![]() | ![]() |
Formats:
|
||||||||||||||||||||||
Copyright © 2008, American Society for Microbiology Transactivation, Dimerization, and DNA-Binding Activity of White Spot Syndrome Virus Immediate-Early Protein IE1 Institute of Zoology, National Taiwan University, Taipei, Taiwan,1 Department of Molecular Biotechnology, Da-Yeh University, Changhua, Taiwan,2 Institute of Biological Chemistry, Academia Sinica, Taipei, Taiwan3 *Corresponding author. Mailing address: Institute of Zoology, National Taiwan University, Taipei 106, Taiwan. Phone: 886-2-33662453. Fax: 886-2-23638179. E-mail for Chu-Fang Lo: gracelow/at/ntu.edu.tw. E-mail for Guang-Hsiung Kou: ghkou/at/ntu.edu.tw Received June 16, 2008; Accepted August 20, 2008. Abstract Immediate-early proteins from many viruses function as transcriptional regulators and exhibit transactivation activity, DNA binding activity, and dimerization. In this study, we investigated these characteristics in white spot syndrome virus (WSSV) immediate-early protein 1 (IE1) and attempted to map the corresponding functional domains. Transactivation was investigated by transiently expressing a protein consisting of the DNA binding domain of the yeast transactivator GAL4 fused to full-length IE1. This GAL4-IE1 fusion protein successfully activated the Autographa californica multicapsid nucleopolyhedrovirus p35 basal promoter when five copies of the GAL4 DNA binding site were inserted upstream of the TATA box. A deletion series of GAL4-IE1 fusion proteins suggested that the transactivation domain of WSSV IE1 was carried within its first 80 amino acids. A point mutation assay further showed that all 12 of the acidic residues in this highly acidic domain were important for IE1's transactivation activity. DNA binding activity was confirmed by an electrophoresis mobility shift assay using a probe with 32P-labeled random oligonucleotides. The DNA binding region of WSSV IE1 was located in its C-terminal end (amino acids 81 to 224), but mutation of a putative zinc finger motif in this C-terminal region suggested that this motif was not directly involved in the DNA binding activity. A homotypic interaction between IE1 molecules was demonstrated by glutathione S-transferase pull-down assay and a coimmunoprecipitation analysis. A glutaraldehyde cross-linking experiment and gel filtration analysis showed that this self-interaction led to the formation of stable IE1 dimers. White spot syndrome virus (WSSV) is the causative agent of a disease that has led to severe mortalities of cultured shrimps all over the world (10, 14, 23, 53). WSSV is a large double-stranded DNA virus which is extremely virulent (23, 38, 39), has a wide host range (14, 33), and targets various tissues (32, 59). It was recently erected as the type species of genus Whispovirus in the family Nimaviridae (56). Although the complete sequence of the WSSV genome has been known for several years (7, 55, 60), knowledge of the biological functions of the viral proteins is still quite poor. The WSSV immediate-early gene ie1 (31) was recently shown to use a shrimp signal transducer and activator of transcription (STAT) as a transcription factor to enhance its expression and contribute to its high promoter activity in host cells (30). In the present study, we further investigate the characteristics of WSSV IE1. This is made more difficult by the fact that no continuous shrimp cell line is currently available, and while bearing in mind that a heterologous system might introduce experimental artifacts, here we follow previous studies (22, 30, 34) and use the Sf9 insect cell system. Many viral immediate-early genes encode multifunctional transcriptional regulators that both positively and negatively modulate gene expression (26, 52, 57). These transcriptional regulators must possess at least two functional domains, namely, a DNA binding domain (DBD) that allows attachment of the transactivator to its target sequence within a gene promoter and a transactivation domain (TAD) that can interact with the basal transcription machinery and promote the transcription of the target genes. These two domains are often functionally independent and physically separate. In many cases, the activity of these transcriptional regulators is regulated by homophilic interactions (35, 42) as well as by the formation of heterodimers with other transcriptional factors. We show here that WSSV IE1 exhibits all three of these transcriptional regulator functions, and we also attempt to identify the domains that are associated with these functions. While the DBDs are extremely well characterized both functionally and structurally, the activation domains do not share easily recognizable motifs or structures (54). Therefore, in the present study, the TAD of WSSV IE1 was investigated by analyzing the transient expression of GAL4 DBD-IE1 N- or C-terminal deletion mutants. IE1-DNA binding and the functionality of a previously identified Cys2/His2-type zinc finger DNA binding motif (31) were investigated using electrophoretic mobility shift assays (EMSAs). Finally, to investigate the intermolecular interactions of WSSV IE1, a combination of in vitro and in vivo assays were performed to test for IE1 homophilic interactions. MATERIALS AND METHODS Plasmids. (i) Luciferase effectors. The plasmid pIZΔIE/V5-His was used as a starting point in dual-luciferase reporter assays. It was modified from the commercialized plasmid pIZ/V5-His (Invitrogen) by deleting the OpIE2 (Orgyia pseudotsugata multicapsid nucleopolyhedrovirus ie2) promoter located in front of the multiple cloning sites. Next, part (~2 kbp) of the WSSV IE1 promoter fragment upstream of the ATG was amplified from the WSSV genomic DNA (using the primers CGGAATTCGATGATGGTGATGTTTCTAGG and CCGCTCGAGCTTGAGTGGAGAGAGAGAGC [underlined sequences represent the restriction enzyme recognition sites]) and cloned into pIZΔIE/V5-His. The resulting plasmid was designated pWSSV-V5-His and was used to express the full-length ie1 coding region, the GAL4 DBD (29), and various fusion proteins consisting of the GAL4 DBD plus downstream, in-frame insertions of different regions of the WSSV ie1 coding sequence (see Table 1 for the ie1 primers). To construct the GAL4 DBD gene plasmid (pWSSV-GAL4-V5-His), the gene sequence encoding GAL4 DBD amino acids (aa) 1 to 147 was amplified by PCR from yeast genomic DNA (using the primers 5′-GCTCTAGAATGAAGCTACTGTCTTCTATC-3′ and 5′-TCCCCGCGGCGATACAGTCAACTGTCTTTG-3′) and then cloned into the XbaI/SacII-digested pWSSV-V5-His plasmid. One of the fusion protein plasmids, pWSSV-GAL4-IE11-80-V5-His, contained the wild-type IE1 sequence spanning aa 1 to 80, and this plasmid was used as a template to produce a range of N-terminal mutants. Site-directed mutations of the acidic residues of the amino terminus of IE1 were generated by using rolling-circle PCR (20) to replace the acidic residues with alanine. To confirm that only the acidic amino acids were involved in transactivation, alanine was also used to replace two randomly chosen nonacidic residues (G20A and G41A mutations). Mutations were verified for all plasmids by DNA sequencing analysis. The specifically designed mutagenic primers used to generate the IE1 TAD mutants are listed in Table 2.
