![]() | ![]() |
Formats:
|
||||||||||||||||||||||||
The Histoplasma capsulatum Vacuolar ATPase is Required for Iron Homeostasis, Intracellular Replication in Macrophages, and Virulence in a Murine Model of Histoplasmosis 1Department of Internal Medicine, Division of Infectious Diseases, University of Cincinnati College of Medicine, Cincinnati, OH 2Department of Cell and Cancer Biology, University of Cincinnati College of Medicine, Cincinnati, OH 3Cincinnati Veterans Affairs Medical Center, Cincinnati, OH *For correspondence. Email newmansl/at/email.uc.edu; Tel 513-558-4709; Fax 513-558-2089 The publisher's final edited version of this article is available at Mol Microbiol.Summary Histoplasma capsulatum is a dimorphic fungal pathogen that survives and replicates within macrophages (Mϕ). To identify specific genes required for intracellular survival, we utilized Agrobacterium tumefaciens-mediated mutagenesis, and screened for H. capsulatum insertional mutants that were unable to survive in human Mϕ. One colony was identified that had an insertion within VMA1, the catalytic subunit A of the vacuolar ATPase (V-ATPase). The vma1 mutant (vma1::HPH) grew normally on iron replete medium, but not on iron deficient media. On iron deficient medium, the growth of the vma1 mutant was restored in the presence of wild type (WT) H. capsulatum yeasts, or the hydroxamate siderophore, rhodotorulic acid. However, the inability to replicate within Mϕ was only partially restored by the addition of exogenous iron. The vma1::HPH mutant also did not grow as a mold at 28°C. Complementation of the mutant (vma/VMA1) restored its ability to replicate in Mϕ, grow on iron poor medium, and grow as a mold at 28°C. The vma1::HPH mutant was avirulent in a mouse model of histoplasmosis, whereas the vma1/VMA1 strain was as pathogenic as WT yeasts. These studies demonstrate the importance of V-ATPase function in the pathogenicity of H. capsulatum, in iron homeostasis, and in fungal dimorphism. Introduction Histoplasma capsulatum is a facultative intracellular pathogen endemic to the Ohio and Mississippi river valley. Typically H. capsulatum causes asymptomatic infections or mild influenza-like illnesses in immunocompetent hosts. In rare cases, immunocompetent individuals that inhale a large inoculum of the saphrophytic conidia develop potentially lethal disseminated infections. In contrast, H. capsulatum infection of immunocompromised hosts causes serious morbidity, and often progresses into a life threatening disseminated disease in individuals with AIDS, transplant recipients, and patients receiving corticosteroids or anti-TNFα therapy (Wheat et al., 1982)(Wheat et al., 1983)(Antinori et al., 2006)(de Francesco Daher et al., 2006)(Wood et al., 2003)(Jain et al., 2006). After an individual inhales H. capsulatum conidia, the conidia are phagocytosed by alveolar macrophages (Mϕ), convert into the pathogenic yeast phase, and then the yeasts replicate within a modified phagosome. Activation of T-cell mediated immunity is required to restrict fungal proliferation and clear the infection (Newman, 2001). Survival and replication of H. capsulatum yeasts within Mϕ is essential for the pathogenesis of histoplasmosis. Upon ingestion by Mϕ, yeasts must make new proteins, rapidly modify the phagosomal environment, and obtain nutrients, particularly iron, for intracellular survival (Newman et al., 1992)(Newman et al., 1994). In human Mϕ, H. capsulatum yeasts inhibit phagolysosomal fusion (PL-fusion) and regulate intraphagosomal pH as part of their survival strategy (Newman et al., 2006). To date, three genes or factors have been identified that play a role in the virulence of H. capsulatum, but the mechanism(s) by which they work are unclear. These are CBP1 that encodes for a calcium-binding protein (Sebghati et al., 2000), the yeast phase-specific cell wall polysaccharide α-(1,3)-glucan (Rappleye et al., 2004), and the yeast phase-specific gene YPS3 that encodes for a cell surface and secreted protein (Bohse and Woods, 2007). Although, the reverse genetics approach is useful when promising virulence genes have been identified, gene targeting in H. capsulatum is tedious, and the deletion of a single gene does not always result in a clear phenotype. Recently, the development of an efficient insertional mutation technique for H. capsulatum using Agrobacterium tumefaciens-mediated transformation has made it possible to use a forward genetic screen to identify genes required for a specific phenotype. Characterization of Agrobacterium-mediated transformants in H. capsulatum yeasts demonstrate that approximately 90% have a single unique insertion with no chromosomal rearrangements or deletions (Sullivan et al., 2002). Recently, a forward genetic screen of 50,000 H. capsulatum insertional mutants was used successfully to identify novel genes required for the synthesis