![]() | ![]() |
Formats:
|
||||||||||||
Copyright © 2008 by The National Academy of Sciences of the USA Neuroscience RNA binding activity of the recessive parkinsonism protein DJ-1 supports involvement in multiple cellular pathways *Cell Biology and Gene Expression Unit, §Transgenic Unit, and **Bioinformatics Core, Laboratory of Neurogenetics, National Institute on Aging, 35 Convent Drive, Bethesda, MD 20892-3707; ‖Laboratory of Cellular and Molecular Biology and ††Research Resources Branch, Gerontology Research Center, National Institute on Aging, 5600 Nathan Shock Drive, Baltimore, MD 21224-6825; ¶Department of Biology, Howard Hughes Medical Institute, University of Pennsylvania, Philadelphia, PA 19104; and ‡Department of Neuroscience, Karolinska Institutet, Retzius vag 8, SE-171 77 Stockholm, Sweden ‡‡To whom correspondence should be addressed. E-mail: cookson/at/mail.nih.gov Edited by Gregory A. Petsko, Brandeis University, Waltham, MA, and approved May 8, 2008 Author contributions: M.P.v.d.B., J.B., A.L., N.M.B., M.G., and M.R.C. designed research; M.P.v.d.B., J.B., J.C., L.-Y.H., A.L., K.M.-M., J.M., C.X., R.A., K.J.T., and A.B. performed research; J.C., L.-Y.H., A.J.M., and H.C. contributed new reagents/analytic tools; M.P.v.d.B., J.B., J.R.G., J.D., M.Z., M.G., and M.R.C. analyzed data; and M.P.v.d.B., J.B., N.M.B., M.G., and M.R.C. wrote the paper. †M.P.v.d.B. and J.B. contributed equally to this work. Received September 7, 2007. This article has been cited by other articles in PMC.Abstract Parkinson's disease (PD) is a major neurodegenerative condition with several rare Mendelian forms. Oxidative stress and mitochondrial function have been implicated in the pathogenesis of PD but the molecular mechanisms involved in the degeneration of neurons remain unclear. DJ-1 mutations are one cause of recessive parkinsonism, but this gene is also reported to be involved in cancer by promoting Ras signaling and suppressing PTEN-induced apoptosis. The specific function of DJ-1 is unknown, although it is responsive to oxidative stress and may play a role in the maintenance of mitochondria. Here, we show, using four independent methods, that DJ-1 associates with RNA targets in cells and the brain, including mitochondrial genes, genes involved in glutathione metabolism, and members of the PTEN/PI3K cascade. Pathogenic recessive mutants are deficient in this activity. We show that DJ-1 is sufficient for RNA binding at nanomolar concentrations. Further, we show that DJ-1 binds RNA but dissociates after oxidative stress. These data implicate a single mechanism for the pleiotropic effects of DJ-1 in different model systems, namely that the protein binds multiple RNA targets in an oxidation-dependent manner. Keywords: gene expression, oxidative stress, Parkinson's disease, translation Mutations in any of three genes cause a recessively inherited early-onset movement disorder reminiscent of Parkinson's disease (PD). Parkin is an E3 protein-ubiquitin ligase and PINK1 is a mitochondrial kinase (1). Results from Drosophila models suggest that PINK1 and parkin define a single pathway that, when disrupted, leads to mitochondrial damage (2, 3). The third, and rarest, gene for recessive parkinsonism is DJ-1. The DJ-1 protein responds to oxidative stress evidenced by a pI shift in sporadic PD (4, 5) and in cell (6, 7) and animal (8) models. DJ-1 knockout models also show increased sensitivity to toxins that cause mitochondrial dysfunction or oxidative stress (9–13). Cys-106 of DJ-1, which is oxidized to form a cysteine-sulfinic acid, is critically required for DJ-1 to protect against these types of damage both in vitro (6) and in vivo (12). However, the molecular function of DJ-1 is unclear. DJ-1 is part of the ThiJ/PfPI superfamily but the proteins most similar to DJ-1 form a distinct clade away from other members with known function (14, 15), implying a novel activity. As well as effects on