• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Dev Cell. Author manuscript; available in PMC Jul 1, 2009.
Published in final edited form as:
PMCID: PMC2528248
NIHMSID: NIHMS56434

The chirality of gut rotation derives from left-right asymmetric changes in the architecture of the dorsal mesentery

Summary

We have investigated the structural basis by which the counter-clockwise direction of the amniote gut is established. The chirality of midgut looping is determined by left-right asymmetries in the cellular architecture of the dorsal mesentery, the structure that connects the primitive gut tube to the body wall. The mesenchymal cells of the dorsal mesentery are more condensed on the left side than on the right and, additionally, the overlying epithelium on the left side exhibits a columnar morphology, in contrast to a cuboidal morphology on the right. These properties are instructed by a set of transcription factors: Pitx2 and Isl1 specifically expressed on the left side, and Tbx18 expressed on the right, regulated downstream of the secreted protein Nodal which is present exclusively on the left side. The resultant differences in cellular organization cause the mesentery to assume a trapezoidal shape, tilting the primitive gut tube leftward.

Keywords: left-right asymmetry, patterning, gut looping, dorsal mesentery, Nodal, Pitx2, Islet1, Tbx18

Introduction

There has been great progress in the last decade in our knowledge of the upstream molecular mechanisms controlling morphological left-right asymmetry. The initial left-right symmetry-breaking event in amniotes appears to take place in or around a small region along the midline of the gastrulating embryo known as Hensen’s Node. Small domains of asymmetric gene activity adjacent to the Node ultimately lead to the much broader expression of Nodal, a gene encoding a TGFβ–related secreted protein throughout the left lateral plate mesoderm (Levin et al., 1995). The left-sided expression of Nodal, conserved in all chordates, is transient (Collignon et al., 1996; Levin et al., 1995; Lowe et al., 1996) due to the activation of its own inhibitor, a gene called Lefty (Meno et al., 1999). However, the left side positional information conferred by exposure to Nodal is maintained cell autonomously through the expression of downstream transcription factors, such as the paired-type homeobox gene Pitx2. Pitx2 is expressed broadly and continuously in the left lateral plate mesoderm and subsequently on the left side of developing organs during asymmetric morphogenesis (Campione et al., 1999; Logan et al., 1998; Piedra et al., 1998; Ryan et al., 1998; St Amand et al., 1998; Yoshioka et al., 1998). This persistent expression of Pitx2 is in marked contrast to the transient nature of Nodal expression in the left lateral plate mesoderm (Collignon et al., 1996; Lowe et al., 1996), suggesting that the maintenance of Pitx2 expression is independent of Nodal signaling. Indeed, transgenic analyses of the cis-regulatory elements that govern the left-specific expression of Pitx2 identified the homeodomain transcription factor Nkx2.5 as both necessary and sufficient for maintaining the later phases of asymmetric Pitx2 expression in the heart and foregut (Shiratori et al., 2001). However, the maintenance of Pitx2 in more posterior regions is not understood.

Functional studies have suggested a critical role for Pitx2 specifically in the left-right patterning of the gut. Overexpression studies in chick and Xenopus demonstrate that Pitx2, when delivered ectopically to the right side of the embryo, is sufficient to randomize gut rotation (Campione et al., 1999; Logan and Tabin, 1998; Ryan et al., 1998; Yu et al., 2001), while gene targeting in the mouse reveals a requirement for Pitx2 function for the normal left-right development of both the stomach (Bamforth et al., 2004) and the intestine (Liu et al., 2001).

In spite of these advances, the downstream cellular mechanisms responsible for asymmetric morphogenesis remain very poorly understood. To investigate the cellular basis for asymmetric organogenesis, we decided to focus on the midgut, which forms the small intestine. Unlike other organs such as the heart or stomach that exhibit complex patterns of asymmetric growth, ballooning, and regional differentiation in addition to looping, the midgut, to a first approximation, remains a relatively simple cylindrical tube throughout its morphogenesis. Thus, the problem of left-right asymmetric morphogenesis in the midgut can be essentially reduced to the single question of how the directional coiling of this structure is specified.

The cellular mechanics of asymmetric gut morphogenesis have been previously explored in Xenopus and in zebrafish. In Xenopus there is an asymmetric, proliferation-independent, elongation of the right side of the gut tube producing concavities on the left side (Muller et al., 2003). The zebrafish gut tube, however, is displaced by asymmetric forces originating outside the gut tube from an epithelialized mesenchyme, which expands in different orientations on the left side versus the right (Horne-Badovinac et al., 2001; Horne-Badovinac et al., 2003). In both cases, asymmetric morphogenesis is regulated by the left-sided signal Nodal and the left-sided transcription factor Pitx2 (Horne-Badovinac et al., 2003; Muller et al., 2003). Yet neither of these mechanisms appear to be responsible for gut looping in birds and mammals. The gut tube in higher vertebrates appears to remain symmetrical in cross-section throughout the looping process, arguing against the differential elongation observed in Xenopus, and is not bordered by an epithelialized mesoderm as in zebrafish.

In amniotes, the primitive gut tube forms during body folding, when the endodermal layer of the trilaminar embryo is transformed into an elongated cylinder. The gut endoderm recruits the adjacent splanchnopleural mesoderm, one of two layers of lateral plate mesoderm, to form the smooth muscle outer layers of the gut (Figure 1A). As this process is completed, there remains a neck of splanchnopleural mesoderm, called the “dorsal mesentery”, connecting the gut tube to the dorsal portion of the body (Figure 1B,C). Thus, seen from the side, the primitive gut is a tube suspended within the coelom by the dorsal mesentery (Figure 1B). This tube is partitioned along the anterior-posterior axis into three segments: the foregut, the midgut, and the hindgut. The continued elongation of the gut tube drives the formation of a hairpin loop in the midgut region, which corresponds primarily to the future small intestine (Figure 1D). As it grows, this hairpin loop moves out of the body cavity. Concomitant with its formation, the loop undergoes an asymmetric, 90° counterclockwise rotation (Figure 1E). Subsequently, the loop retracts and simultaneously undergoes a further 180° counterclockwise rotation (Figure 1F) that properly positions the small intestine anlagen with respect to the future large intestine, a hindgut derivative (Figure 1G).

Figure 1
The formation and rotation of the gut tube

Since the midgut tube itself appears to remain a symmetrical cylinder (a left-right symmetrical oval in cross-section) throughout this process (Supplemental Figure 1), asymmetric growth of the gut tube itself would not seem to be responsible for directing its morphogenesis. We, therefore, turned our attention to the only connection of the gut tube to the body wall: the dorsal mesentery.