of alpha-1,3-glucan (Marion et al., 2006). In the present study, we applied a forward genetic screen using an A. tumefaciens-mediated insertional mutant library of H. capsulatum yeasts to identify genes required for intracellular survival in human Mϕ. Of 2,000 colonies screened, we identified a mutant that was unable to grow in human Mϕ, that had an insertion within the gene encoding for the V-ATPase catalytic subunit A (VMA1). Herein evidence is presented that expression of VMA1 is required for iron homeostasis, yeast to mold transition, intracellular growth in human and murine Mϕ, and virulence in a murine model of pulmonary histoplasmosis. Results Insertional mutagenesis screen To identify gene products required for the intracellular growth of H. capsulatum, we screened approximately 2000 A. tumefaciens-mediated insertional mutant colonies of H. capsulatum for their ability to replicate in human Mϕ. H. capsulatum mutants were grown in 96-well plates for 24 h, diluted 1/20, and approximately 104 yeasts were transferred onto Mϕ monolayers. After 24 h monolayers were visually examined by phase-contrast microscopy to verify the intracellular localization of all yeasts. The monolayers then were cultured for 10-14 days, and the monolayers were monitored for the presence of extracellular yeasts. We identified eight H. capsulatum insertional mutants that were unable to grow in Mϕ in the initial screen. These colonies were re-screened for intracellular growth in human Mϕ. One colony, designated 3d1, demonstrated no visible growth within human Mϕ after two weeks, while 6 colonies showed some growth within Mϕ, but the monolayers still remained intact. These results remained consistent after a third round of screening. TAIL-PCR then was used to identify the disrupted gene in the H. capsulatum mutant deficient for intracellular growth in Mϕ. The mutant had an insertion within the V-ATPase catalytic subunit A, VMA1 (Fig 1B
vma1::HPH mutant yeasts are unable to convert to a mold One of the characteristics of vma mutants is that they have severe developmental defects. Fungal vma mutants that exhibit this phenotype include Saccharomyces cerevisiae (Enyenihi and Saunders, 2003), Neurospora crassa (Bowman et al., 2000), Candida albicans (Poltermann et al., 2005), and Ashbya gossypii (Forster et al., 1999). To determine if the developmental transition of yeast to mold was affected in H. capsulatum vma1 mutants, yeasts were streaked on HMM plates at pH 5.5 or 7.5, and cultured for 14 days at 28°C. At a pH of 7.5, the vma1::HPH mutant was unable to form mycelia at 28°C, whereas the wild type (WT) and vma1/VMA1 strains formed mycelia normally (Fig 3
vma1::HPH mutants do not grow on iron limited medium Vacuolar acidification has been implicated in iron acquisition, storage, and homeostasis. For example, the S. cerevisiae V-ATPase knockout is unable to grow on iron limited media (Bode et al., 1995). As acquisition of iron is essential for the intracellular survival and growth of H. capsulatum in Mϕ (Newman et al., 1994)(Newman et al., 1995), we sought to determine if iron acquisition or usage is disrupted in H. capsulatum vma1::HPH mutants. WT, vma1::HPH, and vma1/VMA1 strains were streaked onto HMM plates containing 5 :M apotransferrin (HMM/Apotf), and cultured for 10-14 days at 37°C. vma1::HPH mutant yeasts were unable to grow on the iron limited media, while WT and vma1/VMA1 yeasts grew normally (Fig 4, bottom panels
At pH 7.5, two molecules of ferric iron are tightly bound to transferrin (Princiotto and Zapolski, 1975), whereas at pH 6.5 transferrin only is half-saturated. Therefore, we sought to determine if the vma1 mutant would grow on HMM/Apotf medium at pH 6.5. The data in Fig 5A
The ability of vma1::HPH mutants to grow on iron deficient medium at pH 6.5 suggests that the mutant can obtain and utilize free iron, but not iron bound to transferrin. In S. cerevisiae, V-ATPase activity is required for loading of Cu onto the FET3 protein, and for the function of the FET3/FTR1 high affinity iron uptake pathway. However, the genome of the G217B strain of H. capsulatum does not contain the FET3 or FTR1 genes (results of BLAST search of the H. capsulatum Genome Project, Washington Univ., St. Louis, MO). However, H. capsulatum has other iron acquisition systems that might be disrupted in vma1 mutant yeasts. Therefore, we next sought to determine if WT yeasts might secrete a component(s) that would restore the growth of vma1::HPH mutant yeasts on iron restricted medium. vma1::HPH mutant yeasts were spread onto a HMM/Apotf plate and WT yeasts were spotted onto the center of the plate. Figure 5C H. capsulatum yeasts secrete hydroxamate siderophores under iron limited conditions (Howard et al., 2000), and H. capsulatum yeasts are able to chelate iron from holotransferrin (Timmerman and Woods, 1999). Therefore, we hypothesized that WT