oxidation and mitochondrial function, DJ-1 enhances Ras-mediated oncogenesis (16), modulates the PTEN/Akt survival pathway (17, 18), suppresses Ask1-mediated apoptosis (19), and increases glutathione (GSH) synthesis, Hsp70 (20) and tyrosine hydroxylase (21, 22) expression. DJ-1 is a small, dimeric, single-domain protein (23), so if all of these effects are true then either the protein has multiple functions or there is a single biochemical activity that explains all of them. One of the original descriptions of the cloning of DJ-1 was as RS, a regulatory component of an RNA binding complex (24). Therefore, we examined whether DJ-1 associates with RNA in vitro and in vivo and looked at the consequences of any interaction. We propose that the apparently pleiotropic effects of DJ-1 relate to the common property of RNA binding. Results Purification of mRNA Associated with DJ-1 Protein. We used immunoprecipitation (IP; Fig. 1
The transcripts that are associated with DJ-1 are potentially involved in many cellular processes. We chose to examine three groupings of transcripts associated with DJ-1 that might be relevant to the survival of dopaminergic neurons: proteins that are involved in the metabolism of selenocysteine and enzymes that contain selenocysteine, particularly the GSH peroxidases; mitochondrial transcripts, both nuclear and mitochondrially encoded; and components of the PTEN/Akt survival pathway (Tables S2–S4). We validated these interactions by RT-PCR and saw preferential amplification of a series of candidate transcripts (Fig. 1 We used a third, nonantibody-based technique and purified 6His-tagged DJ-1 from cells by using Ni-NTA affinity chromatography (Fig. 1 To address whether such interactions might occur in the brain, we isolated complexes by IP with DJ-1 antibody from WT and DJ-1 knockout (27) mouse brains (Fig. 2
Identification of RNA Sequences That Can Bind DJ-1. We next used several approaches to determine the region of the mRNAs to which DJ-1 binds. Although the CLIP technique has lower throughput than microarray analysis, it allows for cloning of sequences directly bound to DJ-1 (26). Our CLIP tags included selenoproteins and members of the PTEN/Akt1 pathway (Fig. 3
We created stable dopaminergic neuroblastoma cell lines expressing a nonsense shRNA or two different shRNA sequences to DJ-1 (Fig. S2). Nonsense shRNA did not affect DJ-1 expression levels but the shRNA constructs decreased expression by >85% and >95%, respectively. We made reporter constructs for RNA binding by cloning UTR sequences from GPx4 or MAPK8IP1 into vectors expressing GFP (Fig. 3 Because DJ-1 is protective under oxidative conditions, we exposed cells to paraquat, which induced a shift in DJ-1 to more acidic isoforms (data not shown) as reported (6). Using NiNTA purification of V5his-tagged WT DJ-1 (Fig. 4
DJ-1 Effects on RNA and Protein. Next, we examined the effects of DJ-1 deficiency and oxidative stress on the RNA and protein levels for two candidate targets. We chose GPx4 as a representative selenoprotein and MAPK8IP1 as a representative member of the Akt pathway. In both cases, we were able to obtain high-quality antibodies to the endogenous proteins, although the GPx4 antibody was human-specific (data not shown). In shRNA-mediated knockdown stable cell lines, DJ-1 deficiency was associated with increased GPx4 (Fig. S3 a and b) or MAPK8IP1 (Fig. S3 d and e) protein levels. After oxidative stress, both proteins were induced in control cells but decreased in the knockdown cells. In contrast to the changes in protein levels, mRNA levels for GPx4 or MAPK8IP1 were similar in all cell lines and did not change after paraquat (PQ) treatment (Fig. S3 c and f). To extend this comparison to the in vivo situation, we examined aging DJ-1 knockout mice. We showed that aging is associated with increased oxidation of DJ-1, comparing young (<1 month) and old (24 months old) WT animals (Fig. S3 g and