Results

Cellular asymmetries in the dorsal mesentery

To understand the cellular events responsible for determining the direction of gut rotation, we wanted to identify the time morphological asymmetries are first evident in the developing midgut. Since the dorsal mesentery forms the lone connection of the primitive midgut tube to the body wall, we focused our attention on this structure, hypothesizing that it might play a role in creating the torque necessary to direct gut rotation. We therefore examined the cellular morphology of the emerging dorsal mesentery, a feature that, perhaps surprisingly, has not been previously described. At HH (Hamburger and Hamilton, 1951) stage 20, shortly after the dorsal mesentery can first be discerned morphologically, striking left-right differences arise in both its mesenchymal and epithelial components (Figure 2A,B). The mesenchymal cells on the right side of the mesentery are more sparse while the corresponding cells on the left side of the dorsal mesentery appear much more densely packed.

Figure 2
Morphological asymmetry in the midgut dorsal mesentery regulated by Pitx2 and Isl1

As a side note, the dorsal mesentery provides a path for the migration of primordial cells to the germinal ridge and of neural crest cells to the developing gut, in addition to its role in attaching the developing gut to the body wall. Interestingly, in spite of the quite striking difference in cell density observed in the mesenchyme of the left and right sides of the dorsal mesentery, we do not find any situs distinction in the preference of cells migrating through the mesentery at this stage; for example, Vasa-positive primordial germ cells (Supplemental Figure 2).

In addition to the differences in mesenchymal architecture on the left and right sides of the dorsal mesentery, the left side of the epithelium is more columnar in morphology while the equivalent cells on the contralateral side have a more flattened cuboidal appearance (Figure 2A,B; Figure 3A,B). To obtain quantitative data for the left-right differences in epithelial cell shape, a mid-caudal section was chosen from each of four embryos and the height of every epithelial cell in the dorsal mesentery was measured (Figure 4A). The height of the epithelial cells on the left averaged 10.7 ± 2.2 microns, while the height of the epithelial cells on the right was 4.2 ± 1.0 microns (p<1.01×10−26). To determine the width of the epithelial cells, the entire length of the dorsal mesentery was measured on the same three mid-caudal sections, the number of cells was counted and the length per cell was calculated (Figure 4B). In addition to being taller, the epithelial cells on the left are thinner, with a width of 3.3 ± 0.3 microns, compared to a width of 5.4 ± 0.3 microns for the epithelial cells on the right (p<1.98×10−4). Very similar results were obtained when comparing epithelial cells on the left and the right at a mid-rostral level (Figure 4E,F).

Figure 3
Cellular asymmetries in the dorsal mesentery
Figure 4
Analysis of changes in epithelial cell shape and condensation of the mesenchyme

To characterize the differences in cell morphology in greater detail, we stained sections of the dorsal mesentery with phalloidin and examined them under a confocal microscope to visualize the actin cytoskeleton within the cells of this structure. While there is no difference in the staining within the mesenchynal cells on the left and the right, there is a striking difference in the epithelium on the two sides. The left, more columnar epithelium displays a high level of phalloidin staining across the entire apical border of the cells; while on the right, where cells are flatter, the phalloidin staining is less focally localized (Figure 3C).

In order to highlight the morphology of individual cells within the dorsal mesentery, we adapted in ovo electroporation to deliver a gfp-expression construct. Electrodes were placed on either side of a day 2 chick embryo and DNA was injected into the coelomic cavity. Strong gfp fluorescence could be observed in the dorsal mesentery and the dorsal portion of the gut mesoderm within 12 hours of electroporation (Figure 3D) and it was maintained for at least 36 hours (Figure 3E). Confocal microscopy of electroporated dorsal mesentery revealed additional information about the cell morphology. When viewed from the surface at 40X magnification, the epithelium on the right side exhibits changes in morphology along the dorsal-ventral axis. Both dorsal and ventral epithelial cells are cuboidal in shape, while those in the middle of the dorsal-ventral axis, where the bend of the mesentery is greatest, are squamous (Figure 3F). In contrast, the cells on the left side of the dorsal mesentery are consistently columnar along the dorsoventral axis when viewed from the surface (data not shown). The cells of the left epithelium are, however, smaller in cross-section. This can best be appreciated when the cells are viewed from the side under the confocal microscope. The left epithelial cells are tall thin columnar cells, in many cases with a bottle-cell morphology (Figure 3G) while the epithelial cells on the right side are relatively broader, more irregular and cuboidal (Figure 3M). Staining for F-actin with phalloidin (Figure 3C,H) or for β-catenin by immunohistochemistry (Figure 3I) indicate that the epithelial cells on the left side are highly polarized, with strong apical staining. In contrast, both F-actin (Figure 3C,N) and β-catenin (Figure 3O) show diffuse staining in cells of the right epithelium. Interestingly, no differences were observed in individual mesenchymal cell morphology on the left or right sides (data not shown) and indeed all the mesenchymal cells display a very similar shape to the epithelial cells on the right side (Figure 3M and data not shown). Moreover, the mesenchymal cells display the same diffuse F-actin and β-catenin staining as the right epithelial cells, raising the possibility that the cells on the right surface of the dorsal mesentery might have entirely lost their epithelial character. To test this, we examined the dorsal mesentery at a very high resolution using electron microscopy.

Under the transmission electron microscope, the mesenchymal cells were seen to be more densely packed on the left than on the right, however, once again, no consistent differences in cell morphology were observed in the mesenchymal cell populations on the two sides (Figure 3J,P; 2,900X). In contrast, the epithelia are seen to be radically different on the two sides. The left dorsal mesentery epithelium not only has a very regular, highly polarized columnar morphology (Figure 3J,K) but it also displays a clearly visible underlying basement membrane (false-colored blue, Figure 3J). In contrast, on the right side of the dorsal mesentery the cells are shorter, wider, and irregular in shape and no basement membrane is seen (Figure 3P,Q). Indeed, the appearance of the epithelium on the right is disorganized enough that, as noted above, at first glance one might wonder if the cells even maintain an epithelial character. However, other hallmarks of epithelia are indeed found on both the right and left sides, including tight junctions and desmosomes (Figure 3L,R; 23,000X).