yeasts might secrete siderophores to complement the growth of vma1::HPH mutants. To determine if siderophores would complement the growth of vma1::HPH mutants under iron poor conditions, vma1::HPH mutant yeasts were spread onto HMM/Apotf plates, and rhodotorulic acid was spotted onto the edge of the plate. In the presence of rhodotorulic acid the vma1::HPH mutants grew normally (Fig 5D We then sought to determine if vma1::HPH yeasts were deficient in siderophore synthesis. WT and mutant yeasts first were grown in iron replete HMM media to mid log phase. The yeasts were harvested, resuspended to 5 × 107/ml in RPMI (without phenolphthalein) containing 1 μM apotransferrin and 18 g/l of glucose, and then cultured for an additional 7 days. Supernatant was harvested and then tested in the Atkin's Assay (Atkin et al., 1970)(Payne, 1994). Remarkably, vma1::HPH mutant yeasts produced the same amount of siderophores as the WT yeasts (331 μM for WT yeasts and 337 μM for vma1::HPH mutant yeasts; mean of three experiments). To confirm that vma1::HPH mutants produced siderophores, the supernates were tested for their ability to stimulate the growth of Microbacteria flavescens JG-9 (Payne, 1994). As shown in the top panel of Fig 6
Treatment of WT G217B yeasts with bafilomycin recapitulates the vma1 mutant phenotype Bafilomycin A is a specific inhibitor of V-ATPases (Bowman et al., 1988). We hypothesized, therefore, that co-culture of WT yeasts with bafilomycin would mimick the vma1::HPH mutant phenotype. To test this hypothesis, WT yeasts were streaked onto either standard HMM plates, or HMM plates containing 5 μM apotransferrin. The plates also were prepared with and without various concentrations of bafilomycin. On standard HMM plates, 5 μM bafilomycin partially inhibited the growth of WT yeasts, and 30 μM bafilomycin almost completely inhibited the growth of yeasts (Fig 7, top panel
Free iron only partially restores the growth of vma1::HPH mutants in Mϕ Our initial phenotypic screen demonstrated that vma1::HPH mutants do not replicate in human Mϕ. Since the mutant yeasts do not grow under iron poor conditions, and iron acquisition is an absolute necessity for H. capsulatum to survive and multiply in Mϕ (Newman et al., 1994)(Newman et al., 1995), we next sought to determine if the inability to grow in Mϕ could be reversed by the addition of exogenous iron. For these experiments, both holotransferrin and FeNTA were used as a source of iron. However, only the data with FeNTA is shown as the holotransferrin did not enhance the growth of the vma1 mutant. As shown in figure 8
PL-fusion occurs in Mϕ that have ingested vma1::HPH mutant yeasts H. capsulatum yeasts inhibit PL-fusion in human Mϕ as part of their strategy for intracellular survival (Newman et al., 2006). As vma1 mutant yeasts were unable to grow in human Mϕ, we hypothesized that these mutants would not inhibit PL-fusion. Therefore, we quantified PL-fusion in Mϕ that had phagocytosed WT or vma1::HPH mutant yeasts using LysoTracker Red (Newman et al., 2006). After 2 and 4 h, Mϕ that had ingested vma1::HPH yeasts demonstrated 58% and 64% phagolysosomal fusion, respectively (mean of two experiments). Mϕ that had ingested WT yeasts demonstrated only 5% PL-fusion fusion at both time points. Pathogenicity of vma1 mutant in a murine model of histoplasmosis Finally, we sought to determine if vma1::HPH mutants were pathogenic in a murine model of histoplasmosis. In the first experiment, a sublethal inoculum of WT, vma1::HPH, and vma1/VMA1 yeasts were instilled intranasally into mice, and cfu were quantified in the lung and spleen at one week post-infection. The data in figure 9
Discussion Identifying the genes and gene products that promote the intracellular survival of H. capsulatum in Mϕ is essential to understanding the pathogenesis of histoplasmosis. In the present study, a forward genetics approach, A. tumefaciens-mediated transformation, was used to identify genes required for the intracellular survival of H. capsulatum strain G217B in human Mϕ. A vma1 insertional mutant was identified that did not replicate in Mϕ. Additional screening of transformants has identified other genes that are required for intracellular growth in Mϕ. For the 3d1 mutant that was used in the present studies, it is unknown why an insertion in the 3′ UTR should result in the loss of VMA1 gene expression. Most likely this area of the 3′ UTR contains a regulatory sequence that is critical for VMA1 transcription. Although the 3H-leucine assay for intracellular growth only quantifies fungistasis, the fact that no yeast growth was observed after two weeks in culture with Mϕ, and that PL-fusion occurred in Mϕ containing the vma1 mutant, suggests not only that growth of the yeasts was inhibited, but that a majority of the yeasts were killed. The lack of VMA1 expression in the mutant probably indirectly