pmc logo image
Logo of nihpaNIHPA bannerabout author manuscriptssubmit a manuscript
Journal List > NIHPA Author Manuscripts

Formats:
Dev Dyn. Author manuscript; available in PMC 2008 October 3.
Published in final edited form as:
PMCID: PMC2559871
NIHMSID: NIHMS70025
Copyright notice and Disclaimer
Maintenance of undifferentiated mouse embryonic stem cells in suspension by the serum- and feeder-free defined culture condition
Yukiiko Tsuji,1,3 Naoko Yoshimura,1,3 Hitomi Aoki,1 Alexei A. Sharov,2 Minoru S.H. Ko,2 Tsutomu Motohashi,1 and Takahiro Kunisada1
1Department of Tissue and Organ Development Regeneration and Advanced Medical Science, Gifu University Graduate School of Medicine, Gifu City, Gifu 501-1194, Japan
2Developmental Genomics and Aging Section, Laboratory of Genetics, National Institute on Aging, 333 Cassell Drive, Suite 3000, Baltimore, MD 21224, USA
Corresponding Author: Takahiro Kunisada, Ph.D. Gifu University School of Medicine, Gifu City, Gifu 501-1194, Japan. Telephone:+81-58-230-5477; Fax: +81-58-230-6478; e-mail: tkunisad/at/gifu-u.ac.jp
3These authors contributed equally to this work.
Small right arrow pointing to: The publisher's final edited version of this article is available free at Dev Dyn.
Small right arrow pointing to: This article has been corrected. See the correction in volume 238 on page 501.
Abstract
The proven pluripotency of ES cells is expected to allow their therapeutic use for regenerative medicine. We present here a novel suspension culture method that facilitates the proliferation of pluripotent ES cells without feeder cells. The culture medium contains polyvinyl alcohol (PVA), free of either animal-derived or synthetic serum, and contains very low amounts of peptidic or proteinaceous materials, which are favorable for therapeutic use. ES cells showed sustained proliferation in the suspension culture, and their undifferentiated state and pluripotency were experimentally verified. DNA microarray analyses showed a close relationship between the elevated expression of genes related to cell adhesions. We suggest that this suspension culture condition provides a better alternative to the conventional attached cell culture condition, especially for possible therapeutic use, by limiting the exposure of ES cells to feeder cells and animal products.
Keywords: Embryonic stem cell, Suspension culture, Serum-free, Feeder-free, Cell adhesion molecules
Embryonic stem (ES) cells are pluripotent in that they can differentiate into cells of all 3 germ layers, and they also self-renew extensively in culture [Smith et al., 2001; Evans et al., 1981; Martin et al., 1981]. Therefore, their therapeutic potential in regenerative medicine has been suggesteed [Donovan et al., 2001; Prelle et al., 2002]. ES cells are derived from the inner, clonogenicity, a normal karyotype, extencell mass (ICM) of mammalian blastocysts [Evans et al., 1981; Martin et al., 1981; Thomson et al., 1998]. The basic characteristics of ES cells, which include self-renewal, multilineage differentiation, clonogenicity, a normal karyotype, extensive proliferation, and the ability to be frozen and thawed, are all the fundamental properties of early embryonic cells [Smith et al., 2001].
External signaling pathways such as LIF-gp130-STAT3 [Niwa et al., 1998; Matsuda et al., 1999; Raz et al., 1999], BMP-TGF-β -Nodal -Smad [Ying et al., 2003; Ogawa et al., 2007], MAPK-ERK [Burdon et al., 1999], and WNT [Hao et al., 2006; Ogawa et al., 2006] as well as transcription factors Oct3/4 [Niwa et al., 2000], Sox2 [Masui et al., 2007], and Nanog [Mitsui et al., 2003; Chambers et al., 2003] have been reported to play important roles in the self-renewal of mouse ES cells. The interaction of transcription factors including Oct3/4, Sox2 and Nanog seems to form a flexible interactive network to ensure the pluripotency of ES cells [Wang et al., 2006; Ivanova et al.,2006]. Epigenetic modification of the chromatin21 and global control of gene expression [Boyer et al.,2006] are also proposed to regulate their pluripotency to allow the transition from the undifferentiated to the differentiated state [Niwa et al., 2000].