At stage 21, as the dorsal mesentery starts to elongate, the left-right morphological differences in both the epithelium and mesenchyme are initially maintained. By stage 22, however, these cellular asymmetries are greatly reduced, and both the mesenchymal and epithelial components of the dorsal mesentery appear more uniform on the left and right sides, although the tilt of the gut tube, initiated at earlier stages, is maintained (Figure 4H). Importantly, we do not see any left-right asymmetries in the gut tube itself at any stage examined, including the morphology of the outer coelomic epithelium, the density of the mesenchyme or the morphology of the endodermal lining.

During the short time window when the cellular asymmetries are seen in the dorsal mesentery (between stages 20–22, approximately 12 hours), the net result of the more compacted mesenchyme and the presence of a columnar epithelial morphology on the left and more dispersed mesenchyme and cuboidal epithelial morphology on the right is to expand the right side of the dorsal mesentery relative to the left. Thus, the mesentery takes on a trapezoidal rather than a rectangular shape in cross-section (Figure 2C). As a consequence, the midgut suspended from the dorsal mesentery acquires a distinct tilt to the left (Figure 1A,C), presaging the counterclockwise rotation of the gut tube. The extent of tilting is greatest in the central region of the midgut, where the hairpin loop will subsequently originate (20–38 degree tilt) and is somewhat less pronounced at the rostral and caudal ends of the midgut (11–18 degree tilt) (Figure 1J, angle measured every 25 microns along the approximately 240 micron midgut of four different embryos).

To get an indication of whether the differences in cell morphology we observed are specific to avian gut morphogenesis or are conserved in all amniotes, we also examined the histology of the dorsal mesentery in the mouse at E10.5 – E10.75, when the midgut tube is first forming. As in the chick, the mesenchymal cells are more densely packed on the left than on the right and the epithelium on the left side is more columnar in appearance (Figure 5A and Supplemental Figure 3). These cellular differences are more pronounced toward the rostral end of the murine midgut mesentery. Moreover, the differences are even more transient than in the chick and are essentially unobservable by E11.0 (data not shown). The similar histologies found in the chick and mouse midgut mesentery (Figure 1B, Figure 5A) suggest that similar mechanisms are used to asymmetrically displace the gut tube in these two species.

Figure 5
Pitx2 is necessary as well as sufficient for specifying the unique morphology and gene expression pattern on the left side of the dorsal mesentery

Left-right differences in the dorsal mesentery are attributable to changes in cellular properties on the right

To understand the genesis of the left-right differences in the cellular morphology of the dorsal mesentery, we examined this structure at HH stage 19, when it is first forming, concomitant with the closure of the gut tube. At this earlier time, the cells on both the left and the right appear similar to each other, with both sides exhibiting columnar epithelium and densely packed mesenchyme (Figure 4G). Thus, the asymmetric shape of the dorsal mesentery appears to be driven by changes taking place on the right side.

In principle, the emerging difference in cell density of the mesenchyme on the left versus the right side of the dorsal mesentery at HH stage 20 could be attributable to left-right differences in cell number (resulting from differential proliferation or death), or alternatively it could reflect changes in compaction of similar numbers of cells on the left and right sides. To differentiate between these possibilities we first examined proliferation in the dorsal mesentery at HH stage 19. Nuclei were stained with DAPI and the percentage of cells undergoing mitosis was determined by staining for phosphorylated Histone H3 (Figure 2J). No differences were observed in the rate of proliferation on the right and left sides of the dorsal mesentery (4.9 +/− 1.2% on the left, 5.2 +/− 1.4% on the right, n=18; 3 embryos, 6 sections from each). We next examined cell death during the formation of the midgut, however, we did not detect any apoptosis (in 10 sections from each of 3 embryos) as determined by TUNEL staining (Figure 2K) on either side of the dorsal mesentery (Figure 2L), although other regions of the embryo known to exhibit cell death, such as the mesonephros, showed the expected TUNEL staining (inset, Figure 2K). These data suggested that the numbers of cells in the left and right domains are likely to be similar. To directly examine this, we manually counted the number of DAPI stained nuclei in the left and the right domains of the dorsal mesentery after the changes in cell density had already taken place, at Stage 21 (Figure 2I). The border between the left and right domains of the dorsal mesentery can easily be identified in histological sections (Figure 2B). Sections were selected from evenly spaced anterior-posterior levels within the gut spanning the axial distance from the extreme anterior to posterior midgut (n = 36; 9 independent embryos, 4 sections per embryo). From these left and right side cell counts, we calculated the ratio of left cells to right cells for each section and then calculated the average ratio for all of the sections (see Experimental Procedures). The data indicate, with 95% confidence, that the ratio of left cells to right cells is between 0.99 and 1.2. These results support the conclusion that the observable left-right difference in cell density within the dorsal mesentery mesenchyme stems from changes in the packing of similar numbers of cells on the left and right sides.

Asymmetric expression of transcription factors in the dorsal mesentery

We next wanted to identify genes asymmetrically expressed in the dorsal mesentery that could potentially control the differential cellular properties we observed, both to connect the asymmetric cellular changes to known left-right signals, and to provide tools for manipulating and understanding these cellular properties. The left-sided transcription factor Pitx2 was an obvious candidate in this regard. We carried out in situ hybridization of histological sections of the developing chick midgut to obtain detailed information on Pitx2 expression at the earliest stages of gut tube formation and intestinal looping. Pitx2 is robustly expressed throughout the left side of both the gut tube and prospective dorsal mesentery at HH stage 19 (data not shown). By HH stage 21, when we observe maximal differences in the cellular organization of the dorsal mesentery, Pitx2 is strongly down-regulated in many tissues, including within the mesodermal component of the gut (Figure 6A). However, there is robust maintenance of Pitx2 expression extending along the entire dorsal-ventral length of the dorsal mesentery at every anterior-posterior level of the midgut (Figure 6A and data not shown). Note that the cellular asymmetries and the tilt of the gut tube described above are difficult to discern in embryos that have been processed for in situ hybridization, including proteinase K digestion. Nonetheless, condensation of the mesenchyme on the left is reflected in the narrower width of Pitx2–positive domain on the left, relative to the Pitx2–negative domain on the right.