permits PL-fusion to occur. Thus, iron homeostasis and other metabolic processes are disrupted in the vma1 mutant, and this may affect the ability of the yeasts to produce element(s) that are responsible for inhibiting PL-fusion. Alternatively, PL-fusion may simply have occurred after the yeasts had died or become metabolically inactive. The vma1 mutant also appeared to be killed upon intranasal infection of mice. Thus, one week after infection, vma1 mutant yeasts could not be cultured from either the lung or the spleen, suggesting that these organs were sterile. The one caveat here is that our limit of detection for the culture of H. capsulatum yeasts is about 100. At the very least, it is clear that the vma1 mutant is avirulent in a murine model of pulmonary histoplasmosis. Eukaryotic V-ATPases are proton pumps, and in fungi and most other eukaryotic cells their primary role is the ATP-driven transport of protons from the cytosol into acidic organelles. These acidic organelles include lysosomes, early and late endosomes, and the late golgi apparatus (Mellman et al., 1986). Organelle acidification appears to be involved in protein sorting in biosynthetic and endocytic pathways, proteolytic activation of zymogen precursors, and transmembrane transport of viral contents and toxins (Mellman et al., 1986)(Stevens and Forgac, 1997)(Nishi and Forgac, 2002). In plants and fungi, the lysosome-like vacuole is involved in the storage of metabolic building blocks, calcium and metal ion homeostasis, and osmotic control (Klionsky et al., 1990), and vacuolar acidification is critical for these functions. V-ATPases are multi-subunit enzymes composed of a peripheral complex, V1 , attached to a membrane-bound complex, V0 (Nishi and Forgac, 2002). The V1 sector contains three copies of the catalytic subunit A, and, in the present study, it is the gene for this subunit that was disrupted by the insertion of the HPH gene. Several interesting yeast phenotypes have been described that arise from the loss of V-ATPase function. In S. cerevisiae, the loss of V-ATPase function leads to a pH-dependent lethality in which mutants can not grow at pH 7 or above, but are able to grow at pH 5.0-5.5 (Nelson and Nelson, 1990). Other fungi, including N. crassa, C. albicans, and S. pombe also show a pH-dependent growth phenotype upon disruption of V-ATPase activity (Bowman et al., 2000)(Poltermann et al., 2005)(Iwaki et al., 2004). In standard HMM media the H. capsulatum vma1 mutant also demonstrated a pH-dependent growth phenotype. However, this phenotype did not appear to be as severe as reported for other fungi. Thus, the growth rate of vma1::HPH was only modestly effected at pH 7.5, and was normal at pH 6.5 and 5.5. Another characteristic of S. cerevisiae vma mutants is that they have severe defects in sporulation and germination (Enyenihi and Saunders, 2003), but the germination defect can be suppressed at low pH. Other fungal mutants with defects in V-ATPase function that demonstrate aberrant hyphal growth include N. crassa, A. nidulans, and C. albicans (Bowman et al., 2000) (Melin et al., 2004)(Poltermann et al., 2005). Similarly, the H. capsulatum vma1 mutant also demonstrated an inability to produce hyphae when grown at 28°C, but this was not reversed by culturing the mutant yeasts at pH 5.5. A third characteristic of yeast vma mutants is that they are defective in many aspects of metal ion homeostasis (Eide et al., 2005). Some of these defects may be caused an inability to store and detoxify metal ions (Eide et al., 1993), whereas other defects are more complex. Of particular interest in regards to the pathogenesis of H. capsulatum is that vacuoles (that contain V-ATPases) in S. cerevisiae are known to be involved in iron storage and metabolism, and protect the yeasts from the oxidative effects of iron (Eide et al., 1993)(Li et al., 2001). S. cerevisiae yeasts deficient in V-ATPase activity are disrupted in iron acquisition due to improper loading of copper onto the FET3 multicopper oxidase (Davis-Kaplan et al., 2006). Although, the G217B strain of H. capsulatum does not contain the FET3/FTR1 iron capture pathway (results of BLAST search of the H. capsulatum Genome Project, Washington Univ., St. Louis, MO), vma1::HPH mutant yeasts were unable to grow on iron poor medium, demonstrating that the H. capsulatum V-ATPase is involved in iron homeostasis. This idea was reinforced by the demonstration that bafilomycin, an inhibitor of the V-ATPase (Bowman et al., 1988), partially blocked the growth of WT G217B on iron replete medium, and completely blocked the growth of WT yeasts on iron poor medium. Thus, treatment of WT yeasts with bafilomycin recapitulated the vma1::HPH mutant phenotype. A link between iron homeostasis and the V-ATPase also has been observed in A. nidulans. In this fungus sidC is required for the synthesis of the iron