h). MAPK8IP3 protein levels were higher in young knockout animals compared with WT littermates but in aged samples MAPK8IP3 was higher in the WT animals and decreased in the knockouts (Fig. S3 i and j) such that the relative expression levels in knockouts and controls were reversed. Similar patterns were seen with MAPK8IP1 (Fig. S3k). Quantitation of protein levels, correcting for β-actin, revealed a significant effect of age (P = 0.0012 for MAPK8IP3; P = 0.026 for MAPK8IP1) and an interaction between age and genotype (P = 0.0006 for MAPK8IP3; P = 0.0039 for MAPK8IP1) by two-way ANOVA (n = 3–4 animals per group). The steady-state levels of each mRNA did not vary between conditions (data not shown). These data therefore support the hypothesis that DJ-1 binds to RNA for GPx4 and MAPK8IP1/3 in vivo and have a mild suppressive effect on translation. DJ-1 Knockout Flies Are More Sensitive to Disrupted GSH Peroxidase Function. Previous studies support the idea that mitochondrial (9) and PTEN/Akt-related (18) DJ-1 targets are important in maintenance of viability in vivo. However, the hypothesis that GSH peroxidases are also targets is novel and led us test the idea in vivo by exposing DJ-1-deficient flies to GSH inhibitors. Flies deficient in DJ-1 showed an increase in sensitivity to the GSH synthesis inhibitor buthionine-S,R-sulfoximine that was similar to that of stressors such as PQ (Fig. S4), supporting a role of GSH in the ability of DJ-1 to protect organisms in vivo. Discussion Overall, our results indicate that DJ-1 associates with specific mRNA species in vitro and in vivo. The observation that there are several transcripts that interact may help explain previous observations about the biological roles of DJ-1. By allowing for a simultaneous control of the mRNA for GSH peroxidases, and selenoproteins needed to synthesize functional GPx, DJ-1 may control antioxidant defenses. Targets of DJ-1 within the PTEN/Akt1 pathways may be related to the ability of the protein to suppress cell death, as has been reported in many previous studies, including those demonstrating a specific connection to this pathway (18). The mitochondrial transcripts are also of interest because of the emerging evidence of a mitochondrial basis of recessive parkinsonism (2, 3). DJ-1 can be found on the surface of mitochondria (6) and within the mitochondrial matrix (28), supporting the idea that a small pool of DJ-1 may authentically associate with RNA in the mitochondria. However, this hypothesis requires additional confirmation. Further work is also required to define the nature of the DJ-1–mRNA interaction. The structural basis of the interaction between the DJ-1 and RNA is unclear as DJ-1 lacks classical RNA binding motifs. However, our data found using in vitro approaches suggests that DJ-1 alone is sufficient to GG/CC-rich sequences at nanomolar concentrations. We have evidence that the RNA targets that DJ-1 binds are distinct from other RNA–protein complexes. In previous large-scale studies of RNA–protein interactions in the brain, FMR-1, associated with mental retardation, binds a distinct set of targets from those discussed here (29), and binding to the splicing factors Nova1/2 are also different (30). Other RNA binding proteins, such as HuR (31), also gave different targets in our studies using the same experimental procedures (data not shown). Therefore, DJ-1 is specific in the sense of binding only a subset of targets. Our data are consistent with a model whereby DJ-1 interacts with mRNA and dissociates under conditions of oxidative stress. In this respect, when bound to RNA, DJ-1 would slow translation but would allow efficient translation under appropriate local or environmental cues. Rapid translational processes are important in control of stress responses and apoptosis (32), and local translation at synapses is critical for neuronal function. If this interpretation is correct then the