Figure 6
Asymmetric expression of transcription factors in the dorsal mesentery is regulated by the Nodal-Pitx2 pathway

Isl1 is a LIM homeodomain-containing transcription factor, also described as being expressed in a left-right asymmetric pattern in the developing gut, although the precise location of its expression within the gut-associated tissues had not been analyzed (Yuan and Schoenwolf, 2000). At HH stage 19, when Pitx2 is already robustly expressed in the developing gut, Isl1 is undetectable (data not shown). However, at HH stage 21, we confirmed by whole mount in situ hybridization the previously described foregut expression of Isl1 and also observed prominent expression in the developing mid- and hindgut (data not shown). Using in situ hybridization on histological sections of the HH stage 21 midgut, we found that Isl1 expression in the midgut is completely restricted to the left side of the dorsal mesentery, directly abutting the midgut mesoderm (Figure 6B). However, unlike Pitx2, Isl1 expression only encompasses the full dorsal-ventral extent of the left dorsal mesentery in the extreme anterior end of the midgut where the future duodenum intersects the stomach. At more posterior levels there is an increasing restriction to the ventral-most aspect of the dorsal mesentery (Supplemental Figure 4). Isl1 expression is noticeably absent from regions of asymmetric Pitx2 expression outside of the dorsal mesentery.

A third asymmetrically expressed transcription factor, the T-box containing transcription factor Tbx18, was kindly pointed out to us by Malcom Logan. Whole mount in situ hybridization reveals that, in addition to other previously reported domains of expression in the early vertebrate embryo (Begemann et al., 2002; Haenig and Kispert, 2004; Kraus et al., 2001; Tanaka and Tickle, 2004), Tbx18 is expressed asymmetrically, very specifically in the developing midgut (data not shown). Section in situ hybridization at HH stage 22 indicates that Tbx18 is expressed asymmetrically, with a domain of robust expression localized to the right side of the dorsal mesentery and only weak expression present on the left, thus having a reverse bias from the left-sided transcription factors Pitx2 and Isl1 (Figure 6C).

Regulation of asymmetric gene expression within the dorsal mesentery

Previous work indicates that misexpression of the TGFβ family member Nodal on the right side of the embryo is sufficient to alter organ situs by activating a left-specific genetic pathway including Pitx2 (Campione et al., 1999; Levin et al., 1997; Logan and Tabin, 1998; Piedra et al., 1998; Sampath et al., 1997), although this pathway had not been previously examined in the dorsal mesentery. We used retroviral misexpression to confirm that ectopic Nodal and Pitx2 are capable of expanding left-right specification in the form of bilateral Isl1 expression and loss of Tbx18 expression. Following in ovo misexpression of RCAS-Nodal at HH Stage 4 (Levin et al., 1997), we indeed observed bilateral dorsal mesentery expression of Pitx2 (Figure 6E) (n=3 of 7 injected embryos) and Isl1 (Figure 6F) (n=3 of 6 injected embryos) as well as loss of right-sided Tbx18 expression (Figure 6G) (n=4 of 5). Similarly, following infection of the splanchnic mesoderm with RCAS-Pitx2c (the asymmetrically-expressed isoform of Pitx2 (Yu et al., 2001), injected into the coelomic cavity at HH Stage 7, we observed bilateral expression of Isl1 (Figure 6H) (n=4 of 5), as well as loss of normal right-sided pattern of Tbx18 expression (Figure 6I) (n=4 of 6) in the dorsal mesentery of the developing midgut.

Although Pitx2 expression in the splanchnic mesoderm of the gut is initiated prior to and in a broader domain than that of Isl1, supporting the notion that it acts upstream, it was conceivable that Isl1 could feed back to maintain Pitx2 expression within the dorsal mesentery domain. To test this possibility, we infected the right coelomic cavity of HH Stage 7 embryos with RCAS-Isl1. Following Isl1 misexpression, embryos display bilateral expression of Pitx2 throughout the midgut dorsal mesentery and in the superficial epithelium that lines the coelomic surface of the developing intestine, in a mirror image of wild type expression (Figure 6J, n=8 of 9). Thus, Isl1, though acting downstream of Pitx2 in the developing gut, also appears to be involved in a positive feedback loop supporting Pitx2 expression. It should be noted, however, that the domain of Isl1 expression is more limited than Pitx2 expression within the dorsal mesentery. Thus, additional factors must also act to maintain Pitx2 expression. As expected, in addition to inducing ectopic Pitx2 expression, infection with RCAS-Isl1 results in loss of the normal right-sided pattern of Tbx18 expression within the mesenchyme of the dorsal mesentery (Figure 6K) (n=8 of 9). While the penetrance of altered gene expression was less than 100% in each of these experiments, the embryos showing molecular phenotypes correlate with those in which the retrovirus successfully infected the dorsal mesentery, as seen in serial sections stained with an antibody, 3C2, which recognizes a retroviral protein (Figure 6D and data not shown). Finally, we also tested whether, in a reciprocal fashion, Tbx18 is capable of down-regulating either Pitx2 or Isl1. However, following viral misexpression of Tbx18, neither of the transcription factors expressed on the left side exhibited altered expression (data not shown).

Pitx2 and Islet1 are sufficient to specify cellular properties within the dorsal mesentery

We next asked whether the transcription factors we found to be asymmetrically expressed in the dorsal mesentery were responsible for controlling the differences in cellular morphology we observed in that structure. Following either RCAS-Isl1 (Figure 2D,E) or RCAS-Pitx2 infection (Figure 2G,H) targeted to the right coelom, the characteristic left-right asymmetry in the dorsal mesentery is lost and instead is replaced with a more uniform, bilaterally symmetric morphology. In place of the loose, mesenchymal characteristics normally present on the right side, the mesenchymal cells are densely distributed throughout the dorsal mesentery and have an architecture that approximates the left side of the wild type dorsal mesentery. Moreover, the distinct cuboidal morphology of the epithelium of the dorsal mesentery on the right side is replaced with cells that appear more columnar. Indeed, both the height and width of the epithelial cells become statistically indistinguishable on the left and right sides of the dorsal mesentery (Figure 4C,D; data combined for measurements taken from mid-caudal sections of two Pitx2 infected and two Islet-1-infected embryos). In addition to being the same on the left and right sides, the height of the columnar epithelium on either side of the infected dorsal mesentery is also statistically indistinguishable from the height of the normal left epithelium (p>0.158) while it is significantly higher than the flattened cuboidal epithelium normally seen on the right (p<3.97×10−18). Consequently, the stark left-right differences normally present within the coelomic epithelium are extinguished and we observe a morphology that is homogeneous between the left and right sides. These morphological changes are observed in the dorsal mesentery throughout the rostrocaudal extent of the midgut (data not shown).

