![]() | ![]() |
Formats:
|
||||||||||||||||||||||
Copyright © 1999, The American Society for Cell Biology Role of the Box C/D Motif in Localization of Small Nucleolar RNAs to Coiled Bodies and Nucleoli Departments of †Biochemistry and Molecular Biology and *Genetics, University of Georgia, Athens, Georgia 30602 Joseph Gall, Monitoring Editor ‡Corresponding author. E-mail address: mterns/at/bchiris.bmb.uga.edu. Received April 5, 1999; Accepted May 4, 1999. This article has been cited by other articles in PMC.Abstract Small nucleolar RNAs (snoRNAs) are a large family of eukaryotic RNAs that function within the nucleolus in the biogenesis of ribosomes. One major class of snoRNAs is the box C/D snoRNAs named for their conserved box C and box D sequence elements. We have investigated the involvement of cis-acting sequences and intranuclear structures in the localization of box C/D snoRNAs to the nucleolus by assaying the intranuclear distribution of fluorescently labeled U3, U8, and U14 snoRNAs injected into Xenopus oocyte nuclei. Analysis of an extensive panel of U3 RNA variants showed that the box C/D motif, comprised of box C′, box D, and the 3′ terminal stem of U3, is necessary and sufficient for the nucleolar localization of U3 snoRNA. Disruption of the elements of the box C/D motif of U8 and U14 snoRNAs also prevented nucleolar localization, indicating that all box C/D snoRNAs use a common nucleolar-targeting mechanism. Finally, we found that wild-type box C/D snoRNAs transiently associate with coiled bodies before they localize to nucleoli and that variant RNAs that lack an intact box C/D motif are detained within coiled bodies. These results suggest that coiled bodies play a role in the biogenesis and/or intranuclear transport of box C/D snoRNAs. INTRODUCTION The generation of eukaryotic ribosomes takes place predominantly inside the nucleus within nucleoli. Nucleoli are composed of a complex mixture of macromolecules, and considerable intracellular trafficking of macromolecules is required to assemble functional nucleoli and to produce ribosomal subunits. Scores of ribosomal and nonribosomal proteins synthesized in the cytoplasm must move to nucleoli. Indeed, several nucleolar proteins have been demonstrated to shuttle continuously between the cytoplasm and nucleus (Borer et al., 1989 ; Meier and Blobel, 1992 ; Shaw and Jordan, 1995 ). In addition, >150 distinct small nucleolar RNAs (snoRNAs) are each targeted to nucleoli where they function in the modification and processing of rRNA (Bachellerie et al., 1995 ; Maxwell and Fournier, 1995 ; Smith and Steitz, 1997 ; Tollervey and Kiss, 1997 ). snoRNAs are produced in the nucleus and remain within the nucleus where they are matured at unidentified intranuclear sites (Terns and Dahlberg, 1994 ; Terns et al., 1995 ). Thus, production of functional snoRNAs involves transport from the nucleoplasm to nucleoli and may involve other nuclear structures.The box C/D snoRNAs are one of two major classes of snoRNAs distinguished by the presence of conserved sequence elements and common secondary structures (Balakin et al., 1996 ). Box C/D snoRNAs each associate with common proteins including fibrillarin (Schimmang et al., 1989 ; Lapeyre et al., 1990 ; Baserga et al., 1991 ), Nop 56/58 (Wu et al., 1998 ; Lafontaine and Tollervey, 1999 ), and recently identified proteins (Caffarelli et al., 1998 ; Watkins et al., 1998 ). Only a few box C/D snoRNAs, namely, U3, U8, U14, and U22, are required for rRNA processing (Li et al., 1990 ; Savino and Gerbi, 1990 ; Hughes and Ares, 1991 ; Peculis and Steitz, 1993 ; Tycowski et al., 1994 ; Enright et al., 1996 ). The majority of box C/D snoRNAs function as guide RNAs to direct methylation of ribose 2′-hydroxyl groups at conserved positions in rRNA (Cavaille et al., 1996 ; Kiss-Laszlo et al., 1996 ; Tollervey, 1996 ; Tycowski et al., 1996 ).The defining structural element of the box C/D snoRNAs is the box C/D motif. The box D element (core consensus sequence CUGA [Xia et al., 1997 ]) is generally found in a single-stranded region near the 3′ terminus of the box C/D RNAs. The box C element (core consensus sequence GANG [Xia et al., 1997 ]) exists in a single-stranded region opposite box D within the predicted secondary structure of most box C/D snoRNAs (Tycowski et al., 1993 ; Kiss-Laszlo et al., 1996 ; Watkins et al., 1996 ; Samarsky and Fournier, 1998 ). Thus the two common sequence elements, box C and box D, are generally distant from each other in the primary sequence of the snoRNAs but are brought into proximity in the folded RNAs as a result of the base pairing of complementary sequences flanking the box elements. The resultant structure, consisting of box C and box D and one or two adjacent helices, has been referred to as the stem-box structure (Qu et al., 1995 ), the terminal core motif (Xia et al., 1997 ), or, simply, the box C/D motif (Samarsky et al., 1998 ).In this study, we have focused our analysis on the mechanisms governing the localization of the box C/D class of snoRNAs to the nucleolus. Extensive studies were performed using U3 snoRNA, which is the most abundant and well-characterized box C/D snoRNA. Comparison of U3 RNAs from diverse organisms reveals that U3 snoRNA contains a box D and two box C (referred to as boxes C and C′) sequence elements as well as U3-specific elements known as boxes A, A′, and B. A two-domain secondary structure is predicted for U3 RNA from all organisms examined. The 5′ domain contains sequences (boxes A and A′) that participate in base-paired interactions with 18S rRNA (Hughes, 1996 ; Mereau et al., 1997 ). The 3′ domain of U3 RNA is structurally diverse (Fournier et al., 1998 ) but invariably contains boxes B, C, C′, and D, which are protein-binding sites (Parker and Steitz, 1987 ; Jeppesen et al., 1988 ; Hartshorne and Agabian, 1994 ; Mereau et al., 1997 ), as well as a 3′ terminal stem. The “hinge,” a short, single-stranded sequence that links the 