increased levels of MAPK8IP1 and MAPKIP3 in the mouse brains with aging would represent successful responses to oxidative stress but the failure of the DJ-1-deficient animals would represent an inadequate ability to do so. The steady-state levels of RNA for these targets are not different in the absence of DJ-1, suggesting that the protein does not modify RNA turnover. However, we cannot exclude that the partial suppression of translation of RNA by DJ-1 is a by-product of another function of the protein. For example, RNA is transported throughout the cell and translation is repressed during transport (33). Future studies will be required to clarify whether DJ-1 has additional activities on its RNA targets. In summary, we have shown both in vitro and in vivo that DJ-1 is capable of binding a series of target mRNA molecules, identifying a GG/CC-rich sequence that is sufficient for DJ-1 recruitment. The functional classification of these transcripts suggests how DJ-1 may play roles in coordinating responses to oxidative damage and suppression of cell death. Our data support the hypothesis that the apparently pleiotropic roles of DJ-1 may be related to the single function of binding to multiple mRNA transcripts. Methods DJ-1 Knockout Mice and Cell Lines. DJ-1 knockout mice lacking exon 2 have been described in detail (27). DJ-1 expression constructs have been described (6, 34, 35). Stable M17 human neuroblastoma cell lines were cultured as described (6). Clonal M17 cell lines stably expressing different DJ-1 siRNAs were constructed with the Invitrogen BLOCK-iT Lentiviral system, according to the manufacturer's instructions. Two target sequences (GGAAGTAAAGTTACAACACA, GGTCATTACACCTACTCTGAG) and one nonsense control sequence (GCCTAGACGCGATAGTATGGA) were used. Precipitation of DJ-1 RNA Complexes. Anti-DJ-1 antibody C-16 (Santa Cruz Biotechnology) had no detectable RNA-degrading activity and was used for IPs. Negative control IPs were performed by using normal goat IgG from the same manufacturer (catalog no. SC-2028). Cell or brain samples were harvested in PLB buffer (0.5% Nonidet P-40, 10 mM Hepes, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, RNase OUT and protease inhibitors) and prepared for RNA-IP as described (31). Briefly, DJ-1 C-16 bound to Protein G Dynabeads (Invitrogen) or Ni-NTA magnetic beads (Qiagen) were incubated with precleared lysate in NT2 buffer (0.05% Nonidet P-40, 50 mM Tris, 150 mM NaCl, 1 mM MgCl2), and then washed four times with NT2 buffer. RNA was extracted by adding DNase for 5 min, discarding the supernatant, then eluting after treatment with Proteinase K. RNA was washed with acid phenol-chloroform and precipitated with 100% ethanol containing sodium acetate and glycoblue (Ambion) overnight. Precipitated RNA was pelleted and washed through 70% ethanol. The concentrations were equalized, and cDNA was generated by using the SuperScript III kit (Invitrogen). CLIP was performed as described (26, 30). Expression Arrays and Analysis. Illumina human oligonucleotide arrays were used according to the manufacturer's instructions, starting with 500 ng of total RNA for each sample. Arrays were read on an Illumina Bead array reader confocal scanner. Differential gene expression values were calculated with the Illumina Custom algorithm within the Illumina BeadStudio software suite. Biotin-Labeled RNA Pull-Down Assays. Biotin-labeled RNAs corresponding to the UTR sequences for GPx4 were synthesized with T7 polymerase, biotinylated, and used in pull-down assays with recombinant GST-tagged DJ-1 as described (35). Quantitative RT-PCR (qRT-PCR). Primers were designed against potential DJ-1 binding targets and validated for use in comparative qRT-PCR with β-actin (25). Primer sequences are available on request. Final quantitation of changes in gene expression was calculated from reactions performed in quadruplicate with four biological replicates per sample. Protein