Thus, following Pitx2 or Isl1 misexpression, the mesenchyme remains condensed and the epithelium is columnar on both sides (as they are at the start of dorsal mesentery formation). As a result, the width of the dorsal mesentery becomes narrower than in uninfected embryos and, in cross-section, the overall structure resembles a symmetric rectangle rather than a trapezoid (Figure 2F,I). This effect is seen throughout the midgut, including both caudal (Figure 2D,E,F) and rostral (Figure 1G,H,I) levels. As a consequence, the gut tube suspended from the dorsal mesentery does not tilt to near the extent seen in wild type and moreover, the slight tilts that are observed are random in their orientation to the right or the left side (Figure 1D,G,J).

In contrast to the misexpression of Pitx2 and Isl1, infection with a viral vector containing Tbx18 does not alter the morphology of the cells on the left side of the dorsal mesentery (data not shown).

Pitx2 and Isl1 are necessary for left-specific molecular and cellular properties within the dorsal mesentery

Misexpression data (described above) indicate that Pitx2 and Isl1 expression is sufficient to generate and maintain the distinct cellular morphologies normally observed in the epithelium and mesenchyme on the left side of the dorsal mesentery. To determine whether Pitx2 expression is also necessary for the cellular architecture of the left side of the dorsal mesentery, we examined this structure in E10.75 mouse embryos deficient for Pitx2. Similar analysis of the necessity for Isl1 function was precluded, as mice lacking functional Isl1 exhibit severe developmental abnormalities and arrest early in embryogenesis. While the dorsal mesentery in Pitx2 heterozygotes (n=2 of 2) shows the same asymmetric cellular histology as in wild type embryos (n=4 of 4; Figure 1L), the dorsal mesentery in Pitx2 null embryos is left-right symmetric in appearance (n=2 of 2; Figure 1M). The dorsal mesentery in these mutant embryos is lined by a shorter, cuboidal epithelium on both sides and the mesenchyme is dispersed and similar in appearance to that seen on the right side of the wild type dorsal mesentery. On a molecular level, E10.75 Pitx2-deficient embryos exhibit a loss of Isl1 expression (Figure 5D) and bilateral Tbx18 expression (Figure 5F), compared to the unilateral expression of these factors seen in control embryos (Figure 5C,E). Thus the upstream cascade of left-side signals and transcription factors is both necessary and sufficient to specify the distinct molecular identity and cellular architecture of the left side of the dorsal mesentery.

Pitx2 and Isl1 regulate asymmetric gut morphogenesis

Our results demonstrate that the left-right asymmetric signaling cascade is both necessary and sufficient to produce cellular changes in the dorsal mesentery that, in turn, result in a tilting of the primitive gut tube. If the tilting of the midgut plays a role in establishing the counter clockwise rotation of the gut, then alteration in the expression of the upstream transcription factors should also have an effect on the chirality of gut coiling. Indeed, previous studies in mice have revealed that the directional coiling of the midgut is defective in embryos deficient for Pitx2 activity (Liu et al., 2001; Shiratori et al., 2006); a genetic condition that we have shown produces a dorsal mesentery with a symmetrical morphology similar to that normally found on the right side. To test whether a bilateral cellular architecture characteristic of that normally found on the left side would also have an effect on directional gut looping, we utilized the retroviruses carrying Isl1 and Pitx2 and injected viral supernatant into the right coelomic cavity at HH stage 7. Embryos were grown until HH stage 24 (close to the time when infected embryos fail to survive), then harvested and analyzed morphologically for gut situs. Following Isl1 misexpression, in histological sections we observed reversals in the situs of the gut in 28% of embryos (n=4; Figure 4L,M). In parallel experiments with RCAS-Pitx2, assayed in whole mount we observed similar reversals in gut situs at a frequency of 30% (n=23; Figure 4N,O). Previous work addressing the role of Pitx2 in asymmetric gut morphogenesis using a slightly different injection protocol also demonstrated situs perturbations albeit at a lower frequency of 7.6% (Logan et al., 1998). Embryos injected with a control virus, RCAS-alkaline phosphatase, using the above protocol did not show any alterations in gut situs (n=21), indicating that the situs reversals we observe are specific to Isl1 or Pitx2 misexpression.

DISCUSSION

Regulation of amniote gut morphogenesis

We have investigated the cellular basis of looping morphogenesis in the context of the asymmetric rotation of the primitive midgut. Since, in the midgut, the gut tube itself maintains a symmetric cross-sectional profile through the looping process, it follows that the biomechanical forces driving the looping must originate from outside the gut tube and rules out the alternative possibility that shape changes in the dorsal mesentery are passive responses to changes in the gut itself. Historically, the dorsal mesentery has been appreciated for its structural importance: it connects the gut tube, through its entire axial length, to the dorsal body wall throughout embryogenesis, yet a direct role in gut looping has not been previously proposed. The data presented here provides evidence that the dorsal mesentery of the developing gut tube is deformed to a trapezoidal shape, due to changes in epithelial cell shape and cell density within the mesenchyme on the left side, thereby tilting the developing midgut and providing a left-right bias for subsequent gut rotation. This work provides a framework for understanding how the cascade of differential left-right signaling, first initiated during gastrulation, is ultimately responsible for changes in cell behavior initiating asymmetric organogenesis (Figure 7). In a separate study, we have investigated the cellular mechanisms involved in producing the less condensed morphology of mesenchyme on the right side of the dorsal mesentery. We identified changes in both cell adhesion and extraceullar matrix synthesis acting downstream of Pitx2 and Isl1 and contributing to the deformation of the dorsal mesentery and thereby the tilting of the gut tube (Kurpios et al. 2008).

Figure 7
Model for the directional looping of the gut tube.

It should be noted that the tilting we observe in the midgut is only the first step in its asymmetric morphogenesis. While the changes in the cellular architecture result in a leftward tilt throughout the midgut, as the midgut subsequently forms a hairpin loop it actually takes on an S shape when viewed ventrally, bending to the right anteriorly and to the left posteriorly. The rightward bend at the rostral end is likely due to forces put on the midgut tube by its connection to the stomach, which is simultaneously undergoing rotation. We suggest that the initial tilt provides a left-right bias that directs the orientation of the reverse curve as the looping commences. Thus the cellular asymmetries in the dorsal mesentery likely determine the direction, but not the degree of deformation of the gut tube. In this respect, the bending of the gut tube is analogous to Euler buckling, where compression applied to the ends of a rod cause it to bend. While the bending can be controlled with even the most minimal of forces applied perpendicular to the rod’s midpoint, the magnitude of bending depends on the forces applied to the ends. In the case of gut looping, the dorsal mesentery provides the equivalent of the minimal perpendicular forces biasing the direction of buckling, while elongation of the gut provides the larger motive force driving axial compression. The existence of additional forces on the ends of the gut tube as morphogenesis proceeds may contribute to the variable phenotypes observed in the intestines of Pitx2 mutants (Liu et al., 2001). Once the direction of rotation has been established, the midgut leaves the body cavity, completes a 90° rotation, then retracts and simultaneously undergoes another 180° rotation. The signals and cellular changes during these later aspects of asymmetric morphogenesis remain to be elucidated.