Pluripotent mouse ES cells are usually propagated under complex culture conditions that are poorly defined because they include both growth-inactivated feeder cells and serum. The exposure of ES cells to these components has been a major concern for the potential therapeutic use of ES cells because of their immunogenicity and potential pathogenicity. After the discovery of LIF as a crucial factor produced by the feeder cells, mouse ES cells have been propagated in medium containing serum and LIF without feeder cells on gelatin-coated dishes. Although animal-derived serum was later substituted by synthetic serum [Goldsborough et al., 1988;Ward et al., 2002], synthetic serum products still contain considerable amounts of purified animal-derived proteins. Using ES cells expressing exogenously induced Bcl2, Yamane et al. cultured them in medium containing LIF, insulin, and transferrin as the only peptidic ingredients; and they replaced the abundantly used animal protein albumin with polyvinyl alcohol (PVA) [Yamane et al., 2005]. Still, gelatin-coated dishes were required even in this culture system, and normal ES cell strains could not be maintained for long term under this culture condition using PVA. Remarkable progress on the culture of human ES cells has recently enabled nearly completely defined culture conditions involving the least amount of mitogenic polypeptides; however, a large amount of serum albumin was added, and 4 different matrix proteins were used for coating the culture dish surface [Ludwig et al., 2006].
We describe here a new suspension culture method to propagate pluripotent mouse ES cells of different origins. This method uses culture medium adapted from Yamane et al. [Yamane et al., 2005], which includes the least amount of peptidic materials, and does not require protein-coated dishes. Long-term maintenance of the undifferentiated state and pluripotency of the suspended ES cells were confirmed in several ways. The indispensable function of PVA to maintain sphere-like assembly of ES cells in suspension culture was also indicated. We further obtained data from DNA micro array analysis suggesting roles of cell adhesion molecules for the proliferation of pluripotent ES cells under these rather stringent suspension culture conditions.
Proliferation of ES cells in suspension cultures
Yamane et al. previously reported that ES cells exogenously expressing Bcl2 could be maintained in an undifferentiated state in considerably stringent culture medium containing only insulin, transferrin, and LIF as protein ingredients [Yamane et al., 2005]. In the absence of an adhesive environment such as the surface of culture dishes coated with cell matrix proteins, we found that the ES cell strains tested (D3, E14, and EB5) continued to proliferate under these stringent culture conditions. Soon after the transfer of ES cells prepared under standard adhesive culture conditions with serum to this stringent, suspension culture condition, the cells started to stick to each other and formed cell “clumps” (Fig. 1A-DFigure 1). Although most of these clumps were small at the start of the culture, they gradually increased in size to be recognized as clumps (Fig.1A to CFigure 1). These clumps seemed to fuse to each other during the culture period and formed larger clumps. The upper limit of the size of these ES cell clumps was about 1 mm in diameter (Fig.1DFigure 1). For serial passage, the cells were dissociated by vigorous (or gentle) pipetting before changing the medium. Cells maintained in this suspension culture system continued to grow for over 150 days (Fig. 1EFigure 1). The mean population doubling time of the ES cells in these suspension cultures was 3 to 4 days, roughly twice longer than that under the standard culture conditions.
Figure 1
Figure 1
Figure 1
Proliferation of undifferentiated ES cells in suspension culture
We found PVA to be an important ingredient for the ES-cell suspension cultures. PVA is a synthetic resin formed by saponification of polyvinyl acetate and used as a replacement for serum or albumin. When cells clumps cultured in suspension were transferred to PVA-free medium, single cells detached from the clumps and became attached to the surface of the non-coated dish, as shown in Fig. 1FFigure 1. Large cell clumps also attached to the dish, and individual cells forming a clump migrated out, as shown in Fig. 1GFigure 1. The dendritic shape of the migrating cells indicated the differentiation of ES cells in this PVA-free culture condition, even in the presence of LIF, as confirmed by the absence of alkaline phosphatase activity in the cells that migrated out to form a single cell layer (Fig. 1HFigure 1; note that cells forming clumps were alkaline phosphatase positive). After the transfer to the PVA-free condition, proliferation of the ES cells ceased and differentiation began. Thus, we confirmed that culturing the ES cells in suspension in medium containing very low amounts of proteins allowed the continuous proliferation of ES cells in the presence of PVA and LIF.
Next we tested whether the suspension culture method would allow clonal proliferation of ES cells. Cells separated from a suspension culture passaged 30 times were seeded onto 96-well plates, 1 cell per well containing 100μl medium, by using a cell sorter. In this condition, after observing 500 wells, we never found a single cell clump; and these single cells did not even divide once. When 50 cells were inoculated per well for suspension cultures, again no cell clumps were seen, whereas in this case, 100% of the cells transferred to adhesion cultures formed colonies. By increasing the density of suspension cultures to 500 cells per well, proliferating cell clumps were detected in 90±11 % of the wells. Obviously, the suspension culture condition did not support the clonal expansion of ES cells. While ACTH supported the clonal expansion of undifferentiated ES cells in adhesion culture [Niwa et al., 2000], we could not detect the expansion of the suspension culture started from a single cell by adding 10 μM ACTH (data not shown). It should be noted, however, that suspension-cultured ES cells retained a clonal proliferation capability under the standard (adhesion) growth condition, even after long-term culturing in suspension as described in the next section.