Analyses. Analysis of the oxidation state of DJ-1 was performed as described (6) using monoclonal anti-DJ-1 (Stressgen). Antibodies for MAPK8IP1 (JIP1) and MAPK8IP3 (JIP3) were obtained from Santa Cruz Biotechnologies. Quantitation of signal intensities was performed by using a Storm fluorescence scanner, and protein loading was normalized by reprobing the same blots with mAb to β-actin (Sigma; clone AC-15). To make reporter constructs, forward and reverse primers were designed to amplify the 5′ and 3′ UTRs of human GPx4 or MAPK8IP1. Sequences were cloned into the pEGFP-N1 and pEGFP-C1, respectively (Clontech). Constructs were transiently transfected into cell lines by using Lipofectamine 2000 (Invitrogen), and protein was measured by blotting for GFP. Drosophila melanogaster Viability Experiments. Drosophila DJ-1b-deleted (DJ-1bΔ93) and double knockout (DKO, DJ-1bΔ93 with DJ-1aΔ72) and exposure to drugs (5% buthionine-S,R-sulfoximine or 1 mM selenium, in 5% sucrose, 1% agar medium) have been described (11). Supporting Information
Acknowledgments. This research was supported in part by the Intramural Research Program of the National Institute on Aging, National Institutes of Health. Computational approaches used the high-performance computational capabilities of the Biowulf Linux cluster at the National Institutes of Health (http://biowulf.nih.gov). L.-Y.H. and N.M.B. were supported by National Institute on Aging Grant P01-AG09215. N.M.B. is an Investigator of the Howard Hughes Medical Institute. A.J.M. received grant support from the Verum Foundation and the European Union DIADEM (Delivering Inclusive Access for Disabled or Elderly Members of the community) project. Footnotes The authors declare no conflict of interest. This article is a PNAS Direct Submission. Data deposition: The data reported in this paper have been deposited in the Gene Expression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE8632). This article contains supporting information online at www.pnas.org/cgi/content/full/0708518105/DCSupplemental. References 1. Cookson MR. The biochemistry of Parkinson's disease. Annu Rev Biochem. 2005;74:29–52. [PubMed] 2. Clark IE, et al. Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature. 2006;441:1162–1166. [PubMed] 3. Park J, et al. Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature. 2006;441:1157–1161. [PubMed] 4. Bandopadhyay R, et al. The expression of DJ-1 (PARK7) in normal human CNS and idiopathic Parkinson's disease. Brain. 2004;127:420–430. [PubMed] 5. Choi J, et al. Oxidative damage of DJ-1 is linked to sporadic Parkinson and Alzheimer diseases. J Biol Chem. 2006;281:10816–10824. [PubMed] 6. Canet-Aviles RM, et al. The Parkinson's disease protein DJ-1 is neuroprotective due to cysteine-sulfinic acid-driven mitochondrial localization. Proc Natl Acad Sci USA. 2004;101:9103–9108. [PubMed] 7. Kinumi T, et al. Cysteine-106 of DJ-1 is the most sensitive cysteine residue to hydrogen peroxide-mediated oxidation in vivo in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 2004;317:722–728. [PubMed] 8. Betarbet R, et al. Intersecting pathways to neurodegeneration in Parkinson's disease: Effects of the pesticide rotenone on DJ-1, α-synuclein, and the ubiquitin-proteasome system. Neurobiol Dis. 2006;22:404–420. [PubMed] 9. Kim RH, et al. Hypersensitivity of DJ-1-deficient mice to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyrindine (MPTP) and oxidative stress. Proc Natl Acad Sci USA. 2005;102:5215–5220. [PubMed] 10. Menzies FM, Yenisetti SC, Min KT. Roles of Drosophila DJ-1 in survival of dopaminergic neurons and oxidative stress. Curr Biol. 2005;15:1578–1582. [PubMed] 11. Meulener M, et al. Drosophila DJ-1 mutants are selectively sensitive to environmental toxins associated with Parkinson's disease. Curr Biol. 2005;15:1572–1577. [PubMed] 12. Meulener MC, et al. Mutational analysis of DJ-1 in Drosophila implicates functional inactivation by