosine A(1) receptor in the rat kidney. Eur J Pharmacol. 2002;442:251–264. [PubMed]
  • Broach JR, Strathern JN, Hicks JB. Transformation in yeast: development of a hybrid cloning vector and isolation of the CAN1 gene. Gene. 1979;8:121–133. [PubMed]
  • Chaney SG, Campbell SL, Bassett E, Wu Y. Recognition and processing of cisplatin-and oxaliplatin-DNA adducts. Crit Rev Oncol Hematol. 2005;53:3–11. [PubMed]
  • Collins A, Oates DJ. Hydroxyurea: effects on deoxyribonucleotide pool sizes correlated with effects on DNA repair in mammalian cells. Eur J Biochem. 1987;169:299–305. [PubMed]
  • Crowley JC, Kaback DB. Molecular cloning of chromosome I DNA from Saccharomyces cerevisiae: isolation of the ADE1 gene. J Bacteriol. 1984;159:413–417. [PMC free article] [PubMed]
  • Denis V, Boucherie H, Monribot C, Daignan-Fornier B. Role of the myb-like protein bas1p in Saccharomyces cerevisiae: a proteome analysis. Mol Microbiol. 1998;30:557–566. [PubMed]
  • Di Pasqua AJ, Goodisman J, Kerwood DJ, Toms BB, Dubowy RL, Dabrowiak JC. Role of carbonate in the cytotoxicity of carboplatin. Chem Res Toxicol. 2007;20:896–904. [PubMed]
  • Durant ST, Morris MM, Illand M, McKay HJ, McCormick C, Hirst GL, Borts RH, Brown R. Dependence on RAD52 and RAD1 for anticancer drug resistance mediated by inactivation of mismatch repair genes. Curr Biol. 1999;9:51–54. [PubMed]
  • Escobar-Henriques M, Daignan-Fornier B. Transcriptional regulation of the yeast gmp synthesis pathway by its end products. J Biol Chem. 2001;276:1523–1530. [PubMed]
  • Franska M, Franski R, Schroeder G, Springer A, Beck S, Linscheid M. Electrospray ionization mass spectrometric study of purine base-cisplatin complexes. Rapid Commun Mass Spectrom. 2005;19:970–974. [PubMed]
  • Furuchi T, Ishikawa H, Miura N, Ishizuka M, Kajiya K, Kuge S, Naganuma A. Two nuclear proteins, Cin5 and Ydr259c, confer resistance to cisplatin in Saccharomyces cerevisiae. Mol Pharmacol. 2001;59:470–474. [PubMed]
  • Gercel-Taylor C, Scobee JJ, Taylor DD. Effect of chemotherapy on the mutation frequency of ovarian cancer cells at the HPRT locus. Anticancer Res. 2005;25:2113–2117. [PubMed]
  • Guetsova ML, Lecoq K, Daignan-Fornier B. The isolation and characterization of Saccharomyces cerevisiae mutants that constitutively express purine biosynthetic genes. Genetics. 1997;147:383–397. [PMC free article] [PubMed]
  • Hector S, Bolanowska-Higdon W, Zdanowicz J, Hitt S, Pendyala L. In vitro studies on the mechanisms of oxaliplatin resistance. Cancer Chemother Pharmacol. 2001;48:398–406. [PubMed]
  • Holzer AK, Howell SB. The Internalization and Degradation of Human Copper Transporter 1 following Cisplatin Exposure. Cancer Res. 2006;66:10944–10952. [PubMed]
  • Huang RY, Eddy M, Vujcic M, Kowalski D. Genome-wide screen identifies genes whose inactivation confer resistance to cisplatin in Saccharomyces cerevisiae. Cancer Res. 2005;65:5890–5897. [PubMed]
  • Ishikawa T, Ali-Osman F. Glutathione-associated cis-diamminedichloroplatinum(II) metabolism and ATP-dependent efflux from leukemia cells. Molecular characterization of glutathione-platinum complex and its biological significance. J Biol Chem. 1993;268:20116–20125. [PubMed]
  • Jansen BA, Brouwer J, Reedijk J. Glutathione induces cellular resistance against cationic dinuclear platinum anticancer drugs. J Inorg Biochem. 2002;89:197–202. [PubMed]
  • Kerr SL, Shoeib T, Sharp BL. A study of oxaliplatin-nucleobase interactions using ion trap electrospray mass spectrometry. Anal Bioanal Chem. 2008 doi: 10.1007/s00216-008-2128-3. [PubMed] [Cross Ref]
  • Koehler RN, Rachfall N, Rolfes RJ. Activation of the ade genes requires the chromatin remodeling complexes saga and swi/snf. Eukaryotic Cell:EC. 2007:00068–00007. [PMC free article] [PubMed]
  • Lecoq K, Konrad M, Daignan-Fornier B. Yeast GMP kinase mutants constitutively express AMP biosynthesis genes by phenocopying a hypoxanthine-guanine phosphoribosyltransferase defect. Genetics. 2000;156:953–961. [PMC free article] [PubMed]
  • Li G, Alexander H, Schneider N, Alexander S. Molecular basis for resistance to the anticancer drug cisplatin in Dictyostelium. Microbiology. 2000;146(Pt 9):2219–2227. [PubMed]
  • Mantsala P, Zalkin H. Glutamine nucleotide sequence of Saccharomyces cerevisiae ADE4 encoding phosphoribosylpyrophosphate amidotransferase. J Biol Chem. 1984;259:8478–8484. [PubMed]
  • Martin DS, Spriggs D, Koutcher JA. A concomitant ATP-depleting strategy markedly enhances anticancer agent activity. Apoptosis. 2001;6:125–131. [PubMed]
  • Niedner H, Christen R, Lin X, Kondo A, Howell SB. Identification of genes that mediate sensitivity to cisplatin. Mol Pharmacol. 2001;60:1153–1160. [PubMed]
  • Page T, Coleman M. Purine metabolism abnormalities in a hyperuricosuric subclass of autism. Biochim Biophys Acta. 2000;1500:291–296. [PubMed]
  • Perez RP. Cellular and molecular determinants of cisplatin resistance. Eur J Cancer. 1998;34:1535–1542. [PubMed]
  • Rebora K, Desmoucelles C, Borne F, Pinson B, Daignan-Fornier B. Yeast AMP pathway genes respond to adenine through regulated synthesis of a metabolic intermediate. Mol Cell Biol. 2001;21:7901–7912. [PMC free article] [PubMed]
  • Reedijk J, Lohman PH. Cisplatin: synthesis, antitumour activity and mechanism of action. Pharm Weekbl Sci. 1985;7:173–180. [PubMed]
  • Rosenbloom FM. Possible mechanism for increased purine biosynthesis de novo in Lesch-Nyhan syndrome. Fed Proc. 1968;27:1063–1066. [PubMed]
  • Sherman F. Getting started with yeast. Methods Enzymol. 1991;194:3–21. [PubMed]
  • Shinohara A, Ogawa T. Stimulation by Rad52 of yeast Rad51-mediated recombination. Nature. 1998;391:404–407. [PubMed]
  • Sigel RK, Thompson SM, Freisinger E, Glahe F, Lippert B. Metal-modified nucleobase sextet: joining four linear metal fragments (trans-a2PtII) and six model nucleobases to an exceedingly stable entity. Chemistry. 2001;7:1968–1980. [PubMed]
  • Van Driessche N, Alexander H, Min J, Kuspa A, Alexander S, Shaulsky G. Global transcriptional responses to cisplatin in Dictyostelium discoideum identify potential drug targets. Proc Natl Acad Sci U S A. 2007;104:15406–15411. [PMC free article] [PubMed]
  • Yoshida M, Hoshi A. Mechanism of inhibition of phosphoribosylation of 5-fluorouracil by purines. Biochem Pharmacol. 1984;33:2863–2867. [PubMed]
  • Zamble DB, Lippard SJ. Cisplatin and DNA repair in cancer chemotherapy. Trends Biochem Sci. 1995;20:435–439. [PubMed]
  • Zannis-Hadjopoulos M, Baumann EA, Hand R. Effect of purine deprivation on DNA synthesis and deoxyribonucleoside triphosphate pools of a mammalian purine auxotrophic mutant cell line. J Biol Chem. 1980;255:3014–3019. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...