Since relatively large spheric cell clumps are formed in suspension culture, proliferative disadvantages such as a lack of nutrients may affect the viability of the cells inside of the spheric cell masses. However, we did not observe dead cells inside of them after trypan blue staining. Histological section of the spheric cells masses revealed uniformly distributed, round cells without heterogeneous morphology (Fig.1JFigure 1). A cell cycle analysis of the suspension cultured and standard adhesive cultured cells revealed comparable fraction of cells in S-phase, indicating that cells maintained in the suspension culture is proliferating normally as those in the standard adhesive condition (Fig.1.IFigure 1). High and uniform SSEA-1 expression compared to the adherent culture condition was observed in the suspension culture (Fig.1KFigure 1), indicating undifferentiated nature of suspension cultured ES cells.
Undifferentiated state of the ES cells was maintained in suspension cultures
Cells that were cultured in the suspended state were confirmed to be undifferentiated by their expression of alkaline phosphatase (ALP) and gene expression pattern. For both D3 (Fig.2AFigure 2) and E14 (Fig.2CFigure 2), cell clumps formed in the suspension cultures were clearly positive for alkaline phosphatase activity. In the suspension cultures without LIF, ES cells could form the clumps, but their alkaline phosphatase activity was significantly reduced, as shown in Fig. 2BFigure 2. After 2 weeks in LIF-free suspension cultures, differentiated cell populations such as beating muscle cells were observed in the cell clumps, indicating the requirement of LIF to maintain the undifferentiated state of suspension-cultured ES cells. Cells separated from a suspension culture passaged over 30 times in the presence of LIF were seeded 1 cell per well onto 96-well plates and cultured with standard adhesive condition. In this condition, 51% of ES cells (total 96 cells were seeded) formed morphologically undifferentiated colonies expressing alkaline phosphatase (Fig.1DFigure 1) and no differentiated, alkaline phosphatase negative colonies was formed, as comparable to the control experiments in which 29% of the cells cultured in standard condition formed undifferentiated colonies, indicating that undifferentiated state of the ES cells were maintained after prolonged suspension culture.
Figure 2
Figure 2
Figure 2
Differentiation status of suspension-cultured ES cells
The undifferentiated state of suspension-cultured ES cells was verified by the expression of Oct3/4 [Niwa et al., 2000; Masui et al., 2007], Nanog [Mitsui K et al., 2003; Chambers et al., 2003], Eras [Takahashi et al., 2003], and Rex1/Zfp42 [Ben-Shushan et al., 1998] genes, all known to be important for the maintenance of the undifferentiated state of ES cells (Fig. 2EFigure 2). In both D3 and EB5 strains, the expression levels of these genes were comparable between standard adhesion cultures (Fig. 2E lanes 1 and 5Figure 2) and suspension culture (Fig. 2E, lanes 3, 4, and 6Figure 2). This sustained expression of genes required for the undifferentiated status of the ES cells well confirmed the undifferentiated proliferation of ES cells in our suspension culture. As expected, expression of Gata4, Slug(Snail2), and Snail(Snail1), markers for differentiated cell lineages were not detected by RT-PCR (Fig. 2FFigure 2).
Using DNA microarray analysis, we further confirmed the expression level of genes usually highly expressed in undifferentiated ES cells, such as those listed in Fig. 2GFigure 2. The expression levels of these genes under adhesive and suspension culture conditions were virtually comparable. It should be noted that blasticidin S resistant gene was inserted in one of the endogenous Oct3/4 allele in EB5 ES cell line so that the selection with blasticidin allows proliferation of only Oct3/4-expressing undifferentiated cells. The formation of spheric cell masses in the EB5 suspension cultures containing blasticidin S indicates that the cells maintained in suspension culture were mostly in the undifferentiated state. Thus, the suspension culture condition was capable of maintaining the undifferentiated state of ES cells.
Suspension-cultured ES cells are pluripotent for in vitro and in vivo differentiation
To confirm the differentiation potential, we dissociated suspension-cultured cells passaged more than 30 times and cultured them under the conditions necessary to induce melanocyte differentiation [Yamane et al.,1999;Kunisada et al.,2003]. After 14 days, melanocytes appeared in the cultures (Fig. 3A, BFigure 3). Moreover, various cell types such as beating heart muscle cells, neurons, and hematopoietic cells were also found in such cultures (data not shown). The multipotential cell fate of the suspension-cultured ES cells was thus suggested in vitro. Next, we compared the colony-forming abilities of ES cells in conventional adhesion cultures with those in suspension culture. Both the total number of colonies formed (Fig. 3CFigure 3) and the number of colonies containing melanocytes (Fig. 3DFigure 3) were significantly higher in cultures started from suspension-cultured ES cells than that from ES cells in adhesion culture. It is likely that suspension cultured ES are useful as the seeds for in vitro differentiation.