oxidative damage and aging. Proc Natl Acad Sci USA. 2006;103:12517–12522. [PubMed] 13. Ved R, et al. Similar patterns of mitochondrial vulnerability and rescue induced by genetic modification of α-synuclein, parkin, and DJ-1 in Caenorhabditis elegans. J Biol Chem. 2005;280:42655–42668. [PubMed] 14. Bandyopadhyay S, Cookson MR. Evolutionary and functional relationships within the DJ1 superfamily. BMC Evol Biol. 2004;4:6. [PubMed] 15. Lucas JI, Marin I. A new evolutionary paradigm for the Parkinson disease gene DJ-1. Mol Biol Evol. 2007;24:551–561. [PubMed] 16. Nagakubo D, et al. DJ-1, a novel oncogene which transforms mouse NIH3T3 cells in cooperation with ras. Biochem Biophys Res Commun. 1997;231:509–513. [PubMed] 17. Yang Y, et al. Inactivation of Drosophila DJ-1 leads to impairments of oxidative stress response and phosphatidylinositol 3-kinase/Akt signaling. Proc Natl Acad Sci USA. 2005;102:13670–13675. [PubMed] 18. Kim RH, et al. DJ-1, a novel regulator of the tumor suppressor PTEN. Cancer Cell. 2005;7:263–273. [PubMed] 19. Junn E, et al. Interaction of DJ-1 with Daxx inhibits apoptosis signal-regulating kinase 1 activity and cell death. Proc Natl Acad Sci USA. 2005;102:9691–9696. [PubMed] 20. Zhou W, Freed CR. DJ-1 up-regulates glutathione synthesis during oxidative stress and inhibits A53T α-synuclein toxicity. J Biol Chem. 2005;280:43150–43158. [PubMed] 21. Xu J, et al. The Parkinson's disease-associated DJ-1 protein is a transcriptional coactivator that protects against neuronal apoptosis. Hum Mol Genet. 2005;14:1231–1241. [PubMed] 22. Zhong N, et al. DJ-1 transcriptionally up-regulates the human tyrosine hydroxylase by inhibiting the sumoylation of pyrimidine tract-binding protein-associated splicing factor. J Biol Chem. 2006;281:20940–20948. [PubMed] 23. Wilson MA, et al. The 1.1-A resolution crystal structure of DJ-1, the protein mutated in autosomal recessive early-onset Parkinson's disease. Proc Natl Acad Sci USA. 2003;100:9256–9261. [PubMed] 24. Hod Y, Pentyala SN, Whyard TC, El-Maghrabi MR. Identification and characterization of a novel protein that regulates RNA–protein interaction. J Cell Biochem. 1999;72:435–444. [PubMed] 25. Baptista MJ, et al. Coordinate transcriptional regulation of dopamine synthesis genes by α-synuclein in human neuroblastoma cell lines. J Neurochem. 2003;85:957–968. [PubMed] 26. Ule J, Jensen K, Mele A, Darnell RB. CLIP: A method for identifying protein–RNA interaction sites in living cells. Methods. 2005;37:376–386. [PubMed] 27. Chandran JS, et al. Progressive behavioral deficits in DJ-1-deficient mice are associated with normal nigrostriatal function. Neurobiol Dis. 2008;29:505–514. [PubMed] 28. Zhang L, et al. Mitochondrial localization of the Parkinson's disease-related protein DJ-1: Implications for pathogenesis. Hum Mol Genet. 2005;14:2063–2073. [PubMed] 29. Brown V, et al. Microarray identification of FMRP-associated brain mRNAs and altered mRNA translational profiles in fragile X syndrome. Cell. 2001;107:477–487. [PubMed] 30. Ule J, et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 2003;302:1212–1215. [PubMed] 31. Lopez de Silanes I, et al. Identification of a target RNA motif for RNA-binding protein HuR. Proc Natl Acad Sci USA. 2004;101:2987–2992. [PubMed] 32. Holcik M, Sonenberg N. Translational control in stress and apoptosis. Nat Rev Mol Cell Biol. 2005;6:318–327. [PubMed] 33. Bramham CR, Wells DG. Dendritic mRNA: Transport, translation, and function. Nat Rev Neurosci. 2007;8:776–789. [PubMed] 34. Blackinton J, et al. Effects of DJ-1 mutations and polymorphisms on protein stability and subcellular localization. Brain Res Mol Brain Res. 2005;134:76–83. [PubMed] 35. Miller DW, et al. L166P mutant DJ-1, causative for recessive Parkinson's disease, is degraded through the ubiquitin-proteasome system. J Biol Chem. 2003;278:36588–36595. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||
Annu Rev Biochem. 2005; 74():29-52.