storage siderophore, ferricrocin, and disruption of sidC results in a phenotype similar to an A. nidulans V-ATPase knockout (Eisendle et al., 2003; Melin et al., 2004). The inability of the vma1::HPH mutants to grow on iron poor medium could be reversed by the simultaneous presence of WT yeasts, or the addition of the siderophore rhodotorulic acid. A logical interpretation of this data is that the vma1 mutant is defective in siderophore production, and WT yeasts enhanced mutant growth by secreting siderophores into the medium. To our surprise, however, under iron poor conditions the vma1::HPH mutant was able to synthesize and secrete siderophores. Thus, we hypothesize that under iron restrictive conditions, the vma1 mutant is able to produce siderophores, but is unable to produce an additional molecule(s) that is required for iron acquisition and/or usage. Although the vma1 mutant makes siderophores, it is unclear if the mutant still is unable to take up iron, or whether it is unable to use iron. Experiments with radiolabeled iron should address this question. In contrast, the addition of exogenous free ferric to vma1::HPH mutant-infected Mϕ only partially restored intracellular growth, but the additional growth was miniscule compared to the intracellular growth of WT or vma1/VMA1 yeasts. As human Mϕ produce H2O2 upon ingestion of H. capsulatum yeasts (Bullock and Wright, 1987), thistoxic oxygen radical probably contributed to the demise of the vma1 mutant. Supporting this idea is the known sensitivity to oxidant stress of yeast mutants lacking a functional V-ATPase (Thorpe et al., 2004)(Milgrom et al., 2007). As numerous physiological processes depend on the activity of V-ATPases, drugs that specifically target fungal V-ATPase may serve as a new class of drugs for treatment. Currently, three classes of natural products act as specific and potent inhibitors of V-ATPases. The macrocyclic lactones, bafilomycin and concanamycin inhibit eukaryotic V-ATPases from animals, plants and fungi. The benzolactone enamides, including salicylihalamides and lobatamides preferentially inhibit V-ATPases from mammalian sources (Bowman and Bowman, 2005). The recently discovered chondropsins show preference for the N. crassa V-ATPase (Bowman et al., 2003). Thus, chondropsins could lead to novel anti-fungal agents (Bowman and Bowman, 2005). Experimental Procedures Reagents Apotransferrin, holotransferrin, nitriloacetate, ferric chloride, and gentamicin were purchased from Sigma-Aldrich (St. Louis, MO). Rhodotorulic acid, cefotaxime, hygromycin, HAMS F12, and RPMI 1640 were purchased from Fisher Scientific (Hampton, NH). Bafilomycin was a generous gift from K. Altendorf (Univeristat Osnabruck, Osnabruck, Germany). Iron nitriloacetate (FeNTA) and its control, NTA, were prepared fresh for each experiment as described previously (Newman et al., 1994). NTA was prepared in distilled water and mixed 1:1 with ferric chloride in 1 N HCl to generate FeNTA. The pH of the solution was adjusted to 7.0 with 1 N NaOH. Yeasts H. capsulatum strains G217B, G217B vma1 mutants, and G217B vma1/VMA1 were maintained as previously described (Newman et al., 1990). For experiments, yeasts were grown in Histoplasma Mϕ medium (HMM) (Klimpel and Goldman, 1987) at 37°C with orbital shaking at 150 rpm. After 48 h, yeast were harvested by centrifugation, washed three times with HBSS containing 20 mM Hepes and 10 μg/ml of gentamicin (HBSSh), and resuspended to 30 ml in HBSSh. Large clumps of yeasts were removed by centrifugation at 200 × g for 5 min at 4°C. The top 5 ml was removed, and the suspension was standardized to 1 × 105/ml in RPMI 1640 containing 5% heat-inactivated FCS and 10 μg/ml of gentamicin. Agrobacterium tumefaciens-mediated transformation A. tumefaciens transformed with the Ti plasmid and the pCB301-HYG binary vector plasmid (Fig 1A Phenotypic screen A. tumefaciens transformed H. capsulatum colonies were picked with sterile toothpicks and were inoculated into 200 μl of RPMI 1640 in flat bottom 96 well plates. After 24 h of culture at 37°C, the wells were resuspended and diluted 1:20 by transferring 10 μl of yeasts into a new 96 well plate with 200 μl of RPMI 1640 per well. Ten μl of yeasts then were used to inoculate human ϕ monolayers. ϕ were incubated at 37°C in 5% CO2 for up to 10 days and screened by phase-contrast microscopy for wells in which the yeasts did not lyse the ϕ monolayer. Generally, after 4-5 days of culture, most monolayers had been destroyed by replicating yeasts. H. capsulatum colonies negative for growth during this initial screen were streaked out on solid HMM media and a single colony was re-screened. Mutants that did not replicate in ϕ after three rounds of screening were selected for further study. TAIL PCR To identify the disrupted gene, thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) was performed as previously