Figure 3
Figure 3
Figure 3
Maintenance of pluripotency of suspension-cultured ES cells
To demonstrate their pluripotency in vivo, we injected cells passaged more than 30 times passaged in suspension culture into blastocysts, which were then transferred into the uterus of pseudopregnant ICR females. E 11.5 embryos obtained showed chimerism in most of their tissues, as shown by the abundant GFP-positive cells derived from GFP-expressing D3 strain [Hirano et al.,2003](Fig.3EFigure 3). Thus, we verified that our suspension culture method could maintain the pluripotency of ES cells.
ES cells in suspension were induced to express genes related to cell adhesion
To elucidate the molecular basis enabling the suspension culture of ES cells, we compared gene expression patterns of the cells under both culture conditions by DNA microarray analysis. Under the suspension culture condition, 136 genes were found to be up-regulated more than 5-fold compared with those under the adhesion culture condition. Likewise, 29 genes were down-regulated in suspension culture (Fig. 4AFigure 4 and Supplementary Tables 1,2). Out of these 136 up-regulated genes and 29 down-regulated genes, 129 (95%) and 24 (98.6%), respectively, have a known function. These genes are summarized in Fig. 4BFigure 4 (the total indicated is 167 genes, not 129, because some genes were classified into more than 1 category) and C, in which the up-regulated ones were classified into the following 6 functional categories: cell adhesion (such as Cadherin 22(Cdh22), Cadherin 11(Cdh11), and Cadherin2(Cdh2), development (e.g., Ephrin b3 and Adducin 2[beta]), organismal physiological process (Aquaporin 4 and Chemokine [c-x-c motif] receptor 4), cell cycle (Cyclin d2), cell organization and biogenesis (Profilin 2), and metabolism (Chst 1) in decreasing order of enrichment score. Down-regulated genes were classified as regulators of metabolism (e.g., Sialophorin), transcription (Doublesex and mab-3 related transcription factor 1), and cellular processes (Myosin if). Interestingly, cell adhesion-related genes were prominently up-regulated as judged by the enrichment score. Expression of the genes with the highest enrichment score (Fig. 4DFigure 4), Integrin beta 8, Cadherin 11, and Procollagen typeIII alpha I in suspension-cultured ES cells were confirmed by RT-PCR (Fig. 4EFigure 4). In considering the fact that trypsinization instead of mechanical separation is necessary for complete separation of suspension-cultured ES cells into single cells, adhesion through cell matrix secreted from ES cells rather than homophilic interaction mediated by cadherin family proteins might be involved in the establishment of ES-cell suspension cultures.
Figure 4
Figure 4
Figure 4
Comparison of expression pattern between suspension and attachment conditions
In this study, we showed that our suspension cultures, which did not require serum or animal-derived product including extracellular matrix proteins to coat the surface of the culture dish, could maintain mouse ES cells for both proliferation and pluripotency. Although we routinely used LIF produced by CHO cells (culture supernatant, added to 0.1 % of the medium), ESGRO (commercially available purified LIF protein; Chemicon International) was also tested and found to be able to maintain ES cells (data not shown). The only animal-derived components used presently were insulin, transferrin, and LIF. The use of the least amount of animal-derived products may well contribute to eliminate the risk of immunogenicity and transmission of viruses by future therapeutic use of ES cell derivatives. Aggregated growth of undifferentiated mouse ES cells was performed by using spinner culture flask-based bioreactor systems [Cormier et al.,2006; Fok et al.,2005]. In these reported suspension cultures, medium containing 15% fetal bovine serum were used and continuous mechanical shear control were necessary to maintain cell proliferation. Recent progress has been made in studies using human ES cells, in which these cells could be successfully maintained in a proliferative and pluripotent state even when the feeder cells and serum were replaced with mostly defined proteins or chemicals [Ludwig et al., 2006; Sato et al., 2004; Xu et al., 2001; Xu et al., 2005; Lu et al., 2006; Pyle et al., 2006; Darr et al., 2006]. However, all of these reported human ES cell cultures used matrix protein-coated dishes and multiple recombinant proteins in addition to a considerable amount of human serum-derived albumin. We adopted the same suspension culture condition described here for human ES cells but it was not successful at present, possibly indicating the different origin of human ES cells from mouse ES cells [Brons et al., 2007]. In any case, the application of our suspension culture system to human ES cells would drastically reduce the amount of animal-derived product and thus might contribute to future application of ES cells to regenerative cell therapy and tissue engineering.