There are potential interesting parallels between the role of the dorsal mesentery in midgut rotation and the role of the equivalent structure, termed the dorsal mesocardium, in the looping of the heart tube. The dorsal mesocardium has been implicated in the left-right morphogenesis of this organ through various theoretical models (Manasek, 1983; Manner, 2004; Voronov et al., 2004). Recent studies suggest that the dorsal mesocardium may indeed play a biomechanical role in constraining the forces applied to the early heart tube, converting them into an initial rightward rotation of the heart tube about the anterior-posterior axis (Voronov et al., 2004). While the cellular mechanisms that are responsible for such a transmission of force during the asymmetric morphogenesis of the heart are not known, it is possible that a differential cellular organization in the dorsal mesocardium plays a role similar to the ones we observe in the dorsal mesentery upstream of midgut.

Experimental Procedures

Chick and Mouse Embryos

Chick embryos were obtained by incubation of fertilized White Leghorn eggs (provided by SPAFAS, Norwich, CT) at 37.5°C and staged according to Hamburger and Hamilton (Hamburger and Hamilton, 1951).

The Pitx2 null allele is a 4 Kb deletion that removes Pitx2 exon 5 and the majority of exon 6 and the intervening intron (Lu et al., 1999).

Cloning of Retroviral Constructs and Viral Misexpression

Cloning of retroviral constructs using pSlax13, as well as transfection and growth of RCAS viruses was performed as previously described (Logan and Tabin, 1998; Morgan and Fekete, 1996). RCASBP(A) and RCASBP(B) constructs included cNodal (BMP4 pro domain fused to the cNodal mature region (Levin et al., 1997)), full-length cIslet1 (kindly provided by T. Jessell), and full-length cPitx2c (RCASBP(A)-Pitx2c construct kindly provided by Y. Chen (Yu et al., 2001)). RCASBP (A) and RCASBP (B) constructs containing full-length cIslet1 were constructed by fusing the initiator ATG in-frame to the NcoI site that lies downstream of the 5’ ClaI site in pSlax13. The following PCR primers were used to engineer unique restriction enzyme sites into the 5’ and 3’ ends of the cIslet1 cDNA (restriction sites are underlined):

  • 5’ NcoI site: TTACAGCCATGGGAGACATGGGAG,
  • 3’ HindIII site: ATCAAGCTTTCATGCCTCAATAGGAC

All injections were performed using an Eppendorf pressure injector (model 5242). For Nodal misexpression experiments, RCASBP(A)-Nodal supernatant was injected in ovo into the right side of the embryo at HH stage 4. To target the developing gut, Pitx2c and Isl1 viruses were injected in ovo into embryos at HH stage7. Embryos were infected by slowly filling the right coelomic cavity with as large a volume of supernatant as could be delivered by a single injection, without damage to neighboring tissues. To further increase the extent of initial viral infection, RCASB (A) and RCASBP(B) viral supernatants were pooled and co-injected. This injection protocol frequently results in widespread infection of the splanchnic mesoderm of the gut, as well as surrounding tissues. Following microinjection of viral supernatant, eggs were sealed and incubated until stage 21–22. At the time of harvest, embryos were analyzed for stomach situs and processed for section in situ hybridization, immunohistochemistry or histology.

In situ hybridization

Embryos for whole mount in situ hybridization were dissected in PBS and fixed overnight in 4% paraformaldehyde at 4°C. Whole mount in situ hybridization was performed as described previously, with slight modifications (Brent et al., 2003; Dietrich et al., 1997). Embryos for section in situ hybridization were dissected in PBS and fixed in 4% paraformaledehyde at room temperature for 1–3 hours. After fixation, embryos were rinsed in PBS, dehydrated in a graded ethanol series, then cleared in xylenes and embedded in paraffin. Serial sections at 8–10µm thickness were collected and floated onto TESPA (3aminopropyltriethoxysilane)-coated slides. Section in situ hybridization was performed as described (Brent et al., 2003; Murtaugh et al., 1999). Probes included Isl1 (ChEST 76l14 from MRCgeneservice), Pitx2 (Logan and Tabin, 1998), Pitx2C (cDNA fragment corresponding to the first 360 bp of the 5’ region including 76 bp 5’ UTR, (Yu et al., 2001)) and Tbx18 (cDNA fragment corresponding to nucleotides 474 through 1807, GenBank accession number AY173127; a generous gift of M. Logan, unpublished.

Histology

Embryos were fixed in 4% paraformaldehyde and then dehydrated in a graded ethanol series, cleared in xylenes, and embedded in paraffin. Sections at 6–8µm thickness were collected and floated onto TESPA (3-aminopropyltriethoxysilane)-coated slides. Hematoxylin staining was performed using standard protocols. Briefly, slides were dewaxed in xylenes, rinsed in successive washes with 100% and 95% ethanol, and rehydrated in tap water. Slides were then stained with Harris’ hematoxylin (Fisher) for five minutes or Fast Green (Sigma Aldrich) for 30 minutes, rinsed in tap water, washed in a 1% HCl/70% ethanol solution, and rinsed again in tap water. Next, slides were incubated in a saturated lithium carbonate solution for two minutes and rinsed in tap water. Finally, slides were dehydrated, cleared in xylenes and sealed with DPX mountant (Fluka).

Apoptosis assay

TUNEL assay was performed on 6 µm-thick paraffin sections using In situ Cell Death Detection Kit, TMR red (Roche Applied Science, Laval, QC). Pretreatment of tissue sections with Proteinase K (5 µg/ml) was performed for 10 minutes at room temperature. Labeling of DNA strand breaks with TMR (Tetramethylrodamine) red-dUTP by Terminal deoxynucleotidyl transferase was performed for 1 hour at 37°C. For positive control, sections were incubated with DNAse I, grade I (100 U/ml) for 5 minutes at room temperature, prior to labeling procedure. DAPI was used as a fluorescent counter stain (Roche Applied Science, Laval, QC). Images were captures using a Zeiss Axiophot microscope and Nikon digital camera.