described (Singer and Burke, 2003). A DNA miniprep from a single H. capsulatum colony was used to prepare the DNA (Tian and Shearer, 2002). The mixture AD1,2,3,6 and LB1,2,3 primers were used for the PCR reactions. An agarose gel was used to verify the fidelity of the PCR reactions. The tertiary TAIL PCR product was cloned into pCR2.1 TOPO/TA (Invitrogen, Carlsbad, CA) and sequenced using M13F and M13R primers. The resulting sequence was BLAST searched against the H. capsulatum G217B genomic database (Washington Univ., St. Louis, MO). Complementation of the vma1::HPH mutant The H. capsulatum VMA1 gene was amplified by PCR using the sense primer, VMAS' GAGACCTGCAGAAAGAGAAGGAATGAAA, and the antisense primer VMAA' CAAAAGCGGCGAGAAGCAAGC with a high fidelity polymerase (Phusion; Finnzymes, Findland). The sequence of the PCR product was from 1.5 Kb upstream of the coding region to 1.5Kb downstream of the coding region. Thus, the insert contained the endogenous promoter and terminator for the VMA1 gene. The PCR product was cloned into pCR8/GW/TOPO TA (Invitrogen, Carlsbad, CA), and verified by restriction digestion, and sequencing. The insert then was cloned into the R1-R2 site of pCB301-bleo-R1-R2 using the LR Clonase enzyme (Invitrogen, Carlsbad, CA). The gateway vector pCB301-bleo-R1-R2 was generated by the insertion of the Gateway RfB cassette, a bleo resistance cassette containing the Aspergillus nidulans GPD regulator sequences, the Streptoalloteichus hindustanus BLE gene, and the A. nidulans TrpC terminator sequence, into the pCB301 backbone. The resulting pCB301-bleo-VMA1 plasmid was transformed into A. tumefaciens by electroporation, and then transformed into H. capsulatum as previously described. Complementation was verified by RT-PCR (Fig 1C RT-PCR H. capsulatum yeasts were grown in HMM media for 48 h and RNA was extracted from a pellet of 1 × 108 yeasts using the Master Pure Yeast RNA purification system (Epicentre, Madison, WI). cDNA was made from 1μg of RNA using random hexamer primers with the Superscript First Strand for RT-PCR system (Invitrogen). The cDNA was amplified by PCR using the VMA1 primers rtVMA-1S, GTGCGTTTGGTTGCGGGAA and rtVMA-1A, GCATCTCTCCCAA-ACGTCCTGA, and the gapdh primers rtGAPDHS, ATTGGGCGTATTGTCTTCC, and rtGAPDHA, TTGAGCATGTAGGCAGCATA. The PCR products were analyzed by gel electrophoresis on a 2% agarose gel. Human and Murine Mϕ Human mononuclear cells were purified from blood obtained from the Hoxworth Blood Center, Cincinnati OH, by dextran sedimentation and Ficoll-Hypaque (LKB Biotechnology Inc., Piscataway, NJ) centrifugation as previously described (Newman et al., 1980). The mononuclear cells were washed in HBSSh and suspended to 5 × 106/ml in HBSSh containing 0.1% autologous serum. One-tenth ml aliquots of cells were plated in 96-well tissue culture plates, and the monocytes were allowed to adhere for 1 h at 37°C in 5% CO2. Adherent monocytes were washed twice with HBSS to remove lymphocytes, and then were cultured for 7 days in M199 containing 10% autologous serum and 10 μg/ml of gentamicin to allow for differentiation into Mϕ. Alternatively, monocytes were separated from lymphocytes using an EasySep CD14 positive selection kit (Stem Cell Technologies, Vancouver, BC, Canada), following the manufacturer=s instructions. Mϕ were obtained by culture of monocytes at 1 × 106/ml in Teflon beakers with RPMI 1640 containing 15% pooled human serum, and 10 μg/ml gentamicin. Mϕ were harvested after 5-7 days in culture. Mouse peritoneal Mϕ (PM) were harvested from 6-10 week old C57BL/6 mice (Jackson Laboratory, Bar Harbor, ME) by peritoneal lavage. Ten ml of HBSS was injected into the peritoneal cavity of euthanized mice with an 18-ga needle and the peritoneal fluid was withdrawn. Cells were standardized to 1 × 106 /ml in RPMI 1640 containing 10% FCS and 10 μg/ml gentamicin and 0.1-ml volumes of cells were adhered in 96-well plates and cultured for 24 h before use. Quantitation of the intracellular growth of H. capsulatum yeasts in Mϕ The intracellular replication of H. capsulatum yeasts in Mϕ was quantified by 3H-leucine incorporation as previously described (Newman and Gootee, 1992). Culture media was removed from Mϕ monolayers and 100 μl of H. capsulatum yeasts (1×105/ml) in RPMI 1640 containing 5% FCS and 10 μg/ml gentamicin were added to each well. The yeasts and Mϕ were cultured for 24 h at 37°C. The plates then were centrifuged at 1500 rpm, the supernatant was carefully aspirated through a 27-ga needle, and 50 μl of 3H-leucine (153 Ci/mmol; New England Nuclear, Boston, MA) in sterile water (1.0 μCi) and 5 μl of 10X yeast nitrogen broth (Difco Laboratories, Detroit, MI) were added to each well. The plates then were incubated for an additional 24 h at 37°C. Finally, 50 μl of L-leucine (10 mg/ml) and 50 μl of sodium hypochlorite were added to each well, and the contents of the wells