According to the results of the RT-PCR and microarray analysis, the gene networks responsible for the undifferentiated state of ES cells were functional under either culture condition (Fig. 2Figure 2). Elimination of LIF only from suspension cultures induced spontaneous loss of alkaline phosphatase activity, leading to cellular differentiation, suggesting the same signaling network is responsible for the undifferentiated state of suspension-cultured ES cells. Although precise evaluation of the role of PVA added to the suspension culture medium has not been done yet, removal of PVA only from the suspension cultures promptly induced the adhesive changes in the spheric cell masses and loss of alkaline phosphatase activity associated with morphological changes in the ES cells (Fig. 1F to HFigure 1). Considering the fact that genes showing the highest enrichment scores in suspension-cultured ES cells were those classified into the cell-adhesion category, PVA might interrupt adhesion of ES cells to the dish and /or induce genes related to cell-cell adhesion allowing the formation of spheric cell masses. Our data showed that expansion of ES cells under the suspension culture condition required the seeding of at least 500 cells per well. At less than this density, the ES cells did not form cell masses and died soon after seeding, suggesting that the formation of a certain size of cell mass caused by PVA-induced expression of adhesive molecules is a key for the proliferation of undifferentiated ES cells in suspension cultures. Alternatively, a certain concentration of secreted materials from the spheric cell masses might have been required for the initial maintenance of the suspension cultures. Thus, further comparative analysis of the PVA- induced gene expression may uncover new information on the maintenance of the undifferentiated state of ES cells.
We noticed that over 100 genes related to neural differentiation (e.g., Dbx1, Dcx, Efnb3, Astn1, Robo3, Pou3f2) were more highly expressed in the suspension cell culture than in the attached cell cultures in the microarray data. However, we did not observe neuron-like cells in the cultures at 48 hours after the initiation of differentiation from the suspension cultured ES cells, therefore, is not likely that ES cells maintained in suspension culture is neural stem cell-like populations. Still, considering the fact that stem cells potentially differentiate into neural cells have a tendency to form spheres or cell masses under stringent growth conditions without serum, roles of selectively expressed neural differentiation genes should further be investigated. The pluripotency of the ES cells was also confirmed in spite of the apparent morphological difference between suspension- and adhesive-culture conditions. Therefore, the inalienable association of the undifferentiated state of the ES cells with their pluripotency might not necessarily be related to a specific cell culture method or cellular morphology.
In summary, a novel function of PVA to stimulate sphere-forming suspension culture of ES cells was elucidated in this study. Our novel suspension culture method facilitates the long-term proliferation of pluripotent ES cells without feeder cells. Low-cost maintenance of the culture using the least amount of synthetic or animal-derived peptidic products is a merit of the present culture system in terms of potential use for future therapeutic application. Although the same suspension culture condition is not sufficient to maintain human ES cells, low-cost and animal-derived product free culture system must be developed to facilitate human ES cell-based cell therapy.
Cell culture
Maintenance of mouse ES cell line
For conventional adherent cultures, EGFP D3, EB5, and E14 ES cell lines were maintained on mouse embryonic fibroblasts (MEFs) seeded in gelatin-coated plates in Dulbecco’s minimal essential medium (GIBCO) supplemented with 15 % FCS, 2 mM L-glutamine (GIBCO), 0.1 mM 2-mercaptoethanol (Sigma), 1x non-essential amino acids (GIBCO), 1 mM sodium pyruvate (Invitrogen), 1000 units/ml LIF (culture supernatant of CHO cells expressing LIF or ESGRO [GIBCO]), 100 units/ml penicillin (GIBCO), and 100 μg/ml streptomycin (GIBCO). The medium was changed daily, and the culture was passaged every 2-3 days onto MEFs. For suspension cultures, ES cells prepared from conventional adherent cultures by trypsinization were washed with PBS and transferred to bacterial grade non-coated dishes containing Iscove’s modified Dulbecco medium/F12 (1:1) (GIBCO), supplemented with 2 mM L-glutamine (GIBCO), 0.1 mM 2-mercaptoethanol (Sigma), 0.1 % polyvinyl alcohol (PVA, Sigma), 1x insulin-transferin-selenium-X (GIBCO), 1000 units/ml LIF (CIBCO or culture supernatant), 100 units/ml penicillin (GIBCO), and 100 μg/ml streptomycin (GIBCO). PVA concentrated solution was prepared by adding 10% (w/v) of PVA to D2W and dissolving it by constant stirring for 24 h at 60°C. When indicated, 10μm ACTH (R &D) was added. Starting from a mostly single cell suspension of ES cells in the medium, the cells spontaneously form small aggregates after 12 hours. These small cell masses then aggregate to form larger cell masses. The cells are likely to proliferate constantly during this process. Half of the medium was exchanged for fresh medium every day. Cells were split 1:2 for passaging after mechanical dissociation by pipetting every 3-4 days.
Induction of melanocyte differentiation
To induce melanocyte differentiation in vitro, we dissociated ES cells and seeded them at 1000-2000 cells/well in 6-well plates pre-seeded with ST2 stromal cell line. They were cultured in α-minimum essential medium (GIBCO) supplemented with 5% calf serum, 10 mM dexamethasone, 200 nM basic FGF, and 50 nM cholera toxin, as previously described [Yamane et al.,1999; Kunisada et al.,2003].