Proliferation assay

Mitotic cells were detected using Anti-phospho-Histone H3 (H3) rabbit polyclonal IgG antibody (Upstate, Lake Placid, NY). Paraffin-embedded 6 um-thick sections were incubated with H3 (1:200) for 1 hour at room temperature. Subsequently, sections were incubated with Alexa Fluor-594 goat anti-rabbit secondary antibodies (Molecular Probes, Carlsbad, CA). DAPI was used as a fluorescent counter stain (Roche Applied Science, Laval, QC). Images were captured using a Zeiss Axiophot microscope and Nikon digital camera.

Analyzing L-R cell number in the dorsal mesentery

The average L/R ratio of cells in the dorsal mesentery was determined from manual counts of DAPI-stained nuclei on the left and right sides of histological sections of the developing chick gut. The 95% confidence interval for this ratio was calculated using the following equation for standard error of a ratio: SEQ=Q(SEMA2A2)+(SEMB2B2),where Q corresponds to the average L/R ratio, A is the average of all the left values, B is the average of all the right values, and SEMa and SEMb are the standard error of the mean for the left and right values, respectively. The 95% confidence interval is equal to Q ±t* · SEQ (Motulsky, 1995).

Analysis of L-R differences in epithelial cell shape

To quantitate the left-right differences in epithelial cell shape of the dorsal mesentry, a mid-caudal section and/or a mid-rostral section of the dorsal mesentery was chosen from either WT chick embryos (n=4) or following misexpression of either Pitx2 or Isl1 (n=4). The average height/width of all the epithelial cells comprising the left dorsal mesentery (~60 cells) was then compared to the average size of all the epithelial cells comprising the right dorsal mesentery (~80 cells). All data was analyzed by Anova: Single Factor using Excel software. Mean separation was accomplished using the Least Significant Difference (LSD) method. Differences were considered significant at p<0.05.

Electron microscopy

Transmission electron microscopy was performed using the Tecnai G2 series microscope (Tecnai G2 Spirit BioTWIN) (FEI Company), equipped with an AMT digital camera (AMT 2K CCD, Advanced Microscopy Techniques). Embryos were fixed in a mixture of 2% formaldehyde and 2.5% glutaraldehyde in 0.1M Sodium Cacodylate buffer, pH7.4 for 2 hours at room temperature and subsequently embedded in Epon resin (EMbed 812, Electron Microscopy Sciences). Ultrathin plastic sections (90nm) were cut with a cryodiamond knife using Reichert Ultracut microtome (Leica Microsystems). Sections were stained with 2% aqueous uranyl acetate solution for 5 minutes at room temperature and analyzed.

Electroporation

The electroporation technique was performed as previously described (Scaal et al., 2004). Briefly, a solution containing a plasmid DNA (2µg/µl) encoding a GFP reporter gene (pCAAG-GFP) was microinjected into the coelomic cavity of HH stage 14 chick embryos. To this end, platinum electrodes were used and placed on either side of a chicken embryo to establish an electric field of the desired direction. A BTX electroporator (BTX Harvard) was used to deliver three to five sequential pulses of 10 milliseconds each, at 50 V. Following all micromanipulations, eggs were sealed and incubated until desired HH stage and processed accordingly.

Supplementary Material

01

Acknowledgments

We thank Marta Ibãnes and Juan Carlos Izpisua Belmonte for reading the manuscript and for helpful suggestions. This work was supported by grants from the NIH to JFM (R01DE016329) and CJT (ROHD047360).

Bibliography

  • Bamforth SD, Braganca J, Farthing CR, Schneider JE, Broadbent C, Michell AC, Clarke K, Neubauer S, Norris D, Brown NA, et al. Cited2 controls left-right patterning and heart development through a Nodal-Pitx2c pathway. Nat Genet. 2004;36:1189–1196. [PubMed]
  • Begemann G, Gibert Y, Meyer A, Ingham PW. Cloning of zebrafish T-box genes tbx15 and tbx18 and their expression during embryonic development. Mech Dev. 2002;114:137–141. [PubMed]
  • Brent AE, Schweitzer R, Tabin CJ. A somitic compartment of tendon progenitors. Cell. 113:235–248. [PubMed]
  • Campione M, Steinbeisser H, Schweickert A, Deissler K, van Bebber F, Lowe LA, Nowotschin S, Viebahn C, Haffter P, Kuehn MR, et al. The homeobox gene Pitx2: mediator of asymmetric left-right signaling in vertebrate heart and gut looping. Development. 1999;126:1225–1234. [PubMed]
  • Collignon J, Varlet I, Robertson EJ. Relationship between asymmetric nodal expression and the direction of embryonic turning. Nature. 1996;381:155–158. [PubMed]
  • Dietrich S, Schubert FR, Lumsden A. Control of dorsoventral pattern in the chick paraxial mesoderm. Development. 1997;124:3895–3908. [PubMed]
  • Gaio U, Schweickert A, Fischer A, Garratt AN, Muller T, Ozcelik C, Lankes W, Strehle M, Britsch S, Blum M, et al. A role of the cryptic gene in the correct establishment of the left-right axis. Curr Biol. 1999;9:1339–1342. [PubMed]
  • Haenig B, Kispert A. Analysis of TBX18 expression in chick embryos. Dev Genes Evol. 2004;214:407–411. [PubMed]
  • Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. Journal of Morphology. 1951;88:49–82. [PubMed]
  • Horne-Badovinac S, Lin D, Waldron S, Schwarz M, Mbamalu G, Pawson T, Jan Y, Stainier DY, Abdelilah-Seyfried S. Positional cloning of heart and soul reveals multiple roles for PKC lambda in zebrafish organogenesis. Curr Biol. 2001;11:1492–1502. [PubMed]
  • Horne-Badovinac S, Rebagliati M, Stainier DY. A cellular framework for gut-looping morphogenesis in zebrafish. Science. 2003;302:662–665. [PubMed]
  • Kraus F, Haenig B, Kispert A. Cloning and expression analysis of the mouse T-box gene Tbx18. Mech Dev. 2001;100:83–86. [PubMed]
  • Kurpios NA, Ibañes M, Davis NM, Lui W, Katz T, Martin JF, Belmonte JCI, Tabin CJ. Directional gut looping is mediated by changes in extracellular matrix and in cell:cell adhesion. Proc. Natl. Acad. Sci. U.S.A. 2008 in press. [PMC free article] [PubMed]
  • Levin M. Left-right asymmetry in embryonic development: a comprehensive review. Mech Dev. 2005;122:3–25. [PubMed]
  • Levin M, Johnson RL, Stern CD, Kuehn M, Tabin C. A molecular pathway determining left-right asymmetry in chick embryogenesis. Cell. 1995;82:803–814. [PubMed]
  • Levin M, Pagan S, Roberts DJ, Cooke J, Kuehn MR, Tabin CJ. Left/right patterning signals and the independent regulation of different aspects of situs in the chick embryo. Dev Biol. 1997;189:57–67. [PubMed]
  • Liu C, Liu W, Lu MF, Brown NA, Martin JF. Regulation of left-right asymmetry by thresholds of Pitx2c activity. Development. 2001;128:2039–2048. [PubMed]
  • Logan M, Pagan-Westphal SM, Smith DM, Paganessi L, Tabin CJ. The transcription factor Pitx2 mediates situs-specific morphogenesis in response to left-right asymmetric signals. Cell. 1998;94:307–317. [PubMed]
  • Logan M, Tabin C. Targeted gene misexpression in chick limb buds using avian replication-competent retroviruses. Methods. 1998;14:407–420. [PubMed]
  • Lowe LA, Supp DM, Sampath K, Yokoyama T, Wright CV, Potter SS, Overbeek P, Kuehn MR. Conserved left-right asymmetry of nodal expression and alterations in murine situs inversus. Nature. 1996;381:158–161. [PubMed]
  • Lu MF, Pressman C, Dyer R, Johnson RL, Martin JF. Function of Rieger syndrome gene in left-right asymmetry and craniofacial development. Nature. 1999;401:276–278. [PubMed]
  • Manasek FJ. Control of early embryonic heart morhogenesis: a hypothesis. Ciba Found Symp. 1983;100:4–19. [PubMed]
  • Manner J. On rotation, torsion, lateralization, and handedness of the embryonic heart loop: new insights from a simulation model for the heart loop of chick embryos. Anat Rec A Discov Mol Cell Evol Biol. 2004;278:481–492. [PubMed]
  • Meno C, Gritsman K, Ohishi S, Ohfuji Y, Heckscher E, Mochida K, Shimono A, Kondoh H, Talbot WS, Robertson EJ, et al. Mouse Lefty2 and zebrafish antivin are feedback inhibitors of nodal signaling during vertebrate gastrulation. Mol Cell. 1999;4:287–298. [PubMed]
  • Morgan BA, Fekete DM. Manipulating gene expression with replication-competent retroviruses. Methods Cell Biol. 1996;51:185–218. [PubMed]
  • Motulsky H. Intuitive biostatistics. New York; Oxford: Oxford University Press; 19950.
  • Muller JK, Prather DR, Nascone-Yoder NM. Left-right asymmetric morphogenesis in the Xenopus digestive system. Dev Dyn. 2003;228:672–682. [PubMed]
  • Murtagh LC, Chyung JH, Lassar AB. Sonic hedgehog promotes somitic chondrogenesis by altering the cellular response to BMP signaling. Genes & Dev. 1999;13:225–237. [PMC free article] [PubMed]
  • Piedra ME, Icardo JM, Albajar M, Rodriguez-Rey JC, Ros MA. Pitx2 participates in the late phase of the pathway controlling left-right asymmetry. Cell. 1998;94:319–324. [PubMed]
  • Ryan AK, Blumberg B, Rodriguez-Esteban C, Yonei-Tamura S, Tamura K, Tsukui T, de la Pena J, Sabbagh W, Greenwald J, Choe S, et al. Pitx2 determines left-right asymmetry of internal organs in vertebrates. Nature. 1998:545–551. [PubMed]
  • Sampath K, Cheng AM, Frisch A, Wright CV. Functional differences among Xenopus nodal-related genes in left-right axis determination. Development. 1997;124:32933302. [PubMed]
  • Scaal M, Gros J, Lesbros C, Marcelle C. In ovo electroporation of avian somites. Dev Dyn. 2004;229:643–650. [PubMed]
  • Shiratori H, Sakuma R, Watanabe M, Hashiguchi H, Mochida K, Sakai Y, Nishino J, Saijoh Y, Whitman M, Hamada H. Two-step regulation of left-right asymmetric expression of Pitx2: initiation by nodal signaling and maintenance by Nkx2. Mol Cell. 2001;7:137–149. [PubMed]
  • Shiratori H, Yashiro K, Shen MM, Hamada H. Conserved regulation and role of Pitx2 in situs-specific morphogenesis of visceral organs. Development. 2006;133:30153025. [PubMed]
  • St Amand TR, Ra J, Zhang Y, Hu Y, Baber SI, Qiu M, Chen Y. Cloning and expression pattern of chicken Pitx2: a new component in the SHH signaling pathway controlling embryonic heart looping. Biochem Biophys Res Commun. 1998;247:100–105. [PubMed]
  • Tabin C. Do we know anything about how left-right asymmetry is first established in the vertebrate embryo? J Mol Histol. 2005;36:317–323. [PubMed]
  • Tanaka M, Tickle C. Tbx18 and boundary formation in chick somite and wing development. Dev Biol. 2004;268:470–480. [PubMed]
  • Voronov DA, Alford PW, Xu G, Taber LA. The role of mechanical forces in dextral rotation during cardiac looping in the chick embryo. Dev Biol. 2004;272:339–350. [PubMed]
  • Yan YT, Gritsman K, Ding J, Burdine RD, Corrales JD, Price SM, Talbot WS, Schier AF, Shen MM. Conserved requirement for EGF-CFC genes in vertebrate left-right axis formation. Genes Dev. 1999;13:2527–2537. [PMC free article] [PubMed]
  • Yoshioka H, Meno C, Koshiba K, Sugihara M, Itoh H, Ishimaru Y, Inoue T, Ohuchi H, Semina EV, Murray JC, et al. Pitx2, a bicoid-type homeobox gene, is involved in a lefty-signaling pathway in determination of left-right asymmetry. Cell. 1998;94:299–305. [PubMed]
  • Yost HJ. Left-right asymmetry: nodal cilia make and catch a wave. Curr Biol. 2003;13:R808–R809. [PubMed]
  • Yu X, St Amand TR, Wang S, Li G, Zhang Y, Hu YP, Nguyen L, Qiu MS, Chen YP. Differential expression and functional analysis of Pitx2 isoforms in regulation of heart looping in the chick. Development. 2001;128:1005–1013. [PubMed]
  • Yuan S, Schoenwolf GC. Islet-1 marks the early heart rudiments and is asymmetrically expressed during early rotation of the foregut in the chick embryo. Anat Rec. 2000;260:204–207. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...