5′ and 3′ domains, recognizes complementary sequences in the 5′ external transcribed sequences of pre-rRNA (Beltrame and Tollervey, 1995 ; Mereau et al., 1997 ).We have introduced substitution mutations throughout the U3 molecule including all conserved box elements, the 3′ terminal stem, and the hinge sequence, and have analyzed the intranuclear localization of these variant U3 RNAs after their injection into Xenopus oocyte nuclei. In addition, we have also examined the intranuclear localization of additional box C/D snoRNAs (U8 and U14) to test the generality of our observations. We have found that the targeting of box C/D snoRNAs to nucleoli depends on their common sequence elements (the box C/D motif) and is temperature dependent. Furthermore, we have characterized the association of the box C/D snoRNAs with an additional intranuclear organelle, the coiled body. Our results suggest that box C/D snoRNAs associate with coiled bodies transiently before localization to nucleoli. Important differences between the results obtained in this study and those of similar recent studies (Lange et al., 1998a –c ; Samarsky et al., 1998 ) will be discussed.MATERIALS AND METHODS Generation of snoRNA Mutant Constructs U3 Constructs. A plasmid containing a genomic clone encoding Xenopus U3A snoRNA (Savino et al., 1992 ) was used as the source of wild-type U3 RNA-coding sequence. Templates used to transcribe wild-type or mutant U3 RNAs were DNA fragments generated by PCR amplification. DNA fragments encoding U3 RNAs with specific mutations were generated by PCR-based strategies described in detail below. In general, block substitution mutations were introduced in which each nucleotide of a conserved box element was replaced with a complementary nucleotide. The precise changes are noted in the specific description of the generation of each mutant below. The deoxyoligonucleotide primers used in PCR reactions to prepare wild-type and mutated Xenopus U3 templates are listed. SP6 promoter sequences are underlined, and sites of mutation are in bold. All PCR reactions were performed using Pfu DNA polymerase (Stratagene, La Jolla, CA) and an annealing temperature of 52°C.5′ primers were as follows: 1) GATTTAGGTGACACTATAGAAGACTATACTTTCAGGGATCA; 2) GATTTAGGTGACACTATAGAAGACTAATGAATCAGGGATCA; 3) CAGTAAGACTATACT-TTCAGCCTAGTAAAGATTAGGTTGTACCTGGTGA; 4) GTGCT-CGAAAGTGTGTGACTTGAGTGTTACCACGAGGAAGAGC; 5) CTGAACTCACAAACCACCTCCTTCTGCGTCAGTGTTCTCTC ; 6) CGTCAGTGTTCTCTCCTCTCGCACTTGTGAGCTCACAGT-GCTG; 7) GGCTGCTGTTTGCTATACTACTTGCTTCTGCTCCC-CTTTA; 8) GATTTAGGTGACACTATAGACCACGAGGAAGA-GCG; and 9) AAAAAGAATTCCCAAATTCAGAAGTGACTGCG. 3′ primers were as follows: 10) GGGTGTCAGCCTGTGTTCTCTCCCTCC; 11) ACCACTCAGCCTGTGTTCTCTCCCTCC; 12) TCACCAGGTACAACCTAATCTTTACTAGGCTGAAAGTATAGTCT -TACTG; 13) GCTCTTCCTCGTGGTAACACTCAAGTCACACT-TTCGAGCACAT; 14) GAGAGAACACTGACGCAGAAGGAGGTGGTTTGTGAGTTCAG; 15) CAGCACTGTGAGCTCACAA-GTGCGAGAGGAGAGAACACTGACG; 16) TAAAGGGGAGCAGAAGCAAGTAGTATAGCAAACAGCAGC; 17) ACCACA-GTCGGTGTGTTC; 18) ACCACTCATCCTGTGTTCTCTCCC-TCC; 19) ACCACTCCGCCTGTGTTCTCTCCCTCC; 20) ACCA-CTGAGCCTGTGTTCTCTCCCTCC; 21) ACCACACAGCCTGTGTTCTCTCCCTCC; 22) ACCACTCAGCCTGTGTTCTCTCCCGA-AGG; and 23) AAAAAAAGCTTCAGCCCCACTTTTCCATTC. Two different PCR strategies were used: one to introduce mutations near the termini of U3 and to generate subfragments of U3 and another to introduce mutations at internal positions within the U3-coding region. Generation of Terminal U3 Mutations and U3 Subfragments. Wild-type U3 transcription template DNA was generated by PCR amplification from wild-type U3 plasmid using oligonucleotides 1 + 11. Block substitutions of box A′ (nucleotides [nt] 8–12; UACUU to AUGAA), box D (nt 210–215; GGCUGA to CCGACU), and box D point mutants (see below) were generated by direct PCR amplification from wild-type U3 plasmid using the following primer pairs: box A′, 2 + 11; box D, 1 + 17; box D C212B, 1 + 18; box D U213G, 1 + 19; box D G214B, 1 + 20; and box D A215U, 1 + 21. The subfragment of U3 comprised of the 3′ domain (nucleotides 75–220) was generated using primers 8 + 11. The U3 subfragment containing box C′ and box D (nucleotides 75–104/GCUU tetraloop/198–220) was generated using primers 8 + 22 and the following oligonucleotide template: TAATACGACTCACTATAGGGAAGACTAC-CACGAGGAAGAGCGTCAGTGTTCTCTCCTTCGGGAGAGAA-CACAGGCTGAGTGGT. In all other cases, the wild-type U3 gene was used as the PCR template. The point mutation U213G in the subfragment containing box C′ and box D was produced using primers 8 + 19 and the unmutated subfragment as the template in a PCR reaction. All U3 mutant DNA fragments were subcloned into the SmaI site of pUC19 and confirmed by sequencing. Generation of Internal U3 Mutations. Mutations of the internal elements, box A (nt 17–28; GGAUCAUUUCUA to CCUAGUAAAGAU), hinge (nt 63–74; CUGAACUCACAA to GACUUGAGUGUU), box C′ (nt 80–87; GAGGAAGA to CUCCUUCU), box B (nt 106–114; GAGCGUGAA to CUCGCACUU), and box C (nt 157–165; UGAUGAACG to ACUACUUGC) of the U3 gene were produced by recombinant PCR (Higuchi, 1990 ). Block substitution of box A was accomplished by combining the products of two independent PCR reactions (from the wild-type U3 gene by the use of primer pairs 9 + 12 and 3 + 23) and PCR amplification using the outermost primers (9 + 23). The first series of PCR reactions to produce block substitutions in each of the following elements used the indicated primer pairs: the hinge region, primers 9 + 13 and 4 + 23; box C′, primers 9 + 14 and 5 + 23; box B, primers 9 + 15 and 6 + 23; and box C, primers 9 + 16 and 7 + 23. For each of these PCR reactions, the wild-type U3 plasmid was used as the template. Primers 9 + 23 were used to amplify from the combined products in the second step. All U3 mutant DNA fragments were digested with EcoRI and HindIII (sites incorporated into primers 9 + 23), subcloned into the EcoRI/HindIII site of pGEM3Zf−, and sequenced.U14 Constructs. pBT20, a plasmid containing the mouse U14.5 gene (Shanab and Maxwell, 1992 ), was used as a template to generate wild-type and variant U14 RNAs. Mutagenesis of the box C, box D, and 3′ terminal stem sequences of U14 genes was performed by PCR amplification using mutagenic primers. Base substitutions introduced were ACTACT (wild-type is TGATGA) in the position of box C and TCTAGA (wild-type is GTCTGA) for box D. To disrupt terminal stem formation in the U14 RNA, we substituted the 3′ terminal nucleotides of the U14 gene (GCGAAT) with CGCTTA.In Vitro RNA Synthesis PCR products (100 ng) or linearized plasmids (1 μg) were used as templates for in vitro transcription. Wild-type and mutant U3 and U14 RNAs were transcribed from PCR-derived DNA fragments. The following additional RNAs were prepared by in vitro transcription from plasmids as described previously: Xenopus U8 wild type and a box C mutant (Peculis and Steitz, 1994 ); Xenopus U8 box D mutant and Xenopus U3 terminal stem mutant (Terns et al., 1995 ); Xenopus U1, U1Sm−, and U6 (Terns et al., 1993 ); and DHFR mRNA, 5S rRNA, and tRNAiMet (Jarmolowski et al., 1994 ).The reaction conditions used to generate capped, 32P-labeled RNAs by SP6 or T7 RNA polymerase were essentially as described previously (Terns et al., 1993 ). To generate fluorescein-labeled RNAs, we used an equal mixture (250 μM each) of UTP and fluorescein-12-UTP (Boehringer Mannheim, Indianapolis, IN). The RNAs were quantitated by measuring incorporation of trace amounts of [32P]GTP (ICN Pharmaceuticals, Costa Mesa, CA). RNA transcripts were either gel purified or purified by two successive isopropanol precipitations, suspended in distilled water, and stored at −20°C wrapped in aluminum foil to avoid exposure to light. The integrity and size of the RNA were assessed by electrophoresis on 8% denaturing polyacrylamide gels and ethidium bromide staining.Injection of RNAs into Xenopus Oocytes The method by which we microinject and micromanipulate oocytes has been described recently in detail (Terns and Goldfarb, 1998 ). In brief, stage V and VI Xenopus laevis oocytes were separated from each other and from the surrounding follicle cells by treatment with 2 mg/ml collagenase for 60–90 min. The collagenase-treated cells were washed thoroughly in MBSH buffer before microinjection. Injections were performed using the model PL1–100 picoinjector microinjector (Medical Systems Corporation, Greenvale, NY) and a glass needle with a tip of 10 μm inner diameter. The RNA sample was dried using a Savant (Farmingdale, NY) speed vacuum unit and resuspended in a solution of filter-sterilized blue dextran in water (20 mg/ml; 2 × 106 molecular weight; Sigma, St. Louis, MO). Oocyte nuclei were injected with 10 nl of solution containing 5 fmol of fluorescein-labeled RNA. In control experiments (e.g., see Figure Figure2B),2 ).
For the analysis of RNA stability, nuclear retention, fibrillarin binding, and 5′ cap hypermethylation, oocytes were each injected with 10 nl of solution containing ~1 fmol each of [32P]GTP-labeled U1, U8, and U6 RNAs and either [32P]GTP-labeled or fluorescein-12-UTP + [32P]GTP–labeled U3 RNA. After injection, the oocytes were incubated at 18°C for 8 h before they were manually dissected in J-buffer (Birkenmeier et al., 1978 ) into nuclear and cytoplasmic fractions. The nucleocytoplasmic distribution was determined by isolating the RNAs from two to four dissected nuclear and cytoplasmic fractions by proteinase K digestion, phenol extraction, and ethanol precipitation. The RNA equivalent of one nucleus or one cytoplasm was resolved on an 8% denaturing polyacrylamide gel and detected by autoradiography with an intensifying screen.Immunoprecipitations Antibodies used in these experiments included polyclonal antibodies directed against either the m7G (Munns et al., 1982 ) or m2,2,7G cap (Bringmann et al., 1983 ) and a monoclonal antibody (72B9) against fibrillarin (Reimer et al., 1987 ). Antibodies were coupled to preswollen protein A–Sepharose CL-4C beads (Sigma) by end-over-end rotation in 0.5 ml of Ipp-500 buffer (500 mM NaCl, 10 mM Tris-HCl, pH 8.0, 0.1% [vol/vol] NP-40, and 0.1% [wt/vol] sodium azide) at 4°C for 12–16 h. Immunoprecipitations with cap-specific antibodies were performed with purified nuclear RNAs (1 nuclear equivalent/reaction) in Net-2 buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, and 0.05% NP-40). Immunoprecipitations with fibrillarin antibodies were performed with nuclear extracts (5 nuclear equivalents/reaction) in Net-100 buffer (100 mM NaCl, 50 mM Tris-HCl, pH 7.5, and 0.05% NP-40). In both cases, immunoprecipitations were performed at 4°C for 12–16 h, supernatants were collected, and the beads were washed extensively. RNA from both supernatants and pellets were obtained by digestion with proteinase K, phenol extraction, and ethanol precipitation, and the purified RNAs were analyzed on 8% denaturing polyacrylamide gel by autoradiography.Nuclear Spreads, Immunofluorescence, and Microscopy After injection of fluorescently labeled RNAs into Xenopus oocytes, nuclear spreads were prepared from dissected nuclei as described (Gall et al., 1991 ; Wu et al., 1996 ). After centrifugation, the spreads were fixed in 2% paraformaldehyde in 1× PBS, pH 7.2, for 1 h. After washing with 1× PBS, mounts were made using 50% glycerol (in 1× PBS) containing 1 mg/ml phenylenediamine, pH 9, and were stored at −20°C.Indirect immunofluorescence was performed on the nuclear spreads after fixation essentially as described (Wu and Gall, 1997 ). Briefly, slides were blocked using 10% horse serum (Hyclone, Logan, UT) in 1× PBS for 15 min at 37°C. After thorough washing with 1× PBS, the sample area was incubated with antibody (mAb 17C12) directed against fibrillarin at 1:1000 dilution in 1× PBS (Hultman et al., 1994 ) or with antibody (mAb H1) directed against the Xenopus p80 coilin homologue (Tuma et al., 1993 ) at 1:10 dilution in 1× PBS for 30 min at 37°C. The excess primary antibodies were washed away with 1× PBS, and the secondary antibody (Texas Red–conjugated anti-mouse antibody at 1:150 dilution in 1× PBS) was added and incubated at 37°C for 30 min. Excess secondary antibody was washed away with 1× PBS, and mounts were made as described above.A Zeiss (Thornwood, NY) Axiovert S 100 inverted fluorescence microscope equipped with differential interference contrast optics was used for all observations. All images were acquired using a cooled charge-coupled device camera (Quantix-Photometrics) and IP Lab Spectrum software. RESULTS U3 RNA Synthesized with Fluorescein-12-UTP Retains Its Biological Properties U3 RNA intranuclear transport was studied by examining the localization of fluorescein-labeled RNAs in nuclear spread preparations by fluorescence microscopy. As a first step, we compared the nuclear retention, 5′ cap hypermethylation, and fibrillarin binding of fluorescein-labeled U3 snoRNA with that of control RNA to verify that the fluorescein label did not affect known biological properties of the RNA. U3 RNA injected into oocyte nuclei is stable and retained in the nucleus (Terns and Dahlberg, 1994 ; Terns et al., 1995 ). To ensure that incorporation of fluorescein-12-UTP into U3 RNA would not affect the stability or nuclear retention of the RNA, we injected RNA transcribed in vitro with fluorescein-12-UTP (see MATERIALS AND METHODS) into the nuclei of Xenopus oocytes. Eight hours after injection, RNAs present in the nuclear and cytoplasmic fractions were analyzed by PAGE. Coinjected control RNAs included a U1 small nuclear RNA (snRNA) mutant (U1sm−), U6 snRNA, and U8 snoRNA (Figure (Figure1A).1 ; Terns et al., 1993 ]). U6, an snRNA that is not exported to the cytoplasm (Hamm and Mattaj, 1989 ; Terns et al., 1993 ), and U8 snoRNA were retained within the nucleus (Figure (Figure1A)1 ). These controls ensure that, in each oocyte, RNAs were being exported (U1) and retained (U6 and U8) appropriately and that the nuclear injections and dissections were precise. We found that U3 snoRNA labeled with fluorescein-12-UTP (Figure (Figure1A,1
We also tested for effects of fluorescein labeling on the ability of U3 RNA to undergo cap hypermethylation. U3 snoRNA is normally synthesized with a 5′ m7G cap that is hypermethylated to an m2,2,7G cap within the nucleus (Terns et al., 1995 ). Cap hypermethylation was assayed by immunoprecipitation of nuclear RNAs with antibodies that specifically recognize either the m7G (Munns et al., 1982 ) or m2,2,7G cap structures (Bringmann et al., 1983 ). The antibodies immunoprecipitated the fluorescein-12-UTP–labeled U3 and the nonfluorescein-labeled U3 to the same extent (Figure (Figure1B,1Fibrillarin is a nucleolar protein that binds box C/D family snoRNAs including U3 (Baserga et al., 1991 ). We tested whether fluorescein-labeled U3 RNA associated with fibrillarin by assaying the ability of anti-fibrillarin antibodies to coimmunoprecipitate the RNA after injection of the RNA into oocyte nuclei. Monoclonal antibody 72B9 against fibrillarin (Reimer et al., 1987 ) immunoprecipitates U3 RNA labeled with fluorescein as well as nonfluorescein-labeled U3 (Figure (Figure1C,1Our results clearly show that labeling U3 RNA with fluorescein by transcription with fluorescein-12-UTP does not significantly alter any of the biological properties of the RNA that we examined, which included stability, nuclear retention, hypermethylation, and fibrillarin binding. snoRNAs but Not Other Classes of RNA Localize to Nucleoli U3 snoRNA has been shown to be involved in 18S rRNA processing within the nucleolus (Kass et al., 1990 ; Savino and Gerbi, 1990 ; Hughes and Ares, 1991 ; Beltrame and Tollervey, 1995 ). Amplified nucleoli and other nuclear structures including chromosomes, coiled bodies, and snurposomes can be observed and distinguished by morphology and molecular markers in oocyte nuclear spread preparations (Gall et al., 1991 ; Wu et al., 1993 ). For example, nucleoli can be identified by immunostaining using antibodies against nucleolar proteins such as fibrillarin (Shah et al., 1996 ). Fibrillarin is enriched in the dense fibrillar regions of nucleoli that can be distinguished as internal substructures by differential interference contrast microscopy (Figure (Figure2A).2 ; Matera, 1998 ), are distinguished by their size and morphology (Gall and Callan, 1989 ) and the presence of p80 coilin (Andrade et al., 1991 ). Fluorescein-labeled U3 RNA colocalized with endogenous fibrillarin within the dense fibrillar region of nucleoli and was not detectable in coiled bodies 1 h after injection into Xenopus oocytes (Figure (Figure2A).2Other box C/D snoRNAs, namely, U8 and U14, also localized to the multiple amplified nucleoli after injection into oocyte nuclei (Figure (Figure2B).2 Nucleolar Localization of U3 snoRNA Is Temperature Dependent Energy-dependent, active transport processes in the cell are generally inhibited at low temperatures. To determine whether the nucleolar localization of U3 is a temperature-dependent process, we examined localization at reduced temperatures. Fluorescein-labeled U3 RNA was injected into the nuclei of oocytes that had been preincubated at 4°C for 1 h. The injections were performed at 4°C, and after injection the oocytes were maintained at 4°C for 1 h. U3 RNA was not localized to the nucleolus in oocytes that were maintained at 4°C (Figure (Figure3).3
Box C′ and Box D Are Required for Localization of U3 RNA to the Nucleolus To identify cis-acting signals essential for nucleolar targeting of U3 snoRNA, we analyzed the localization of multiple sequence variants of U3. We began our analysis with block substitutions of the phylogenetically conserved sequence elements in U3: boxes A, A′, B, C, C′, and D (Figure (Figure4A).4 ; Mereau et al., 1997 ). In addition, to determine whether the m7G cap (or its hypermethylated form) is required for nucleolar localization, we replaced the m7G cap of U3 RNA with a nonphysiological, nontrimethylatable ApppG cap.
Among the eight variants analyzed, six were found in nucleoli in patterns similar to that in wild-type U3; substitution of boxes A, A′, B, and C and the hinge region did not prevent the nucleolar localization of U3 (Figure (Figure4B).4 ). Our results clearly indicate that box C′ and box D are necessary for the nucleolar localization of U3 RNA.We performed a more detailed mutational analysis on box D, one of the elements found to be essential for nucleolar localization. The core box D element conserved among C/D family snoRNAs consists of CUGA (Xia et al., 1997 ). We tested the contribution that each of the four conserved nucleotides makes on nucleolar localization by analyzing U3 molecules with point mutations at each position. Substitution of C212 did not disrupt localization of U3 RNA to the nucleolus (Figure (Figure5).5
A Fragment of U3 Containing Box C′ and Box D Localizes to the Nucleolus Box C′ and box D are the only conserved sequence elements that we found to be essential for nucleolar localization of U3 (Figure (Figure4B).4
An Intact 3′ Terminal Stem Is Essential for Nucleolar Localization of U3 and U14 For many box C/D snoRNAs, the 3′ terminal sequences are predicted to be involved in the formation of a short-stem structure that results in positioning the box C and box D sequences adjacent to one another in the predicted secondary structures of the RNAs (Maxwell and Fournier, 1995 ; Tollervey and Kiss, 1997 ) (Figure (Figure4A).4 ; Jeppesen et al., 1988 ; Shanab and Maxwell, 1991 ; Baserga et al., 1992 ; Hartshorne and Agabian, 1994 ; Mereau et al., 1997 ). To determine whether the integrity of the 3′ terminal stem is important for nucleolar localization of box C/D snoRNAs, we examined the effect of disrupting the terminal stems of both U3 and U14 snoRNAs on nucleolar localization. Variant U3 and U14 snoRNAs predicted to be unable to form 3′ terminal stems were generated by substituting the nucleotides of one side of the stem with complementary sequences to abolish Watson–Crick base-pairing potential (see MATERIALS AND METHODS). In contrast to their wild-type U3 and U14 counterparts, both variant RNAs failed to localize to nucleoli (Figure (Figure7).7
Box C/D snoRNAs Transiently Localize to Coiled Bodies before Nucleoli At very early time points (15 min after injection of RNA), before significant localization of U3 to nucleoli, the RNA was clearly observed within coiled bodies (Figure (Figure8A).8
Strikingly, U3 mutants that did not localize to nucleoli accumulated in coiled bodies (Figure (Figure8B).8 The specificity of the association of the RNAs with coiled bodies was supported by the localization observed with additional RNAs including a box H/ACA family snoRNA, U65 (Ganot et al., 1997 ), tRNA, and a spliceosomal snRNA, U1. Although U65 readily localized to nucleoli as expected, we did not detect U65 or tRNA in coiled bodies at any time point examined (Figure (Figure8B8 ) and GAR-1 (our unpublished results) have been observed in coiled bodies. In contrast, U1 RNA localized to coiled bodies for several hours but did not localize to nucleoli (weak localization of U1 to snurposomes [Wu et al., 1993 ] was observed at late time points [our unpublished results]). These controls clearly indicate that coiled bodies are not a simple default destination for injected RNAs.To examine the association of other box C/D snoRNAs with coiled bodies, we analyzed the localization of U8 and U14. As was the case for U3, a transient localization to coiled bodies was observed with U8 and U14 snoRNAs (Figure (Figure9).9
DISCUSSION In eukaryotic cells, mechanisms exist to ensure that RNAs are properly transported from the sites of their synthesis to the sites of their function. In this study, we have identified determinants governing the localization of members of the box C/D class of snoRNAs to the nucleolus. We have found that the nucleolar localization of box C/D snoRNAs requires cis-acting sequences and structural features that are common to this class of RNAs. Moreover, the RNAs apparently travel through coiled bodies en route to nucleoli. The Box C/D Motif Targets Box C/D snoRNAs to the Nucleolus The members of the box C/D snoRNA family contain two common sequence elements (box C and box D) that are brought together in the folded RNAs as a result of the base pairing of complementary sequences flanking the box elements. Our results indicate that the key elements of the box C/D motif (i.e., box C, box D, and a nearby stem; Figure Figure4A,4 U3 snoRNA, the primary focus of this work, contains two conserved elements with homology to box C, termed box C and box C′, and a single box D. In U3 RNA, box C′ exists opposite box D in a conserved stem-loop motif (Figure (Figure4A)4 ; Jeppesen et al., 1988 ; Tycowski et al., 1993 ; Hartshorne and Agabian, 1994 ; Mereau et al., 1997 ; Samarsky and Fournier, 1998 ). Interestingly, box C of U3 is found opposite box B in the predicted secondary structure (Mereau et al., 1997 ; Samarsky and Fournier, 1998 ), and this conserved box B/C motif is unique to U3 RNAs. In addition, box C′ (and not box C) of U3 functions in accumulation of the RNA in yeast similar to box C of other C/D snoRNAs (Samarsky and Fournier, 1998 ). Thus, the box C/D motif of U3 RNA is comprised of U3 box C′, box D, and the flanking stems including the 3′ terminal stem.Our mutational analysis of U3 showed that substitution of sequences in box C′, box D, or the 3′ terminal stem but not of other elements (boxes A, A′, B, and C or hinge) disrupted localization of the RNA to the nucleolus (Figures (Figures4B4 ). Furthermore, box C′ and the 3′ terminal stem were found not to be necessary for nucleolar localization (although it was noted that variable results were obtained with box C′ mutants in that study [Lange et al., 1998c ]). It is difficult to reconcile the striking differences between our results and those of Lange et al. (1998c) given the similarity of the studies. In yeast, mutation of U3 box C′ results in the loss of RNA stability (Mereau et al., 1997 ; Samarsky and Fournier, 1998 ), and Lange et al. (1998c) postulated that the reduced localization that they occasionally observed with Xenopus box C′ mutants may reflect the lack of stability. However, we have consistently observed that essentially all of the Xenopus U3 box C′ mutant RNA injected into Xenopus oocytes is present at the time of analysis (Figure (Figure4C)4Importantly, our results indicate that box C (U3 box C′) and box D function together as parts of the box C/D motif to direct nucleolar localization of this class of RNAs. Neither element appears to be capable of supporting nucleolar localization in the absence of the other, because substitution of either element (block substitution of box C′ or block substitution or point mutation of box D) resulted in a loss of localization (Figures (Figures4B4 ) nor the terminal stem of U14 (Lange et al., 1998b ) are essential for nucleolar localization. In addition, although they also found that box C and box D are essential for nucleolar localization of U8 (Figure (Figure9)9 ), Lange et al. (1998b ,c ) have suggested that the spatial relationship of U8 box C and box D sequence elements is not important. The secondary structure of U8 has not been experimentally determined, and it is possible and indeed might be predicted based on an alternate proposed structure model (Watkins et al., 1996 ) that the spatial relationship of box C and box D has not been significantly altered in the variants examined. The box C/D motif and specifically the terminal stem that is thought to maintain the spatial relationship of box C and box D have been demonstrated to be important for the stability of snoRNAs (Terns et al., 1995 ), snoRNA biogenesis (Baserga et al., 1992 ; Xia et al., 1997 ), small nucleolar ribonucleoprotein (snoRNP) assembly (Watkins et al., 1998 ), and the binding of box C/D–specific proteins (Caffarelli et al., 1998 ). Our results indicate that the box C/D motif is also essential for the transport of the box C/D family snoRNAs to the nucleolus.Our findings further indicate that sequences common to box C/D snoRNAs, rather than sequences specific to particular snoRNAs, are responsible for localizing these RNAs to nucleoli. It is conceivable that mutations in sequences other than the box C/D motif have subtle, nonessential effects on the rate or extent of nucleolar localization that were not detected in our assay. However, none of the other variant RNAs tested exhibited obvious diminished nucleolar localization relative to that of wild-type U3 RNA. It is noteworthy that U3 mutations that are predicted to disrupt base pairing of U3 with pre-rRNA (Beltrame and Tollervey, 1995 ; Hughes, 1996 ; Mereau et al., 1997 ) did not prevent the nucleolar localization of the RNA (box A, box A′, and hinge mutants; Figure Figure4B).4 ; Hughes, 1996 ; Mereau et al., 1997 ), is not essential for its localization to nucleoli. Likewise, sequences within two other box C/D snoRNAs (U14 and U8 snoRNA) that exhibit complementarity to pre-rRNA were shown recently to be dispensable for their nucleolar localization (Lange et al., 1998a –c ; Samarsky et al., 1998 ). Finally, although box B and box C are important for U3 function in rRNA processing (Samarsky and Fournier, 1998 ), we have shown that box B and box C are not essential for localization to nucleoli.In addition, our results indicate that the box C/D motif is sufficient to direct localization of RNA to the nucleolus (Figure (Figure6).6 ). Samarsky et al. (1998) demonstrated that minimal RNAs derived from U14 that maintain the box C/D motif are localized to nucleoli in both yeast and mammalian cells. It was not possible for Samarsky et al. (1998) to assess the necessity of the box C/D motif for U14 localization in those systems because of the lack of stability of the relevant mutant RNAs. Together the results indicate that the highly conserved box C/D motif mediates the nucleolar targeting of snoRNAs in diverse cell types including Xenopus oocytes (U3, U8, and U14 [this study]), yeast, and mammalian somatic cells (U14 [Samarsky et al., 1998 ]).5′ Cap Hypermethylation Is Not Essential for Nucleolar Localization of Box C/D snoRNAs Certain box C/D snoRNAs, including U3 and U8 RNA, are synthesized with m7G caps that become hypermethylated in the nucleus (Tyc and Steitz, 1989 ; Terns and Dahlberg, 1994 ; Terns et al., 1995 ). There is evidence that cap hypermethylation of snoRNAs occurs in the nucleoplasm before their localization to nucleoli (Terns et al., 1995 ). We found that U3, U8, and U14 RNAs transcribed with either their natural m7GpppG cap structure or with a cap structure that cannot be trimethylated (ApppG) were comparably localized to nucleoli (Figure (Figure4B4 ) directly demonstrate that 5′ cap hypermethylation is not essential for the nucleolar localization of the capped box C/D snoRNAs. This conclusion is perhaps not surprising given that the majority of vertebrate snoRNAs are processed out of introns and do not contain 5′ cap structures but are nevertheless targeted to nucleoli (Maxwell and Fournier, 1995 ; Tollervey and Kiss, 1997 ). Previously, it was suggested that cap hypermethylation is not essential for nucleolar localization of U8 RNA because ApppG-capped U8 RNA is functional in Xenopus oocytes (Peculis and Steitz, 1994 ). On the other hand, cap hypermethylation was reported to be essential for the localization of U3 and U8 RNAs to nucleoli of injected mammalian cells (Jacobson and Pederson, 1998 ). This latter study raises the possibility that the nucleolar localization of box C/D snoRNAs may depend on cap hypermethylation in some but not all cell types.The Function of the Box C/D Nucleolar-Targeting Motif Is Likely Mediated by Specific RNA-Binding Proteins It is clear from a number of studies that box C/D sequences play key roles in important aspects of snoRNA metabolism (Baserga et al., 1991 ; Huang et al., 1992 ; Peculis and Steitz, 1994 ; Caffarelli et al., 1996 ; Cavaille and Bachellerie, 1996 ; Kiss-Laszlo et al., 1996 , 1998 ; Nicoloso et al., 1996 ; Watkins et al., 1996 ; Xia et al., 1997 ). In vivo and in vitro structure probing of U3 RNA from a diverse range of organisms demonstrates that both the box C′ and box D sequences of U3 RNA are phylogenetically conserved protein-binding sites (Parker and Steitz, 1987 ; Jeppesen et al., 1988 ; Hartshorne and Agabian, 1994 ; Mereau et al., 1997 ). Moreover, we have found via competition experiments that newly synthesized snoRNAs are actively retained in the nucleus by a mechanism that is both saturable and sequence specific (Terns et al., 1995 ), indicating that specific nuclear factors associate with snoRNAs to prevent them from exiting the nucleus. Recently, excellent candidates for protein mediators of box C/D function have been identified (Caffarelli et al., 1998 ; Watkins et al., 1998 ; Wu et al., 1998 ; Lafontaine and Tollervey, 1999 ). Further research will be required to understand how such RNA–protein interactions contribute to the maturation, transport, and function of box C/D snoRNAs.Potential Role of Coiled Bodies in the Maturation and Transport of Box C/D snoRNAs A major gap in our knowledge of RNA trafficking is how specific subcellular structures participate in RNA transport and localization. We have found that box C/D family snoRNAs associate with nucleoli and coiled bodies. snoRNAs have been observed both in nucleoli (Fischer et al., 1991 ; Puvion-Dutilleul et al., 1991 ; Matera et al., 1994 ; Samarsky et al., 1998 ) and in coiled bodies (Bauer et al., 1994 ; Jimenez-Garcia et al., 1994 ; Samarsky et al., 1998 ; Shaw et al., 1998 ) in diverse cell types by in situ hybridization and light and electron microscopy. However, because analysis of the steady-state distribution of endogenous RNAs yields little information about the mechanism of ongoing RNA transport, we have performed a temporal analysis of the intranuclear distribution of injected snoRNAs. We show that box C/D snoRNAs interact dynamically with coiled bodies (Figures (Figures88In addition to box C/D snoRNAs, other nuclear RNAs may also transiently localize to coiled bodies. Indeed, we have found that the U1 spliceosomal snRNA is targeted to coiled bodies rapidly after injection into Xenopus oocytes before localization to snurposomes (Figure (Figure88 ). However, U1 snRNA has been readily observed in coiled bodies of somatic cells where snRNAs are more actively synthesized (Carmo-Fonseca et al., 1992 ; Huang and Spector, 1992 ; Matera and Ward, 1993 ). In addition, studies with U7 snRNA indicate a dynamic localization with coiled bodies after injection into oocytes (Wu et al., 1996 ).It is unclear why snoRNAs traverse coiled bodies. Numerous models for coiled body function have been proposed to account for the fact that these structures contain a multitude of factors including both snRNAs and snoRNAs and their associated proteins (Lamond and Carmo-Fonseca, 1993 ; Gall et al., 1995 ; Matera, 1998 ). Coiled bodies might be involved in the early metabolism of snoRNAs and may be sites of snoRNA modification or assembly into RNP complexes. Conceivably, the reason why mutant snoRNAs that do not localize to nucleoli are detained in coiled bodies is because they lack the ability (e.g., modifications or box C/D–binding factors) to exit these structures efficiently or to be transferred to nucleoli.Coiled bodies could serve as intranuclear transport vehicles that shuttle components (including snoRNPs) to the sites of their function. We detected snoRNAs in coiled bodies at early but not late time points after injection, suggesting that the flow of snoRNAs between coiled bodies and nucleoli is unidirectional. The box C/D motif is not essential for localization of snoRNAs to coiled bodies, but our results suggest that the motif is required to move snoRNAs from coiled bodies to nucleoli. Coiled bodies have been detected in close association with snoRNA (and snRNA) gene loci (reviewed in Matera, 1998 ) and are often found physically associated with nucleoli (Raska et al., 1990 ; Lafarga et al., 1991 ; Malatesta et al., 1994 ; Ochs et al., 1994 ; Bohmann et al., 1995 ; Lyon et al., 1997 ). Thus, coiled bodies could conceivably be important in the synthesis, modification, and transport of snoRNAs and other nuclear RNAs.ACKNOWLEDGMENTS Special thanks to Joseph Gall for guidance in the preparation of oocyte nuclear spreads and for the generous loan of a specialized rotor. We also kindly thank Elisa Izzauralde (DHFR mRNA and tRNA), Brenda Peculis (U8), E. Stuart Maxwell (U14), and Paul Romaniuk (5S rRNA) for providing plasmids and Reinhard Lührmann (m2,2,7G cap), Elsebet Lund (m7G cap), Joseph Gall (p80 coilin mAb H1), and K. Michael Pollard and Eng Tan (fibrillarin mAbs 72B9 and 17C12) for providing antibodies used in this study. We are grateful to Claiborne Glover III, Pascale Legault, and Michael McEachern for critical reading of this manuscript and to James Griffith for technical assistance in generating many of the mutant templates used in this work. This work was supported in part by a University of Georgia Faculty Research Grant to R.T. and by a Basil O’Conner Starter Scholar Research Award from the March of Dimes Birth Defects Foundation, an American Cancer Society grant (NP-84149), and a National Science Foundation grant (RR61345F) to M.P.T. REFERENCES
|
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||
Cell. 1989 Feb 10; 56(3):379-90.
[Cell. 1989]Cell. 1992 Jul 10; 70(1):127-38.
[Cell. 1992]Annu Rev Cell Dev Biol. 1995; 11():93-121.
[Annu Rev Cell Dev Biol. 1995]Trends Biochem Sci. 1995 Jul; 20(7):261-4.
[Trends Biochem Sci. 1995]Annu Rev Biochem. 1995; 64():897-934.
[Annu Rev Biochem. 1995]Cell. 1996 Sep 6; 86(5):823-34.
[Cell. 1996]EMBO J. 1989 Dec 20; 8(13):4015-24.
[EMBO J. 1989]Mol Cell Biol. 1990 Jan; 10(1):430-4.
[Mol Cell Biol. 1990]EMBO J. 1991 Sep; 10(9):2645-51.
[EMBO J. 1991]J Biol Chem. 1998 Jun 26; 273(26):16453-63.
[J Biol Chem. 1998]RNA. 1997 Jan; 3(1):17-26.
[RNA. 1997]Genes Dev. 1993 Jul; 7(7A):1176-90.
[Genes Dev. 1993]Cell. 1996 Jun 28; 85(7):1077-88.
[Cell. 1996]RNA. 1996 Feb; 2(2):118-33.
[RNA. 1996]Mol Cell Biol. 1998 Jun; 18(6):3431-44.
[Mol Cell Biol. 1998]J Mol Biol. 1996 Jun 21; 259(4):645-54.
[J Mol Biol. 1996]J Mol Biol. 1997 Oct 31; 273(3):552-71.
[J Mol Biol. 1997]RNA. 1998 Mar; 4(3):285-302.
[RNA. 1998]Mol Cell Biol. 1987 Aug; 7(8):2899-913.
[Mol Cell Biol. 1987]Nucleic Acids Res. 1988 Mar 25; 16(5):2127-48.
[Nucleic Acids Res. 1988]RNA. 1998 Jul; 4(7):789-800.
[RNA. 1998]Mol Biol Cell. 1998 Oct; 9(10):2973-85.
[Mol Biol Cell. 1998]EMBO J. 1998 Jul 1; 17(13):3747-57.
[EMBO J. 1998]Nucleic Acids Res. 1992 Oct 25; 20(20):5435-42.
[Nucleic Acids Res. 1992]Eur J Biochem. 1992 Jun 1; 206(2):391-400.
[Eur J Biochem. 1992]Genes Dev. 1994 Sep 15; 8(18):2241-55.
[Genes Dev. 1994]EMBO J. 1995 Oct 2; 14(19):4860-71.
[EMBO J. 1995]Genes Dev. 1993 Oct; 7(10):1898-908.
[Genes Dev. 1993]J Cell Biol. 1994 Mar; 124(5):627-35.
[J Cell Biol. 1994]Genes Dev. 1993 Oct; 7(10):1898-908.
[Genes Dev. 1993]Methods Cell Biol. 1998; 53():559-89.
[Methods Cell Biol. 1998]J Cell Biol. 1994 Mar; 124(5):627-35.
[J Cell Biol. 1994]Cell. 1978 Nov; 15(3):1077-86.
[Cell. 1978]Biochemistry. 1982 Jun 8; 21(12):2922-8.
[Biochemistry. 1982]EMBO J. 1983; 2(7):1129-35.
[EMBO J. 1983]Arthritis Rheum. 1987 Jul; 30(7):793-800.
[Arthritis Rheum. 1987]Methods Cell Biol. 1991; 36():149-66.
[Methods Cell Biol. 1991]RNA. 1996 Aug; 2(8):811-23.
[RNA. 1996]Chromosoma. 1997 Jun; 105(7-8):438-43.
[Chromosoma. 1997]Clin Exp Immunol. 1994 May; 96(2):285-91.
[Clin Exp Immunol. 1994]J Cell Biol. 1993 Aug; 122(4):767-73.
[J Cell Biol. 1993]Science. 1994 May 13; 264(5161):959-61.
[Science. 1994]EMBO J. 1995 Oct 2; 14(19):4860-71.
[EMBO J. 1995]Cell. 1985 Jan; 40(1):111-8.
[Cell. 1985]Genes Dev. 1993 Oct; 7(10):1898-908.
[Genes Dev. 1993]EMBO J. 1989 Dec 20; 8(13):4179-87.
[EMBO J. 1989]EMBO J. 1995 Oct 2; 14(19):4860-71.
[EMBO J. 1995]Biochemistry. 1982 Jun 8; 21(12):2922-8.
[Biochemistry. 1982]EMBO J. 1983; 2(7):1129-35.
[EMBO J. 1983]EMBO J. 1991 Sep; 10(9):2645-51.
[EMBO J. 1991]Arthritis Rheum. 1987 Jul; 30(7):793-800.
[Arthritis Rheum. 1987]Cell. 1990 Mar 23; 60(6):897-908.
[Cell. 1990]EMBO J. 1990 Jul; 9(7):2299-308.
[EMBO J. 1990]EMBO J. 1991 Dec; 10(13):4231-9.
[EMBO J. 1991]EMBO J. 1995 Sep 1; 14(17):4350-6.
[EMBO J. 1995]Methods Cell Biol. 1991; 36():149-66.
[Methods Cell Biol. 1991]EMBO J. 1995 Sep 1; 14(17):4350-6.
[EMBO J. 1995]J Mol Biol. 1997 Oct 31; 273(3):552-71.
[J Mol Biol. 1997]EMBO J. 1995 Oct 2; 14(19):4860-71.
[EMBO J. 1995]RNA. 1997 Jan; 3(1):17-26.
[RNA. 1997]Annu Rev Biochem. 1995; 64():897-934.
[Annu Rev Biochem. 1995]Curr Opin Cell Biol. 1997 Jun; 9(3):337-42.
[Curr Opin Cell Biol. 1997]Mol Cell Biol. 1987 Aug; 7(8):2899-913.
[Mol Cell Biol. 1987]Nucleic Acids Res. 1988 Mar 25; 16(5):2127-48.
[Nucleic Acids Res. 1988]Nucleic Acids Res. 1991 Sep 25; 19(18):4891-4.
[Nucleic Acids Res. 1991]Genes Dev. 1997 Apr 1; 11(7):941-56.
[Genes Dev. 1997]J Cell Biol. 1994 Dec; 127(6 Pt 1):1505-14.
[J Cell Biol. 1994]Cold Spring Harb Symp Quant Biol. 1993; 58():747-54.
[Cold Spring Harb Symp Quant Biol. 1993]Mol Cell Biol. 1987 Aug; 7(8):2899-913.
[Mol Cell Biol. 1987]Nucleic Acids Res. 1988 Mar 25; 16(5):2127-48.
[Nucleic Acids Res. 1988]Genes Dev. 1993 Jul; 7(7A):1176-90.
[Genes Dev. 1993]Nucleic Acids Res. 1994 Aug 25; 22(16):3354-64.
[Nucleic Acids Res. 1994]J Mol Biol. 1997 Oct 31; 273(3):552-71.
[J Mol Biol. 1997]Mol Biol Cell. 1998 Oct; 9(10):2973-85.
[Mol Biol Cell. 1998]J Mol Biol. 1997 Oct 31; 273(3):552-71.
[J Mol Biol. 1997]Mol Cell Biol. 1998 Jun; 18(6):3431-44.
[Mol Cell Biol. 1998]Mol Biol Cell. 1998 Oct; 9(10):2973-85.
[Mol Biol Cell. 1998]EMBO J. 1998 Jun 1; 17(11):3176-87.
[EMBO J. 1998]RNA. 1996 Feb; 2(2):118-33.
[RNA. 1996]EMBO J. 1995 Oct 2; 14(19):4860-71.
[EMBO J. 1995]Genes Dev. 1992 Jun; 6(6):1120-30.
[Genes Dev. 1992]EMBO J. 1995 Sep 1; 14(17):4350-6.
[EMBO J. 1995]J Mol Biol. 1996 Jun 21; 259(4):645-54.
[J Mol Biol. 1996]J Mol Biol. 1997 Oct 31; 273(3):552-71.
[J Mol Biol. 1997]RNA. 1998 Jul; 4(7):789-800.
[RNA. 1998]Mol Biol Cell. 1998 Oct; 9(10):2973-85.
[Mol Biol Cell. 1998]EMBO J. 1998 Jul 1; 17(13):3747-57.
[EMBO J. 1998]EMBO J. 1989 Oct; 8(10):3113-9.
[EMBO J. 1989]Science. 1994 May 13; 264(5161):959-61.
[Science. 1994]EMBO J. 1995 Oct 2; 14(19):4860-71.
[EMBO J. 1995]RNA. 1998 Jul; 4(7):789-800.
[RNA. 1998]Annu Rev Biochem. 1995; 64():897-934.
[Annu Rev Biochem. 1995]EMBO J. 1991 Sep; 10(9):2645-51.
[EMBO J. 1991]Mol Cell Biol. 1992 Oct; 12(10):4456-63.
[Mol Cell Biol. 1992]Genes Dev. 1994 Sep 15; 8(18):2241-55.
[Genes Dev. 1994]EMBO J. 1996 Mar 1; 15(5):1121-31.
[EMBO J. 1996]Biochimie. 1996; 78(6):443-56.
[Biochimie. 1996]Chromosoma. 1991 Dec; 101(3):133-40.
[Chromosoma. 1991]Eur J Cell Biol. 1991 Dec; 56(2):178-86.
[Eur J Cell Biol. 1991]Mol Biol Cell. 1994 Dec; 5(12):1289-99.
[Mol Biol Cell. 1994]EMBO J. 1998 Jul 1; 17(13):3747-57.
[EMBO J. 1998]Mol Biol Cell. 1994 Jun; 5(6):633-44.
[Mol Biol Cell. 1994]J Cell Biol. 1991 May; 113(3):465-83.
[J Cell Biol. 1991]J Cell Biol. 1992 Apr; 117(1):1-14.
[J Cell Biol. 1992]Proc Natl Acad Sci U S A. 1992 Jan 1; 89(1):305-8.
[Proc Natl Acad Sci U S A. 1992]J Cell Biol. 1993 May; 121(4):715-27.
[J Cell Biol. 1993]RNA. 1996 Aug; 2(8):811-23.
[RNA. 1996]Trends Cell Biol. 1993 Jun; 3(6):198-204.
[Trends Cell Biol. 1993]Dev Genet. 1995; 16(1):25-35.
[Dev Genet. 1995]J Cell Biochem. 1998 Apr 1; 69(1):1-12.
[J Cell Biochem. 1998]J Cell Biochem. 1998 Apr 1; 69(1):1-12.
[J Cell Biochem. 1998]J Struct Biol. 1990 Jul-Sep; 104(1-3):120-7.
[J Struct Biol. 1990]J Comp Neurol. 1991 Jun 15; 308(3):329-39.
[J Comp Neurol. 1991]Exp Cell Res. 1994 Apr; 211(2):415-9.
[Exp Cell Res. 1994]J Cell Sci. 1994 Feb; 107 ( Pt 2)():385-99.
[J Cell Sci. 1994]Biochemistry. 1982 Jun 8; 21(12):2922-8.
[Biochemistry. 1982]EMBO J. 1983; 2(7):1129-35.
[EMBO J. 1983]Arthritis Rheum. 1987 Jul; 30(7):793-800.
[Arthritis Rheum. 1987]Clin Exp Immunol. 1994 May; 96(2):285-91.
[Clin Exp Immunol. 1994]J Cell Biol. 1993 Aug; 122(4):767-73.
[J Cell Biol. 1993]J Cell Biol. 1994 Mar; 124(5):627-35.
[J Cell Biol. 1994]