were harvested onto glass fiber filters using an automated harvester (Skatron, Sterling, VA). The filters were placed into scintillation vials, 1 ml of scintillation fluid was added, and the vials were counted in a Beckman LS 7000 liquid scintillation spectrometer (Beckman Instruments, Inc., Fullerton, CA). Results are presented as the mean cpm ∀ SEM. All experimental points were quantified in triplicate and at least three independent experiments were performed. Quantitation of Phagolysosomal Fusion (PL-fusion) Teflon beaker-cultured Mϕ were adhered in 24-well tissue culture plates to 12 mm round glass coverslips. Monolayers then were incubated with 200 nm LysoTracker Red (Invitrogen-Molecular Probes, Eugene, OR) in RPMI 1640 containing 5% FCS for 2 h to label lysosomes. After two washes, the Mϕ were infected with viable H. capsulatum yeasts (2 × 106) for 1 h at 37°C. After an additional two washes, the Mϕ were cultured in 200 nm LysoTracker for an additional 2 h. After washing, the monolayers were fixed in 3.75% paraformaldehyde for 20 min at 25°C. The Mϕ then were covered in Dulbecco's PBS containing 5% glucose. Coverslips were mounted cell-side-down in 90% glycerol in PBS onto microscope slides, and one-hundred yeast-containing phagosomes were counted and scored for lysosomal fusion or no fusion (Newman et al., 2006). Detection of siderophores H. capsulatum yeasts were grown to mid-log phase in HMM, washed once with HBSS, and then resuspended to 5 × 107/ml in 50 ml RPMI (without phenolphthalein) supplemented with 18 g/l of dextrose and 1 μM of apotransferrin. The cultures then were incubated at 37°C with orbital shaking at 150 rpm for 7 days. The yeasts were centrifuged, and the supernatants were filter sterilized. For determination of siderophore production by the Atkin's Assay (Atkin et al., 1970), 0.5 ml of culture supernatant was mixed with ferric perchlorate agent. After 5 min at room temperature, the absorbance was quantified at 480 nm. Uninoculated RPMI medium served as the blank. A standard curve with ferrichrome c was used to calculate the μM of siderophores released by the yeasts. The standard curve was linear (R2 = 0.9994) from 10 μM to 727 μM. Alternatively, Microbacterium flavescens JG-9 (ATCC 25091) was maintained on ATCC 424 Arthobacter medium containing (per liter) 10 g of peptone, 10 g of yeast extract, 2 g of K2HPO4, 20 μg of rhodotorulic acid (34nM), and 15 g of bacto agar. The assay medium was same medium used to maintain growth, but rhodotorulic acid was omitted and a bacterial suspension was added to the molten medium. Approximately 5 to 10 ml/liter of a bacterial suspension were added until the medium just started to turn cloudy. Wells were cut in the plates using the end of a sterile glass pipette, 50 μlof Histoplasma culture supernatant was placed in each well, and the plates were incubated at 30°C for 2 days (Payne, 1994). Murine Model of Histoplasmosis To produce infection in naïve mice, six to eight-week old male C57BL/6 mice were anesthetized by isofluorane and infected intranasally with 2 × 106 (sublethal) or 2 × 107(lethal) yeasts in a 30-μl volume of HBSS. Animals were sacrificed on day 7 and lungs and spleens were homogenized in HBSS, serially diluted, and dispensed (100 μl) onto HMM plates containing gentamicin. Plates were incubated at 37°C in a humidified incubator, for 7 to 10 days before counting cfu per organ. Differences in fungal burden in organs were analyzed by using the Wilcoxon rank sum test. Animals receiving a lethal dose of H. capsulatum were monitored twice daily. Mice with ruffled fur, labored breathing, and inactivity were euthanized. Differences in survival were analyzed by the log-rank test. Acknowledgements This work was supported by NIH Grants AI-49358 and AI-61298 from the National Institute of Allergy and Infectious Diseases. References
|
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||||
Ann Intern Med. 1982 Feb; 96(2):159-63.
[Ann Intern Med. 1982]Arch Intern Med. 1983 Apr; 143(4):703-7.
[Arch Intern Med. 1983]Medicine (Baltimore). 2006 Jan; 85(1):22-36.
[Medicine (Baltimore). 2006]Am J Trop Med Hyg. 2006 Apr; 74(4):600-3.
[Am J Trop Med Hyg. 2006]Am J Respir Crit Care Med. 2003 May 1; 167(9):1279-82.
[Am J Respir Crit Care Med. 2003]J Immunol. 1992 Jul 15; 149(2):574-80.
[J Immunol. 1992]J Clin Invest. 1994 Apr; 93(4):1422-9.
[J Clin Invest. 1994]J Immunol. 2006 Feb 1; 176(3):1806-13.
[J Immunol. 2006]Science. 2000 Nov 17; 290(5495):1368-72.
[Science. 2000]Mol Microbiol. 2004 Jul; 53(1):153-65.
[Mol Microbiol. 2004]Eukaryot Cell. 2002 Dec; 1(6):895-905.
[Eukaryot Cell. 2002]Mol Microbiol. 2006 Nov; 62(4):970-83.
[Mol Microbiol. 2006]Genetics. 2003 Jan; 163(1):47-54.
[Genetics. 2003]J Biol Chem. 2000 Jan 7; 275(1):167-76.
[J Biol Chem. 2000]Microbiology. 2005 May; 151(Pt 5):1645-55.
[Microbiology. 2005]J Biol Chem. 1999 Apr 2; 274(14):9442-8.