Assay for alkaline phosphatase activity and histological analysis
Cells were washed twice with PBS, and then fixed with 4 % paraformaldehyde at room temperature for 4 minutes. Fresh naphthol AS-MX phosphatase solution (0.6 g/l) containing fast red violet B salt (0.1 g/l) in 100 mM Tris-HCl (pH 8) and 50 mM MgCl2 was then added, and incubation was carried out for 30 min at room temperature. Under these conditions, alkaline phosphatase-positive cells were stained pink or red.
For histological analysis, cell clumps gently isolated from the suspension culture were fixed by immersion in 10% formalin in phosphate buffer (PH 7.2) for 30 min, dehydrated with ethanol and xylene, and embedded in paraffin. Serial sections of 3-μm thickness were prepared and stained with hematoxylin and eosin.
Flow-cytometric analysis
Cells were dissociated and incubated in primary antibody against SSEA-1(diluted 1:1000 in PBS containing 5%FCS; Developmental Studies Hybridoma Bank) for 10 min at 4°C, and washed in PBS containing 5%FCS. APC conjugated anti-IgM antibody was then incubated (diluted 1:1000 in PBS containing 5%FCS; Pharmingen) for 10 min at 4°C. Negative controls were treated identically without primary antibody.
RNA extraction and RT-PCR
RNA was extracted by using Isogen (Wako) according to the manufacturer’s instructions. First-strand cDNA was prepared by using Super Script reverse transcriptase (Invitrogen) primed with random hexamer in a 20-μl reaction mixture containing 5 μg of total RNA. A total of 0.5 μl of the first-strand cDNA mixture was used for PCR with Taq polymerase (TAKARA) performed in a 50-μl volume. The following conditions were used: 10 min at 95 °C followed by 40 cycles of 15 seconds at 95 °C and 1 min at 60 °C (for Oct4, Nanog, ERas, Rex-1, Snail1, Gata4, Slug, and Gapdh) or 2 min at 94 °C followed by 25 cycles of 30 seconds at 94 °C, 30 seconds at 56 °C, and 1 min at 72 °C (for Itgb8, Cdh11, and Col3a1). The PCR reaction products were separated by gel electrophoresis, and the DNA bands were visualized under ultraviolet light for photography. The primer sequences (shown as forward followed by reverse) used were the following: GGCGTTCTCTTTGGAAAGGTGTTC and CTCGAACCACATCCTTCTCT for Oct4; TCTGGGAACGCCTCATCAAT and GGAGAGGCAGCCTCTGTGC for Nanog; GCTGGGGAATGGCTTTGCCTA and CAAAGATCTTCAGGCTACAG for ERas; GCGACATTTTCTGGTGCACA and CTTTCCTGTTGGAACTATGCC for Rex-1; ATAGCGAGCTGCAGGACGCGTGTGT and AGGCCGAGGTGGACGAGAAGGACGA for Snail1; GCCTGTATGTAATGCCTGCG and CCGACGAGGAATTTGAAGAGG for Gata4; AAGGCTTTCTCCAGACCCTGGCTG and CAGCCAGATCCTCATGTTTATGC for Slug; CTGAAGAAATACCCCGTGGA and CATGGGGAGGCATACAGTCT for Itgb8; CACAGGATGGTGTGGTGAAG and AGGCTCATCGGCATCTTCTA for Cdh11; TTGATGTGCAGCTGGCATTC and GCCACTGGCCTGATCCATAT for Col3a1; and CTTCACCACCATGGAGAAGGC and GGCATGGACTGTGGTCATGAG for Gapdh.
Clonal proliferation analysis
To test the potential for clonal proliferation, we dissociated suspension-cultured ES cells into single-cell suspensions by trypsin-EDTA treatment (37°C, 5min), and then seeded 1 or 50 cells per well into a 96-well plate or 500, 1000 or 5000 cells per well into a 24-well plate. The medium was changed every-2 days until a visible spheric cell mass appeared. For comparison, cells were also cultured under the conventional adhesion condition.
Production of chimeric mice
Blastocysts were collected from superovulated BDF1×BDF1 females at embryonic day 3.5, injected with ES cells, and then transferred into the uterus of embryonic day-2.5 pseudopregnant ICR females. The EGFP-expressing D3 ES cell line was used for the identification of ES cell-derived cell lineages.
DNA microarray analysis
DNA microarray analysis was performed as described [Carter et al.,2005]. Data were analyzed by using the NIA Array Analysis tool [Sharov et al.,2005] (http://lgsun.grc.nia.nih.gov/ANOVA/) and DAVID (http://david.abcc.ncifcrf.gov/) software. The data discussed in this publication have been deposited in NCBI’s Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series accession number GSE9022. (The link for reviewers: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=jrqxxicaycecone&acc=GSE9022).