(ii) Luciferase reporters. The reporter plasmid p35BAS-Luc, which contained the firefly luciferase reporter gene, was constructed by PCR cloning of the Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) p35 basal promoter into the pGL3-Basic vector (Promega), using the primer pair AcMNPV-p35-F1 and AcMNPV-p35-R1 (Table 1). The other reporter plasmid, G5p35BAS-Luc, contained five copies of the GAL4 DNA binding site upstream of the AcMNPV p35 basal promoter, and it was constructed by amplifying five copies of the GAL4 DNA binding site from pG5SEAP (Clontech), using primers GAL4bs-F and GAL4bs-R (Table 1), and then cloning them into p35BAS-Luc vector KpnI and XhoI sites. (iii) Glutathione S-transferase-IE1 (GST-IE1) and GST-VP36B. The plasmids pGST-IE11-224 and pGST-IE181-224 were generated by cloning PCR-amplified WSSV ie1 coding region fragments flanked by EcoRI and XhoI restriction sites into the corresponding sites of predigested pGEX-5X-1 vector (Amersham Pharmacia Biotech). pGST-IE181-224 C2-H2mut was constructed by rolling-circle PCR as described above, using pGST-IE181-224 as the template. The plasmid pGST-VP36B was constructed by cloning the WSSV structural protein VP36B into the pGEX-5X-1 vector, using primers VP36B-F and VP36B-R. Primer sequences are listed in Table 3.
(iv) IE1 expression plasmids. PCR cloning was used to insert the WSSV ie1 coding region into the vectors pDHsp/V5-His and pDHsp/FLAG-His, which both contain the heat-inducible Drosophila heat shock protein 70 promoter (28). The resulting plasmids, pDHsp/IE1-V5-His and pDHsp/IE1-FLAG-His, expressed the V5 and FLAG tag fusion proteins, respectively. Another IE1 expression plasmid, pcDNA3/IE1, was constructed by PCR cloning the WSSV ie1 coding region into the commercialized vector pcDNA3 (Invitrogen). Primer sequences are listed in Table 3. Transient transfections and dual-luciferase reporter assay. Transfections of Sf9 insect cells were performed using the Cellfectin reagent (Invitrogen). Briefly, the Sf9 insect cells were seeded onto a 24-well plate (1 × 105 cells/well) and grown in Sf-900 II serum-free medium (Invitrogen) overnight at 27°C. Cells were cotransfected with 300 ng of the reporter plasmid containing the firefly luciferase gene, 500 ng of one of the different effector plasmids or the empty vector, and 100 ng of the Renilla luciferase gene plasmid, phRL/AcMNPVie1 (30). The phRL/AcMNPVie1 plasmid contains the AcMNPV ie1 promoter to drive the expression of the Renilla luciferase gene and was used to monitor and normalize transfection efficiency. Cells were collected at 48 h posttransfection, and the cell lysates were prepared according to the Promega instruction manual for the dual-luciferase assay system. Luciferase activities were measured with a luminometer (Labsystems). Firefly luciferase activity values were then normalized against the activities of the Renilla luciferase to correct for transfection efficiency, and data were expressed as relative luciferase activities. Luciferase activities were determined for triplicate transfections in two independent experiments, and the means and standard deviations (SD) were calculated. For the point mutation assays, statistically significant differences from the wild-type TAD expression plasmid were identified using paired Student's t test, with significance set at P values of <0.01. Cell extracts and Western blot analysis. Total cell lysates were prepared by directly adding 2× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer (100 mM Tris-HCl [pH 6.8], 200 mM dithiothreitol [DTT], 4% SDS, 0.2% bromophenol blue, 20% glycerol) to cell pellets and then boiling the samples for 10 min. The samples were separated in 15% polyacrylamide gels, transferred to a polyvinylidene difluoride membrane (MSI), incubated with either anti-V5 antibody (Sigma) or anti-β-actin antibody (Chemicon), and then detected with a secondary peroxidase-conjugated antibody. Detected proteins were visualized using an ECL (Perkin-Elmer) detection system. Expression and purification of GST, GST-VP36B, GST-IE11-224, and GST-IE1 deletion mutants. GST fusion proteins were expressed and purified according to the manufacturer's manual. After overnight culture of the GST plasmids in transformed Escherichia coli BL21 Codon Plus cells (Stratagene), the cultures were diluted 1:200 (vol/vol) in Luria-Bertani (LB) medium containing 50 μg/ml of ampicillin and then incubated for another 3 h at 37°C. Expression of the fusion proteins was induced by the addition of IPTG (isopropyl-β-d-thiogalactopyranoside) to a final concentration of 1 mM, and the cultures were grown for a further 24 h at 15°C. The soluble GST fusion proteins were resuspended in lysis buffer (50 mM Tris-HCl [pH 8.0], 300 mM NaCl, 1 mM DTT, and 1 mM EDTA) and purified by affinity chromatography with an FF 16/10 GST column (Amersham Biosciences). The fusion proteins were eluted from the beads with 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 1 mM DTT, 1 mM EDTA, and 10 mM reduced glutathione, and then the purified proteins were condensed with an Amicon Ultra-30 column (Millipore). To obtain the IE11-224 protein, the GST was removed from the GST-IE11-224 fusion protein by digestion with factor Xa (10 units of protease/1 mg GST fusion protein; Amersham Biosciences) in 1× phosphate-buffered saline (PBS) containing 1 mM DTT at 22°C for 16 h. The digested GST was removed with a GST column. Purity of the samples was assessed by SDS-PAGE, and the protein concentration was determined using a Bio-Rad protein assay kit. DNA binding assay (EMSA). EMSA was performed as described previously (49), with some modifications. Single-stranded oligonucleotides containing a 25-nucleotide random core sequence flanked on each side by 27 nucleotides [5′-GTCGCTCGAGCGGTATGACGAGATCTA(N)25TAGATCTGCGTCACTAGTCTAGACTAG-3′ (where N can be any of the four deoxyribonucleotides)] were synthesized (9). A double-stranded [α-32P]dCTP-labeled oligonucleotide library was generated by PCR using the forward primer 5′-GTCGCTCGAGCGGTATGACG-3′ and the reverse primer 5′-CTAGTCTAGACTAGTGACGC-3′. Binding reactions were carried out for 30 min at room temperature in 15-μl reaction mixtures that contained different concentrations of purified recombinant proteins with 10 mM HEPES (pH 7.9), 1 mM DTT, 5 mM MgCl2, 0.5 mM ZnCl2, 60 mM KCl, 0.05% NP-40, 200 ng poly(dI-dC), 10% glycerol, and 50 μg/ml bovine serum albumin. The DNA-protein complexes were resolved in 7.5% polyacrylamide gels in 0.5× Tris-glycine buffer (12.5 mM Tris and 100 mM glycine). The gels were dried and visualized by autoradiography. Some EMSA reactions were run with no ZnCl2 in the binding buffer. In vitro protein synthesis and GST pull-down assay. Coupled in vitro transcription-translation reactions were conducted using a TNT kit in accordance with the manufacturer's protocol (Promega). One microgram of plasmid pcDNA3/IE1 DNA and 2 μl of [35S]methionine (1,000 Ci/mmol; 10 mCi/ml) were added to the TNT mixture (50-μl total volume), and reactions were carried out at 30°C for 90 min. To ensure that there was no contamination by nucleic acids, the purified proteins GST and GST-IE11-224 and the TNT product [35S]methionine-labeled IE1 were all pretreated with nucleases (1 U DNase I [Invitrogen] and 0.5 μg RNase [Sigma]) for 1 h at 25°C in 50 mM Tris-HCl, pH 8, 5 mM MgCl2, 2.5 mM CaCl2, 100 mM NaCl, 5% glycerol, and 1 mM DTT. Subsequently, equal amounts of the TNT product were incubated with GST-IE11-224 (10 μg) or GST (10 μg) bound to glutathione-Sepharose beads in 150 μl NETN buffer (20 mM Tris-HCl [pH 8.0], 100 mM NaCl, 1 mM EDTA, 0.5% NP-40, and a cocktail tablet of protease inhibitors [Roche]) in the presence of ethidium bromide (100 μg/ml) at 4°C for 3 h. After three 10-min washes with NETN buffer, the proteins that bound to the beads were resolved by 15% SDS-PAGE, and the gel was dried and exposed to Kodak Biomax MS film. Coimmunoprecipitation. Sf9 cells were seeded on six-well plates (8 × 105 cells/well) and cotransfected with 2 μg pDHsp/IE1-V5-His and 2 μg pDHsp/IE1-FLAG-His expression plasmid, using Cellfectin reagent. After transfection for 16 to 18 h, the cells were heat shocked in a 42°C water bath for 30 min and then returned to 27°C. Six hours after being heat shocked, the cells were washed with PBS and lysed in 100 μl of NP-40 lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40) supplemented with a protease inhibitor cocktail tablet. The lysis procedure was carried out on ice for 10 min with occasional shaking. The lysate was centrifuged at 12,000 × g for 5 min, and an aliquot of the supernatant (10 μl) was reserved for immunoblot analysis to confirm the expression of the transfected gene. The remaining supernatant (90 μl) was then incubated with 15 μl of anti-FLAG M2 affinity gel (Sigma) at 4°C overnight with rotation. The gel was then washed five times in 150 μl of NP-40 lysis buffer. Aliquots of the total cell lysates and immunoprecipitates were separated by 15% SDS-PAGE and transferred to a polyvinylidene difluoride membrane. V5-tagged IE1 fusion proteins were detected with rabbit anti-V5 antibody (Sigma) and goat anti-rabbit immunoglobulin G-horseradish peroxidase conjugate (Sigma). FLAG-tagged IE1 was detected with mouse anti-FLAG monoclonal antibody (Sigma) and goat anti-mouse immunoglobulin G-horseradish peroxidase conjugate (Sigma). Gel filtration. To evaluate the native molecular size of IE1, purified IE11-224 was analyzed using a Superdex 200-pg gel filtration column (Amersham Biosciences) (using buffer comprised of 500 mM NaCl, 1 mM DTT, 1 mM EDTA, and 20 mM sodium acetate, pH 5.5). Gel filtration standard proteins (bovine serum albumin [67 kDa], ovalbumin [43 kDa], chymotrypsinogen A [25 kDa], and RNase A [13.7 kDa]) were used to calibrate the column. For each protein, the logarithm of molecular mass was plotted against Kav, which was calculated as follows: Kav = (Ve − Vo)/(Vt − Vo), where Ve is the elution volume, Vo is the column void volume using blue dextran 2000, and Vt is the total column bed volume (120 ml for Superdex 200-pg gel filtration column). WSSV IE1 antibody preparation. A PCR fragment representing the coding region of ie1 was amplified using the IE1-NdeI-F/IE1-XhoI-R primer set (Table 3), digested with restriction enzymes, and cloned into pET-28b(+) (Novagen). The resulting pET clone was transformed into BL21 cells. For protein expression and purification, the cells were grown overnight at 37°C in LB medium supplemented with 50 μg of kanamycin/ml and 34 μg of chloramphenicol/ml. The cells were inoculated into new medium at a ratio of 1:50 and grown at 37°C for 2 to 2.5 h. Expression was induced by the addition of 1 mM IPTG, and incubation was continued for another 1.5 to 3 h. The induced bacteria were spun down at 4°C, suspended in ice-cold PBS containing 10% glycerol and a protease inhibitor cocktail tablet, and then sonicated for 3 min on ice. The insoluble debris was collected by centrifugation, suspended in PBS containing 1.5% sodium lauryl sarcosine, and solubilized by shaking at room temperature for 1 h. The supernatant was clarified by centrifugation and mixed with Ni-nitrilotriacetic acid-agarose beads (Qiagen) on a rotating wheel at 4°C for 16 h or overnight. The beads were then washed several times with ice-cold wash buffer (1 M NaCl, 10 mM Tris-HCl, pH 7.5) to remove unbound material. The fusion proteins were eluted directly from the beads with SDS sample buffer and then subjected to SDS-PAGE analysis. The protein bands containing the fusion proteins were sliced from the gel, minced, mixed with Freund's adjuvant, and used for antibody production. Glutaraldehyde cross-linking of proteins. For protein polymerization assays, Sf9 cells were transfected with pDHsp/IE1-V5-His plasmid DNA and heat shocked as described above. The transfected cells were then washed with PBS, lysed in a hypotonic buffer (10 mM Tris-HCl [pH 7.5], 10 mM KCl, and 5 mM MgCl2), and incubated on ice for 20 min. The swollen cells were passed through a 25-gauge needle 20 times to disrupt the cells. After centrifugation at 1,000 × g, the supernatant was incubated with glutaraldehyde (Sigma) at a final concentration of 0.01% at room temperature for various times. The reactions were stopped by the addition of an equal volume of 2× SDS sample buffer, and the samples were subjected to Western blotting using IE1 polyclonal antibody. RESULTS WSSV IE1 contains TADs. As an initial indication of whether the WSSV IE1 gene product contains a transcriptional activation domain, the IE1 gene was fused to sequences encoding the 147-aa DBD of the yeast transcriptional activator GAL4 (Fig. (Fig.1A).1A
Mapping of the WSSV IE1 TAD. In order to determine the essential domains for transactivation, three series of deletion mutants of WSSV IE1 were generated and constructed as fusion proteins with the GAL4 DBD at the N terminus (Fig. (Fig.2A,2A
Negatively charged amino acids are important for IE1 transactivation activity. Sequence analysis shows that there are 12 acidic amino acids and 6 basic residues in the IE1 minimal TAD (aa 1 to 80), giving the TAD a net negative charge of −6 and a pI of 4.3. Since most TADs can be classified as either acidic activators (46), glutamine-rich activators (11), aromatic and hydrophobic activators (44), or proline-rich activators (37), the acidity of the WSSV IE1 TAD suggested that it might fall within the acidic class of activation domains. We investigated this possibility by constructing mutants (Table 2) in which alanine (A) was used to replace the wild-type aspartate (D), glutamate (E), or glycine (G) residues. GAL4 transactivation assays showed that almost all of these alanine substitutions significantly reduced G5p35BAS-Luc activation (P < 0.01). Replacement of increasing numbers of acidic residues led to a further decrease in transactivation activity (Fig. (Fig.3A),3A
DNA binding activity of WSSV IE1. The DNA binding activity of WSSV IE1 was investigated by gel mobility shift assays using a 79-bp double-stranded DNA oligonucleotide containing a central 25-bp randomized sequence. GST-tagged versions of IE1 and VP36B (a WSSV structural protein which served as a negative control) were expressed in E. coli to produce either GST-IE11-224, GST-VP36B, or IE11-224 alone. These soluble, well-expressed proteins were then purified with glutathione-Sepharose beads (Fig. (Fig.4A).4A
The WSSV IE1 C-terminal region is required for DNA binding. Since DBDs and TADs usually do not overlap, we hypothesized that the DBD of IE1 was located in the C-terminal region. To test this hypothesis, we expressed and purified two GST-IE1 proteins: GST-IE181-224 was a deletion without the N-terminal TAD, and GST-IE181-224C2-H2mut was identical except for a mutated zinc finger motif (Fig. (Fig.5A).5A
IE1 has a strong affinity for self-interaction. Many virus immediate-early proteins are in dimeric form when they bind to DNA (8, 16, 40, 57). We therefore performed an in vitro biochemical binding assay to determine whether IE1 can also self-interact directly. For this assay, the GST-IE11-224 fusion protein was bound to glutathione-Sepharose beads and incubated with in vitro-translated, [35S]methionine-labeled IE1. SDS-PAGE analysis showed that 35S-labeled IE1 bound to the GST-IE11-224 fusion protein but not to GST, indicating that IE1 can interact directly with itself (Fig. (Fig.6A).6A
IE1 protein forms a dimer. Both gel filtration chromatography and chemical cross-linking were used to investigate the form of IE1 polymerization. Gel filtration chromatography using a Superdex 200-pg gel filtration column revealed that the major peak of purified IE1 eluted with an apparent molecular size of 46 kDa, as calculated from the logarithm of molecular size against the Kav values of protein standards that were fractionated in the same column (Fig. (Fig.6C,6C DISCUSSION Our data suggest that the IE1 residues sufficient for transactivation are confined to the N terminus (Fig. (Fig.2).2 In the region of the TAD (aa 1 to 80) of WSSV IE1, three possible inhibitory domains were identified, at aa 41 to 49, aa 81 to 92, and aa 93 to 137. To date, little is known about sequences which mediate transcription inhibition and which are present within transcriptional activators. We note, however, that the WSSV IE1 potential inhibitory domain from aa 41 to 49 contains a large proportion of positively charged amino acids (GIEVMKRRL [the three basic residues are underlined]). Slack and Blissard (50) suggested that the substantial concentrations of positively charged amino acids in two inhibition domains of the baculovirus AcMNPV IE1 may act to neutralize the adjacent activation region. It is possible that the basic amino acids in WSSV IE1 aa 41 to 49 are likewise responsible for negatively regulating WSSV IE1's transcriptional activation. The putative WSSV IE1 inhibitory domains at aa 81 to 92 and aa 93 to 137 do not contain large proportions of basic residues. If they regulate the TAD activity, it is therefore probable that they do so either by direct interactions with components of the general transcription factors (4, 51) or by indirect interactions through secondary “inhibitor” proteins that mask the activation domain (2, 5). In addition to the TAD, most transcriptional factors also require a second region that confers specificity for target genes. This region may confer target gene specificity either directly (in the form of a DBD) or indirectly (by serving as an interface for protein-protein interactions with factors bound to target genes). Our EMSA results (Fig. (Fig.5C)5C When there is only a single predicted zinc finger in a transcription factor (for example, human cytomegalovirus immediate-early protein IE2 [1]), it is not always used to bind DNA. On the contrary, when transcription factors use zinc fingers to bind DNA, there are usually several (often three or more) fingers involved (24, 36, 58). Furthermore, the involvement of zinc finger motifs in other activities has also been documented for viruses. For instance, the herpesvirus saimiri immediate-early protein ORF57 is a transcriptional activator with a zinc finger-like domain in its C terminus, and during a herpesvirus saimiri infection, this domain is required for transactivation, repression of viral proteins, and the redistribution of the host splicing factor SC-35 (19). Other examples include adenovirus E1A, which has a zinc finger domain that functions in protein-protein interactions and transactivation activity (17, 47), and HSV type 1 immediate-early protein ICP27, whose C-terminal zinc finger domain is required for ICP27 self-interaction (61). In the case of IE1, several observations are relevant to the possible function of its zinc finger. Like many other virus immediate-early proteins that bind DNA in a dimeric form (8, 16, 40, 57), our evidence suggests that WSSV IE1 also has this characteristic. Starting from the EMSA results (Fig. (Fig.4B4B In conclusion, we have been able to ascribe several functions to separate regions of the WSSV IE1 protein. Our data suggest that WSSV IE1 has at least two distinguishable domains, an N-terminal region that is essential for transactivation and a C-terminal region that is required for DNA binding activity. We also conclude that IE1 probably occurs primarily as a homodimeric protein. Acknowledgments This investigation was supported financially by a National Science Council grant (NSC96-2317-B-002-005) and by the Council of Agriculture (97AS-14.1.1-AQ-B1). We are indebted to Paul Barlow for his helpful criticism. Footnotes Published ahead of print on 3 September 2008.REFERENCES 1. Asmar, J., L. Wiebusch, M. Truss, and C. Hagemeier. 2004. The putative zinc finger of the human cytomegalovirus IE2 86-kilodalton protein is dispensable for DNA binding and autorepression, thereby demarcating a concise core domain in the C terminus of the protein. J. Virol. 7811853-11864. [PubMed] 2. Baichwal, V. R., A. Park, and R. Tjian. 1992. The cell-type-specific activator region of c-Jun juxtaposes constitutive and negatively regulated domains. Genes Dev. 61493-1502. [PubMed] 3. Blair, W. S., H. P. Bogerd, S. J. Madore, and B. R. Cullen. 1994. Mutational analysis of the transcription activation domain of RelA: identification of a highly synergistic minimal acidic activation module. Mol. Cell. Biol. 147226-7234. [PubMed] 4. Boyd, J. M., P. M. Loewenstein, Q. Tang, L. Yu, and M. Green. 2002. Adenovirus E1A N-terminal amino acid sequence requirements for repression of transcription in vitro and in vivo correlate with those required for E1A interference with TBP-TATA complex formation. J. Virol. 761461-1474. [PubMed] 5. Brown, H. J., J. A. Sutherland, A. Cook, A. J. Bannister, and T. Kouzarides. 1995. An inhibitor domain in c-Fos regulates activation domains containing the HOB1 motif. EMBO J. 14124-131. [PubMed] 6. Buczynski, K. A., S. K. Kim, and D. J. O'Callaghan. 1999. Characterization of the transactivation domain of the equine herpesvirus type 1 immediate-early protein. Virus Res. 65131-140. [PubMed] 7. Chen, L.-L., H.-C. Wang, C.-J. Huang, S.-E. Peng, Y.-G. Chen, S.-J. Lin, W.-Y. Chen, C.-F. Dai, H.-T. Yu, C.-H. Wang, C.-F. Lo, and G.-H. Kou. 2002. Transcriptional analysis of the DNA polymerase gene of shrimp white spot syndrome virus. Virology 301136-147. [PubMed] 8. Chiou, C.-J., J. Zong, I. Waheed, and G. S. Hayward. 1993. Identification and mapping of dimerization and DNA-binding domains in the C terminus of the IE2 regulatory protein of human cytomegalovirus. J. Virol. 676201-6214. [PubMed] 9. Choi, Y.-S., and S. Sinha. 2006. Determination of the consensus DNA-binding sequence and a transcriptional activation domain for ESE-2. Biochem. J. 398497-507. [PubMed] 10. Chou, H.-Y., C.-Y. Huang, C.-H. Wang, H.-C. Chiang, and C.-F. Lo. 1995. Pathogenicity of a baculovirus infection causing white spot syndrome in cultured penaeid shrimp in Taiwan. Dis. Aquat. Organ. 23165-173. 11. Courey, A. J., D. A. Holtzman, S. P. Jackson, and R. Tjian. 1989. Synergistic activation by the glutamine-rich domains of human transcription factor Sp1. Cell 59827-836. [PubMed] 12. Cress, W. D., and S. J. Triezenberg. 1991. Critical structural elements of the VP16 transcriptional activation domain. Science 25187-90. [PubMed] 13. Defossez, P. A., J. L. Baert, M. Monnot, and Y. de Launoit. 1997. The ETS family member ERM contains an alpha-helical acidic activation domain that contacts TAFII60. Nucleic Acids Res. 254455-4463. [PubMed] 14. Flegel, T. W. 1997. Special topic review: major viral diseases of the black tiger prawn (Penaeus monodon) in Thailand. World J. Microbiol. Biotech. 13422-433. 15. Forsythe, I. J., C. E. Shippam, L. G. Willis, S. Stewart, T. Grigliatti, and D. A. Theilmann. 1998. Characterization of the acidic domain of the IE1 regulatory protein from Orgyia pseudotsugata multicapsid nucleopolyhedrovirus. Virology 25265-81. [PubMed] 16. Gallinari, P., K. Wiebauer, M. C. Nardi, and J. Jiricny. 1994. Localization of a 34-amino-acid segment implicated in dimerization of the herpes simplex virus type 1 ICP4 polypeptide by a dimerization trap. J. Virol. 683809-3820. [PubMed] 17. Geisberg, J. V., W. S. Lee, A. J. Berk, and R. P. Ricciardi. 1994. The zinc finger region of the adenovirus E1A transactivating domain complexes with the TATA box binding protein. Proc. Natl. Acad. Sci. USA 912488-2492. [PubMed] 18. Gill, G., and M. Ptashne. 1987. Mutants of GAL4 protein altered in an activation function. Cell 51121-126. [PubMed] 19. Goodwin, D. J., K. T. Hall, M. S. Giles, M. A. Calderwood, A. F. Markham, and A. Whitehouse. 2000. The carboxy terminus of the herpesvirus saimiri ORF 57 gene contains domains that are required for transactivation and transrepression. J. Gen. Virol. 812253-2265. [PubMed] 20. Hemsley, A., N. Arnheim, M. D. Toney, G. Cortopassi, and D. J. Galas. 1989. A simple method for site-directed mutagenesis using the polymerase chain reaction. Nucleic Acids Res. 176545-6551. [PubMed] 21. Hope, I. A., S. Mahadevan, and K. Struhl. 1988. Structural and functional characterization of the short acidic transcriptional activation region of yeast GCN4 protein. Nature 333635-640. [PubMed] 22. Hossain, M. S., S. Khadijah, and J. Kwang. 2004. Characterization of ORF89—a latency-related gene of white spot syndrome virus. Virology 325106-115. [PubMed] 23. Inouye, K., S. Miwa, N. Oseko, H. Nakano, and T. Kimura. 1994. Mass mortalities of cultured kuruma shrimp, Penaeus japonicus, in Japan in 1993: electron microscopic evidence of the causative virus. Fish Pathol. 29149-158. 24. Iuchi, S. 2001. Three classes of C2H2 zinc finger proteins. Cell. Mol. Life Sci. 58625-635. [PubMed] 25. Jonker, H. R., R. W. Wechselberger, R. Boelens, G. E. Folkers, and R. Kaptein. 2005. Structural properties of the promiscuous VP16 activation domain. Biochemistry 44827-839. [PubMed] 26. Kovacs, G. R., J. Choi, L. A. Guarino, and M. D. Summers. 1992. Functional dissection of the Autographa californica nuclear polyhedrosis virus immediate-early 1 transcriptional regulatory protein. J. Virol. 667429-7437. [PubMed] 27. Lee, M. S., G. P. Gippert, K. V. Soman, D. A. Case, and P. E. Wright. 1989. Three-dimensional solution structure of a single zinc finger DNA-binding domain. Science 245635-637. [PubMed] 28. Leu, J.-H., Y.-C. Kuo, G.-H. Kou, and C.-F. Lo. 2008. Molecular cloning and characterization of an inhibitor of apoptosis protein (IAP) from the tiger shrimp, Penaeus monodon. Dev. Comp. Immunol. 32121-133. [PubMed] 29. Lin, Y.-S., M. Carey, M. Ptashne, and M. R. Green. 1990. How different eukaryotic transcriptional activators can cooperate promiscuously. Nature 345359-361. [PubMed] 30. Liu, W.-J., Y.-S. Chang, A. H.-J. Wang, G.-H. Kou, and C.-F. Lo. 2007. White spot syndrome virus annexes a shrimp STAT to enhance expression of the immediate-early gene ie1. J. Virol. 811461-1471. [PubMed] 31. Liu, W.-J., Y.-S. Chang, C.-H. Wang, G.-H. Kou, and C.-F. Lo. 2005. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp. Virology 334327-341. [PubMed] 32. Lo, C.-F., C.-H. Ho, C.-H. Chen, K.-F. Liu, Y.-L. Chiu, P.-Y. Yeh, S.-E. Peng, H.-C. Hsu, H.-C. Liu, C.-F. Chang, M.-S. Su, C.-H. Wang, and G.-H. Kou. 1997. Detection and tissue tropism of white spot syndrome baculovirus (WSBV) in captured brooders of Penaeus monodon with a special emphasis on reproductive organs. Dis. Aquat. Organ. 3053-72. 33. Lo, C.-F., C.-H. Ho, S.-E. Peng, C.-H. Chen, H.-C. Hsu, Y.-L. Chiu, C.-F. Chang, K.-F. Liu, M.-S. Su, C.-H. Wang, and G.-H. Kou. 1996. White spot syndrome baculovirus (WSBV) detected in cultured and captured shrimp, crabs and other arthropods. Dis. Aquat. Organ. 27215-225. 34. Lu, L., H. Wang, I. Manopo, L. Yu, and J. Kwang. 2005. Baculovirus-mediated promoter assay and transcriptional analysis of white spot syndrome virus orf427 gene. Virol. J. 271. http://www.virologyj.com/content/2/1/71. [PubMed] 35. Massari, M. E., and C. Murre. 2000. Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol. Cell. Biol. 20429-440. [PubMed] 36. McDowall, J. 2007. Protein of the month: zinc fingers. http://www.ebi.ac.uk/interpro/potm/2007_3/Page1.htm. 37. Mermod, N., E. A. O'Neill, T. J. Kelly, and R. Tjian. 1989. The proline-rich transcriptional activator of CTF/NF-I is distinct from the replication and DNA binding domain. Cell 58741-753. [PubMed] 38. Momoyama, K., M. Hiraoka, H. Nakano, H. Koube, K. Inouye, and N. Oseko. 1994. Mass mortalities of cultured kuruma shrimp, Penaeus japonicus, in Japan in 1993: histopathological study. Fish Pathol. 29141-148. 39. Nakano, H., H. Koube, S. Umezawa, K. Momoyama, M. Hiraoka, K. Inouye, and N. Oseko. 1994. Mass mortalities of cultured kuruma shrimp, Penaeus japonicus, in Japan in 1993: epizootiological survey and infection trails. Fish Pathol. 29135-139. 40. Olson, V. A., J. A. Wetter, and P. D. Friesen. 2003. The highly conserved basic domain I of baculovirus IE1 is required for hr enhancer DNA binding and hr-dependent transactivation. J. Virol. 775668-5677. [PubMed] 41. Parraga, G., S. J. Horvath, A. Eisen, W. E. Taylor, L. Hood, E. T. Young, and R. E. Klevit. 1988. Zinc-dependent structure of a single-finger domain of yeast ADR1. Science 2411489-1492. [PubMed] 42. Patikoglou, G., and S. K. Burley. 1997. Eukaryotic transcription factor-DNA complexes. Annu. Rev. Biophys. Biomol. Struct. 26289-325. [PubMed] 43. Pavletich, N. P., and C. O. Pabo. 1991. Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A. Science 252809-817. [PubMed] 44. Regier, J. L., F. Shen, and S. J. Triezenberg. 1993. Pattern of aromatic and hydrophobic amino acids critical for one of two subdomains of the VP16 transcriptional activator. Proc. Natl. Acad. Sci. USA 90883-887. [PubMed] 45. Roberts, S. G., I. Ha, E. Maldonado, D. Reinberg, and M. R. Green. 1993. Interaction between an acidic activator and transcription factor TFIIB is required for transcriptional activation. Nature 363741-744. [PubMed] 46. Sadowski, I., J. Ma, S. Triezenberg, and M. Ptashne. 1988. GAL4-VP16 is an unusually potent transcriptional activator. Nature 335563-564. [PubMed] 47. Sanchez, T. A., I. Habib, J. L. Booth, S. M. Evetts, and J. P. Metcalf. 2000. Zinc finger and carboxyl regions of adenovirus E1A 13S CR3 are important for transactivation of the cytomegalovirus major immediate early promoter by adenovirus. Am. J. Respir. Cell Mol. Biol. 23670-677. [PubMed] 48. Schmitz, M. L., M. A. dos Santos Silva, H. Altmann, M. Czisch, T. A. Holak, and P. A. Baeuerle. 1994. Structural and functional analysis of the NF-kappa B p65 C terminus. An acidic and modular transactivation domain with the potential to adopt an alpha-helical conformation. J. Biol. Chem. 26925613-25620. [PubMed] 49. Sekimata, M., and Y. Homma. 2004. Sequence-specific transcriptional repression by an MBD2-interacting zinc finger protein MIZF. Nucleic Acids Res. 32590-597. [PubMed] 50. Slack, J. M., and G. W. Blissard. 1997. Identification of two independent transcriptional activation domains in the Autographa californica multicapsid nuclear polyhedrosis virus IE1 protein. J. Virol. 719579-9587. [PubMed] 51. Song, C.-Z., P. M. Loewenstein, K. Toth, and M. Green. 1995. Transcription factor TFIID is a direct functional target of the adenovirus E1A transcription-repression domain. Proc. Natl. Acad. Sci. USA 9210330-10333. [PubMed] 52. Stenberg, R. M. 1996. The human cytomegalovirus major immediate-early gene. Intervirology 39343-349. [PubMed] 53. Takahashi, Y., T. Itami, M. Kondo, M. Maeda, R. Fujii, S. Tomonaga, K. Supamattaya, and S. Boonyaratpalin. 1994. Electron microscopic evidence of bacilliform virus infection in kuruma shrimp (Penaeus japonicus). Fish Pathol. 29121-125. 54. Triezenberg, S. J. 1995. Structure and function of transcriptional activation domains. Curr. Opin. Gen. Dev. 5190-196. 55. van Hulten, M. C. W., J. Witteveldt, S. Peters, N. Kloosterboer, R. Tarchini, M. Fiers, H. Sandbrink, R. K. Lankhorst, and J. M. Vlak. 2001. The white spot syndrome virus DNA genome sequence. Virology 2867-22. [PubMed] 56. Vlak, J. M., J. R. Bonami, T. W. Flegel, G.-H. Kou, D. V. Lightner, C.-F. Lo, P. C. Loh, and P. J. Walker. 2004. Nimaviridae, p. 187-192. In C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger, and L. A. Ball (ed.), VIIIth report of the International Committee on Taxonomy of Viruses. Elsevier, Amsterdam, The Netherlands. 57. West, J. T., and C. Wood. 2003. The role of Kaposi's sarcoma-associated herpesvirus/human herpesvirus-8 regulator of transcription activation (RTA) in control of gene expression. Oncogene 225150-5163. [PubMed] 58. Wolfe, S. A., L. Nekludova, and C. O. Pabo. 2000. DNA recognition by Cys2His2 zinc finger proteins. Annu. Rev. Biophys. Biomol. Struct. 29183-212. [PubMed] 59. Wongteerasupaya, C., J. E. Vickers, S. Sriurairatana, G. L. Nash, A. Akarajamorn, V. Boosaeng, S. Panyim, A. Tassanakajon, B. Withyachumnarnkul, and T. W. Flegel. 1995. A non-occluded, systemic baculovirus that occurs in the cells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon. Dis. Aquat. Organ. 2169-77. 60. Yang, F., J. He, X. Lin, Q. Li, D. Pan, X. Zhang, and X. Xu. 2001. Complete genome sequence of the shrimp white spot bacilliform virus. J. Virol. 7511811-11820. [PubMed] 61. Zhi, Y., K. S. Sciabica, and R. M. Sandri-Goldin. 1999. Self-interaction of the herpes simplex virus type 1 regulatory protein ICP27. Virology 257341-351. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||
Virology. 2002 Sep 15; 301(1):136-47.
[Virology. 2002]Virology. 2001 Jul 20; 286(1):7-22.
[Virology. 2001]J Virol. 2001 Dec; 75(23):11811-20.
[J Virol. 2001]Virology. 2005 Apr 10; 334(2):327-41.
[Virology. 2005]J Virol. 2007 Feb; 81(3):1461-71.
[J Virol. 2007]J Virol. 1992 Dec; 66(12):7429-37.
[J Virol. 1992]Intervirology. 1996; 39(5-6):343-9.
[Intervirology. 1996]Oncogene. 2003 Aug 11; 22(33):5150-63.
[Oncogene. 2003]Mol Cell Biol. 2000 Jan; 20(2):429-40.
[Mol Cell Biol. 2000]Annu Rev Biophys Biomol Struct. 1997; 26():289-325.
[Annu Rev Biophys Biomol Struct. 1997]Virology. 2005 Apr 10; 334(2):327-41.
[Virology. 2005]Nature. 1990 May 24; 345(6273):359-61.
[Nature. 1990]Nucleic Acids Res. 1989 Aug 25; 17(16):6545-51.
[Nucleic Acids Res. 1989]Dev Comp Immunol. 2008; 32(2):121-33.
[Dev Comp Immunol. 2008]J Virol. 2007 Feb; 81(3):1461-71.
[J Virol. 2007]Nucleic Acids Res. 2004; 32(2):590-7.
[Nucleic Acids Res. 2004]Biochem J. 2006 Sep 15; 398(3):497-507.
[Biochem J. 2006]Nature. 1988 Oct 6; 335(6190):563-4.
[Nature. 1988]Cell. 1989 Dec 1; 59(5):827-36.
[Cell. 1989]Proc Natl Acad Sci U S A. 1993 Feb 1; 90(3):883-7.
[Proc Natl Acad Sci U S A. 1993]Cell. 1989 Aug 25; 58(4):741-53.
[Cell. 1989]Virus Res. 1999 Dec 15; 65(2):131-40.
[Virus Res. 1999]Virology. 2005 Apr 10; 334(2):327-41.
[Virology. 2005]J Virol. 1993 Oct; 67(10):6201-14.
[J Virol. 1993]J Virol. 1994 Jun; 68(6):3809-20.
[J Virol. 1994]J Virol. 2003 May; 77(10):5668-77.
[J Virol. 2003]Oncogene. 2003 Aug 11; 22(33):5150-63.
[Oncogene. 2003]J Virol. 1992 Dec; 66(12):7429-37.
[J Virol. 1992]Nature. 1988 Oct 6; 335(6190):563-4.
[Nature. 1988]Science. 1991 Jan 4; 251(4989):87-90.
[Science. 1991]Cell. 1987 Oct 9; 51(1):121-6.
[Cell. 1987]Nature. 1988 Jun 16; 333(6174):635-40.
[Nature. 1988]J Virol. 1997 Dec; 71(12):9579-87.
[J Virol. 1997]J Virol. 2002 Feb; 76(3):1461-74.
[J Virol. 2002]Proc Natl Acad Sci U S A. 1995 Oct 24; 92(22):10330-3.
[Proc Natl Acad Sci U S A. 1995]Genes Dev. 1992 Aug; 6(8):1493-502.
[Genes Dev. 1992]EMBO J. 1995 Jan 3; 14(1):124-31.
[EMBO J. 1995]Virology. 2005 Apr 10; 334(2):327-41.
[Virology. 2005]Science. 1989 Aug 11; 245(4918):635-7.
[Science. 1989]Science. 1988 Sep 16; 241(4872):1489-92.
[Science. 1988]Science. 1991 May 10; 252(5007):809-17.
[Science. 1991]Annu Rev Biophys Biomol Struct. 2000; 29():183-212.
[Annu Rev Biophys Biomol Struct. 2000]J Virol. 2004 Nov; 78(21):11853-64.
[J Virol. 2004]Cell Mol Life Sci. 2001 Apr; 58(4):625-35.
[Cell Mol Life Sci. 2001]Annu Rev Biophys Biomol Struct. 2000; 29():183-212.
[Annu Rev Biophys Biomol Struct. 2000]J Gen Virol. 2000 Sep; 81(Pt 9):2253-65.
[J Gen Virol. 2000]Proc Natl Acad Sci U S A. 1994 Mar 29; 91(7):2488-92.
[Proc Natl Acad Sci U S A. 1994]J Virol. 1993 Oct; 67(10):6201-14.
[J Virol. 1993]J Virol. 1994 Jun; 68(6):3809-20.
[J Virol. 1994]J Virol. 2003 May; 77(10):5668-77.
[J Virol. 2003]Oncogene. 2003 Aug 11; 22(33):5150-63.
[Oncogene. 2003]Virology. 1999 May 10; 257(2):341-51.
[Virology. 1999]