[J Biol Chem. 1999]Eur J Biochem. 1995 Mar 1; 228(2):337-42.
[Eur J Biochem. 1995]J Clin Invest. 1994 Apr; 93(4):1422-9.
[J Clin Invest. 1994]Antimicrob Agents Chemother. 1995 Aug; 39(8):1824-9.
[Antimicrob Agents Chemother. 1995]Nature. 1975 May 1; 255(5503):87-8.
[Nature. 1975]Infect Immun. 2000 Apr; 68(4):2338-43.
[Infect Immun. 2000]Infect Immun. 1999 Dec; 67(12):6403-8.
[Infect Immun. 1999]J Bacteriol. 1970 Sep; 103(3):722-33.
[J Bacteriol. 1970]Methods Enzymol. 1994; 235():329-44.
[Methods Enzymol. 1994]Methods Enzymol. 1994; 235():329-44.
[Methods Enzymol. 1994]Proc Natl Acad Sci U S A. 1988 Nov; 85(21):7972-6.
[Proc Natl Acad Sci U S A. 1988]J Clin Invest. 1994 Apr; 93(4):1422-9.
[J Clin Invest. 1994]Antimicrob Agents Chemother. 1995 Aug; 39(8):1824-9.
[Antimicrob Agents Chemother. 1995]J Immunol. 2006 Feb 1; 176(3):1806-13.
[J Immunol. 2006]Annu Rev Biochem. 1986; 55():663-700.
[Annu Rev Biochem. 1986]Annu Rev Cell Dev Biol. 1997; 13():779-808.
[Annu Rev Cell Dev Biol. 1997]Nat Rev Mol Cell Biol. 2002 Feb; 3(2):94-103.
[Nat Rev Mol Cell Biol. 2002]Microbiol Rev. 1990 Sep; 54(3):266-92.
[Microbiol Rev. 1990]Nat Rev Mol Cell Biol. 2002 Feb; 3(2):94-103.
[Nat Rev Mol Cell Biol. 2002]Proc Natl Acad Sci U S A. 1990 May; 87(9):3503-7.
[Proc Natl Acad Sci U S A. 1990]J Biol Chem. 2000 Jan 7; 275(1):167-76.
[J Biol Chem. 2000]Microbiology. 2005 May; 151(Pt 5):1645-55.
[Microbiology. 2005]Mol Genet Genomics. 2004 Mar; 271(2):197-207.
[Mol Genet Genomics. 2004]Genetics. 2003 Jan; 163(1):47-54.
[Genetics. 2003]J Biol Chem. 2000 Jan 7; 275(1):167-76.
[J Biol Chem. 2000]Microbiology. 2004 Mar; 150(Pt 3):743-8.
[Microbiology. 2004]Microbiology. 2005 May; 151(Pt 5):1645-55.
[Microbiology. 2005]Genome Biol. 2005; 6(9):R77.
[Genome Biol. 2005]Mol Gen Genet. 1993 Nov; 241(3-4):447-56.
[Mol Gen Genet. 1993]J Biol Chem. 2001 Aug 3; 276(31):29515-9.
[J Biol Chem. 2001]J Biol Chem. 2006 Oct 20; 281(42):32025-35.
[J Biol Chem. 2006]Proc Natl Acad Sci U S A. 1988 Nov; 85(21):7972-6.
[Proc Natl Acad Sci U S A. 1988]J Exp Med. 1987 Jan 1; 165(1):195-210.
[J Exp Med. 1987]Proc Natl Acad Sci U S A. 2004 Apr 27; 101(17):6564-9.
[Proc Natl Acad Sci U S A. 2004]J Biol Chem. 2007 Mar 9; 282(10):7125-36.
[J Biol Chem. 2007]J Bioenerg Biomembr. 2005 Dec; 37(6):431-5.
[J Bioenerg Biomembr. 2005]J Biol Chem. 2003 Nov 7; 278(45):44147-52.
[J Biol Chem. 2003]J Clin Invest. 1994 Apr; 93(4):1422-9.
[J Clin Invest. 1994]J Clin Invest. 1990 Jan; 85(1):223-30.
[J Clin Invest. 1990]Infect Immun. 1987 Mar; 55(3):528-33.
[Infect Immun. 1987]Eukaryot Cell. 2002 Dec; 1(6):895-905.
[Eukaryot Cell. 2002]Methods Mol Biol. 2003; 236():241-72.
[Methods Mol Biol. 2003]Eukaryot Cell. 2002 Apr; 1(2):249-56.
[Eukaryot Cell. 2002]J Immunol. 1980 Nov; 125(5):2236-44.
[J Immunol. 1980]Infect Immun. 1992 Nov; 60(11):4593-7.
[Infect Immun. 1992]J Immunol. 2006 Feb 1; 176(3):1806-13.
[J Immunol. 2006]J Bacteriol. 1970 Sep; 103(3):722-33.
[J Bacteriol. 1970]Methods Enzymol. 1994; 235():329-44.
[Methods Enzymol. 1994]