Supplementary Material
Supp 1
Click here to view.(194K, doc)
ACKOWLEDGEMENT
We thank Dr. Yasuhiro Yamada for help in producing the chimeric mice and Dr. Yulan Piao for performing the microarray work and Dr. Kenichi Tezuka for discussion. We also thank Dr. Hitoshi Niwa for providing EB5 ES cell line and critical reading of the manuscript and valuable advices. This work was supported in part by grants from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. This work was also supported in part by the Intramural Research Program of National Institute on Aging, NIH.
We thank Dr. Hitoshi Niwa for providing EB5 ES cell line. This work was supported in part by grants from the Ministry of Education, Culture, Sports, Science, and Technology of Japan and Intramural Research Program of National Institute on Aging, NIH.
REFERENCES
  • Azuara V, Perry P, Sauer S, Spivakov M, Jørgensen HF, John RM, Gouti M, Casanova M, Warnes G, Merkenschlager M, Fisher AG. Chromatin signatures of pluripotent cell lines. Nat Cell Biol. 2006;8:1114–1123. [PubMed]
  • Ben-Shushan E, Thompson JR, Gudas LJ, Bergman Y. Rex-1, a gene encoding a transcription factor expressed in the early embryo, is regulated via Oct-3/4 and Oct-6 binding to an octamer site and a novel protein, Rox-1, binding to an adjacent site. Mol Cell Biol. 1998;18:1866–1878. [PubMed]
  • Boyer LA, Plath K, Zeitlinger J, Brambrink T, Medeiros LA, Lee TI, Levine SS, Wernig M, Jaenisch R. Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature. 2006;441:349–353. [PubMed]
  • Brons GM, Smithers LE, Trotter MWB, Rugg-Gunn P, Sun B, Chuva de Sousa Lopes SM, Howlett SK, Clarkson A, Ahrlund-Richter L, Pedersen RA, Vallier L. Derivation of pluripotent epiblast stem cells from mammalian embryos. Nature. 2007;448:191–195. [PubMed]
  • Burdon T, Stracey C, Chambers I, Nichols J, Smith A. Suppression of SHP-2 and ERK signalling promotes self-renewal of mouse embryonic stem cells. Dev Biol. 1999;210:30–43. [PubMed]
  • Carter MG, Sharov AA, VanBuren V, Dudekula DB, Carmack CE, Nelson C, Ko MSH. Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray. Genome Biol. 2005;6:R61. [PubMed]
  • Chambers I, Colby D, Robertson M, et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell. 2003;113:643–655. [PubMed]
  • Cormier J, Zur Nieden NI, Rancourt DE, Kallos MS. Expansion of Undifferentiated Murine Embryonic Stem Cells as Aggregates in Suspension Culture Bioreactors. Tissue Eng. 2006;12:3233–3245. [PubMed]
  • Darr H, Mayshar Y, Benvenisty N. Overexpression of NANOG in human ES cells enables feeder-free growth while inducing primitive ectoderm features. Development. 2006;133:1193–1201. [PubMed]
  • Donovan PJ, Gearhart J. The end of the beginning for pluripotent stem cells. Nature. 2001;414:92–97. [PubMed]
  • Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature. 1981;292:154–156. [PubMed]
  • Fok EYL, Zandstra PW. Shear-Controlled Single-Step Mouse Embryonic Stem Cell Expansion and Embryoid Body-Based Differentiation. Stem Cells. 2005;23:1333–1342. [PubMed]
  • Goldsborough M, Tilkins ML, Price P, Lobo-Alfonso J, Morrison J, Stevens M, Meneses J, Pederson R, Koller B, Latour A. Serum-free culture of murine embryonic stem (ES) cells. Focus. 1988;20:8–12.