[Annu Rev Biochem. 2005]Nature. 2006 Jun 29; 441(7097):1162-6.
[Nature. 2006]Nature. 2006 Jun 29; 441(7097):1157-61.
[Nature. 2006]Brain. 2004 Feb; 127(Pt 2):420-30.
[Brain. 2004]J Biol Chem. 2006 Apr 21; 281(16):10816-24.
[J Biol Chem. 2006]J Cell Biochem. 1999 Mar 1; 72(3):435-44.
[J Cell Biochem. 1999]J Neurochem. 2003 May; 85(4):957-68.
[J Neurochem. 2003]Methods. 2005 Dec; 37(4):376-86.
[Methods. 2005]Neurobiol Dis. 2008 Mar; 29(3):505-14.
[Neurobiol Dis. 2008]Methods. 2005 Dec; 37(4):376-86.
[Methods. 2005]Proc Natl Acad Sci U S A. 2004 Jun 15; 101(24):9103-8.
[Proc Natl Acad Sci U S A. 2004]Proc Natl Acad Sci U S A. 2005 Apr 5; 102(14):5215-20.
[Proc Natl Acad Sci U S A. 2005]Cancer Cell. 2005 Mar; 7(3):263-73.
[Cancer Cell. 2005]Cancer Cell. 2005 Mar; 7(3):263-73.
[Cancer Cell. 2005]Nature. 2006 Jun 29; 441(7097):1162-6.
[Nature. 2006]Nature. 2006 Jun 29; 441(7097):1157-61.
[Nature. 2006]Proc Natl Acad Sci U S A. 2004 Jun 15; 101(24):9103-8.
[Proc Natl Acad Sci U S A. 2004]Hum Mol Genet. 2005 Jul 15; 14(14):2063-73.
[Hum Mol Genet. 2005]Cell. 2001 Nov 16; 107(4):477-87.
[Cell. 2001]Science. 2003 Nov 14; 302(5648):1212-5.
[Science. 2003]Proc Natl Acad Sci U S A. 2004 Mar 2; 101(9):2987-92.
[Proc Natl Acad Sci U S A. 2004]Nat Rev Mol Cell Biol. 2005 Apr; 6(4):318-27.
[Nat Rev Mol Cell Biol. 2005]Nat Rev Neurosci. 2007 Oct; 8(10):776-89.
[Nat Rev Neurosci. 2007]Neurobiol Dis. 2008 Mar; 29(3):505-14.
[Neurobiol Dis. 2008]Proc Natl Acad Sci U S A. 2004 Jun 15; 101(24):9103-8.
[Proc Natl Acad Sci U S A. 2004]Brain Res Mol Brain Res. 2005 Mar 24; 134(1):76-83.
[Brain Res Mol Brain Res. 2005]J Biol Chem. 2003 Sep 19; 278(38):36588-95.
[J Biol Chem. 2003]Proc Natl Acad Sci U S A. 2004 Mar 2; 101(9):2987-92.
[Proc Natl Acad Sci U S A. 2004]Methods. 2005 Dec; 37(4):376-86.
[Methods. 2005]Science. 2003 Nov 14; 302(5648):1212-5.
[Science. 2003]J Biol Chem. 2003 Sep 19; 278(38):36588-95.
[J Biol Chem. 2003]J Neurochem. 2003 May; 85(4):957-68.
[J Neurochem. 2003]Proc Natl Acad Sci U S A. 2004 Jun 15; 101(24):9103-8.
[Proc Natl Acad Sci U S A. 2004]Curr Biol. 2005 Sep 6; 15(17):1572-7.
[Curr Biol. 2005]