  • Hao J, Li TG, Qi X, Zhao DF, Zhao GQ. WNT/beta-catenin pathway up-regulates Stat3 and converges on LIF to prevent differentiation of mouse embryonic stem cells. Dev Biol. 2006;290:81–91. [PubMed]
  • Hirano M, Yamamoto A, Yoshimura N, Tokunaga T, Motohashi T, Ishizaki K, Yoshida H, Okazaki K, Yamazaki H, Hayashi SI, Kunisada T. Generation of structures formed by lens and retinal cells differentiating from embryonic stem cells. Dev Dyn. 2003;228:664–671. [PubMed]
  • Ivanova N, Dobrin R, Lu R, Kotenko I, Levorse J, DeCoste C, Schafer X, Lun Y, Lemischka IR. Dissecting self-renewal in stem cells with RNA interference. Nature. 2006;442:533–538. [PubMed]
  • Kunisada T, Yamane T, Aoki H, Yoshimura N, Ishizaki K, Motohashi T. Development of melanocytes from ES cells. Methods Enzymol. 2003;365:341–349. [PubMed]
  • Lu J, Hou R, Booth CJ, Yang SH, Snyder M. Defined culture conditions of human embryonic stem cells. Proc Natl Acad Sci U S A. 2006;103:5688–5693. [PubMed]
  • Ludwig TE, Levenstein ME, Jones JM, Berggren WT, Mitchen ER, Frane J, Crandall LJ, Daigh CA, Conard KR, Piekarczyk MS, Llanas RA, Thomson JA. Derivation of human embryonic stem cells in defined conditions. Nat Biotechnol. 2006;24:185–187. [PubMed]
  • Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci USA. 1981;78:7634–7638. [PubMed]
  • Masui S, Nakatake Y, Toyooka Y, Shimosato D, Yagi R, Takahashi K, Okochi H, Okuda A, Matoba R, Sharov AA, Ko MS, Niwa H. Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nat Cell Biol. 2007;9:625–635. [PubMed]
  • Matsuda T, Nakamura T, Nakao T, et al. STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J. 1999;18:4261–4269. [PubMed]
  • Mitsui, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M, Yamanaka S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell. 2003;113:631–642. [PubMed]
  • Niwa H. How is pluripotency determined and maintained? Development. 2007;134:635–646. [PubMed]
  • Niwa H, Burdon T, Chambers I, et al. Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev. 1998;12:2048–2060. [PubMed]
  • Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet. 2000;24:328–330. [PubMed]
  • Ogawa K, Nishinakamura R, Iwamatsu Y, et al. Synergistic action of Wnt and LIF in maintaining pluripotency of mouse ES cells. Biochem Biophys Res Commun. 2006;343:159–166. [PubMed]
  • Ogawa K, Saito A, Matsui H, Suzuki H, Ohtsuka S, Shimosato D, Morishita Y, Watabe T, Niwa H, Miyazono K. Activin-Nodal signaling is involved in propagation of mouse embryonic stem cells. J Cell Sci. 2007;120:55–65. [PubMed]
  • Prelle K, Zink N, Wolf E. Pluripotent stem cells-model of embryonic development, tool for gene targeting, and basis of cell therapy. Anat Histol Embryol. 2002;31:169–186. [PubMed]
  • Pyle AD, Lock LF, Donovan PJ. Neurotrophins mediate human embryonic stem cell survival. Nat Biotechnol. 2006;24:344–350. [PubMed]
  • Raz R, Lee CK, Cannizzaro LA, et al. Essential role of STAT3 for embryonic stem cell pluripotency. Proc Natl Acad Sci U S A. 1999;96:2846–2851. [PubMed]
  • Sato N, Meijer L, Skaltsounis L, Greengard P, Brivanlou AH. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat Med. 2004;10:55–63. [PubMed]
  • Sharov AA, Dudekula DB, Ko MSH. A web-based tool for principal component and significance analysis of microarray data. Bioinformatics. 2005;21:2548–2549. [PubMed]
  • Smith AG. Embryo-derived stem cells: of mice and men. Annu Rev Cell Dev Biol. 2001;17:435–462. [PubMed]
  • Takahashi K, Mitsui K, Yamanaka S. Role of ERas in promoting tumour-like properties in mouse embryonic stem cells. Nature. 2003;423:541–545. [PubMed]
  • Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science. 1998;282:1145–1147. [PubMed]
  • Wang J, Rao S, Chu J, et al. A protein interaction network for pluripotency of embryonic stem cells. Nature. 2006;444:364–368. [PubMed]
  • Ward CM, Stern P, Willington MA, Flenniken AM. Efficient germline transmission of mouse embryonic stem cells grown in synthetic serum in the absence of a fibroblast feeder layer. Lab Invest. 2002;82:1765–1767. [PubMed]
  • Xu C, Inokuma MS, Denham J, et al. Feeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol. 2001;19:971–974. [PubMed]
  • Xu C, Rosler E, Jiang J, Lebkowski JS, Gold JD, O’Sullivan C, Delavan-Boorsma K, Mok M, Bronstein A, Carpenter MK. Basic fibroblast growth factor supports undifferentiated human embryonic stem cell growth without conditioned medium. Stem Cells. 2005;23:315–323. [PubMed]
  • Xu RH, Peck RM, Li DS, Ludwig T, Thomson JA. Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells. Nat Methods. 2005;2:185–190. [PubMed]
  • Yamane T, Hayashi S, Mizoguchi M, Yamazaki H, Kunisada T. Derivation of melanocytes from embryonic stem cells in culture. Dev Dyn. 1999;216:450–458. [PubMed]
  • Yamane T, Dylla SJ, Muijtjens M, et al. Enforced Bcl-2 expression overrides serum and feeder cell requirements for mouse embryonic stem cell self-renewal. Proc Natl Acad Sci U S A. 2005;102:3312–3317. [PubMed]
  • Ying QL, Nichols J, Chambers I, Smith A. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell. 2003;115:281–292. [PubMed]

PubMed articles by these authors
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph