• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Gene Ther. Author manuscript; available in PMC Jul 3, 2008.
Published in final edited form as:
PMCID: PMC2442925
NIHMSID: NIHMS55847

Identification of cell-type-specific promoters within the brain using lentiviral vectors

Abstract

The development of cell-type-specific mini-promoters for genetic studies is complicated by a number of issues. Here, we describe a general method for the relatively rapid screening of specific promoter activity in cell culture, in acute brain slice preparations and in vivo. Specifically, we examine the activity of an ~3 kb promoter region from the neuroactive peptide cholecystokinin (CCK) compared to the commonly used cytomegalovirus promoter. We find a high degree of cell-type selectivity in vivo using lentiviral approaches in rats and traditional transgenic approaches in mice. Appropriate colocalization of Cre-recombinase and CCK gene expression is found within the hippocampus, when the CCK promoter is driving either the expression of Cre-recombinase or green fluorescent protein. We also demonstrate fluorescent identification of CCK-positive inter-neurons that allows for cell-type-specific electrophysiologic studies in rats and mice. In conclusion, these studies identify a functional mini-promoter for the CCK gene and outline a novel and sensitive general method to test activity of selective promoters in vitro and in vivo. This approach may allow for the more rapid identification of specific promoters for use with transgenic animals, in genetically modified viruses, and in the design of targeted, therapeutic gene-delivery systems.

Keywords: lentivirus, electrophysiology, behavior, neuroscience, psychiatry, inhibitor, interneuron

Introduction

The potential for using lentiviral vectors in experimental therapeutics is quite promising, largely owing to their ability to (1) integrate into both dividing and post-mitotic cells, and (2) to achieve stable, long-lasting transgene expression.1 Additionally, in comparison to adeno-associated-based and sindbis-based vectors, lentiviral vectors allow for the packaging of larger inserts, opening the possibility for the use of larger promoter lengths to achieve gene expression in selected populations of cells.24 Achieving restricted expression would be beneficial to both basic science studies of the different cell types interacting in complex biologic systems, and to the development of therapeutic gene-delivery systems that are active only within specific types of cells.

Despite these potential benefits, the process of determining minimal promoter lengths to achieve biologically appropriate expression is made difficult by the inability to identify a priori enhancer and silencer regions within putative promoter regions, and by the possibility that regions of the 5′untranslated region (5′UTR) of a given gene may have an important bearing on its expression. In this context, the screening of putative promoters of varying lengths has largely depended on the selective expression of transfected promoter-reporter constructs in cultured cells, based on the notion that selectivity in vitro may indicate selectivity in vivo. As another option, promoter-reporter constructs have been introduced into embryonic stem cells or pre-implantation embryos to generate transgenic animals (usually mice), which can then be screened for appropriate transgene expression.

In the present study, we outline an alternative method of screening promoters for cell-type-specific expression in vitro and in vivo. As this method makes use of viral vectors to assess appropriate promoter expression, it offers several advantages over transgenic approaches, including lower cost, more rapid throughput and most importantly, the ability to use the resulting vectors in a variety of different species. We divide our approach into two sections – a high-sensitivity assessment of minimal promoter expression and cell-type specificity, and a lower sensitivity examination assessing the levels of transgene expression that may be expected from a given promoter. As an example of the use of this technique, we describe the screening process for ~3 kb of the promoter and 5′UTR region of the gene for cholecystokinin (CCK), an abundant neuropeptide of significant interest in psychiatry5,6 and neuroscience.7,8

Results

Assessment of promoter activity in vitro

Before production of active viral particles, the viral constructs for CCK-GFP and cytomegalovirus (CMV)-GFP were transiently transfected into HEK293 cells to determine if the CCK promoter would provide for transgene expression, and determine its level of activity compared to the CMV promoter (Figure 1). Examination of cells 48-h post-transfection indicated that the CCK promoter was indeed able to generate detectable expression of GFP in HEK293 cells. The level of expression attained with the CCK promoter appeared to be quite high, although still far less than the expression of the CMV promoter-containing vector.

Figure 1
GFP expression vectors. An initial screen of promoter activity from the CCK promoter was made by constructing a vector in which the CCK promoter was used to drive expression of GFP (c), by replacing the CMV promoter of pCMV-GFP-dNhe (a). This vector was ...

A similar test of the CCK-Cre-containing vector was performed by transfecting this plasmid along with a reporter plasmid designed to detect Cre-recombinase activity. The reporter plasmid (CX1-LEL-DsRed) was designed with the coding sequence of the GFP gene and its stop codon flanked by loxP sites, upstream of the coding sequence for DsRed, a red fluorescent protein (RFP). In the absence of Cre-recombinase, this reporter plasmid shows high levels of GFP fluorescence with no red fluorescence; in the presence of Cre-recombinase, the GFP coding sequence and its stop codon are excised, resulting in a loss of GFP expression and the emergence of red fluorescence. We observed high levels of DsRed expression in cells co-transfected with CX1-LEL-DsRed and CCK-Cre (Figure 2), demonstrating the CCK-Cre vector produces detectable levels of Cre-recombinase activity in vitro.

Figure 2
Cre expression vector, and assays for Cre activity. A Cre-reporter plasmid was constructed in which the coding sequence for GFP (including stop codon) was surrounded by LoxP sites (floxed) and placed upstream of DsRed (CX1-LEL, a). A plasmid in which ...

Assessment of the selectivity of promoter activity in vivo

Minimal promoter activity was assessed by performing microinjections of CCK-Cre viral particles into the hippocampus of RosaLacZ mice.9 This transgenic strain expresses the LacZ reporter only in cells in which a floxed stop codon has been excised by Cre-recombinase. As excision of the stop codon is possible even in the presence of only one Cre-recombinase molecule, the expression of LacZ in these animals serves as an extremely sensitive measure of Cre expression from the CCK-Cre virus. In addition to being able to detect extremely low levels of expression, this assay system also provides a sensitive measure of the selectivity of expression from a given promoter, as inappropriate expression would also be detectable with a high degree of sensitivity.

In order to determine the selectivity and expression patterns generated by the Cre-expression vector, it was necessary to select a site of injection in which only a sub-population of cells expressed CCK, and where it might be possible to easily judge the appropriate pattern of expression. To identify a suitable injection site, we performed an in situ hybridization study of CCK mRNA expression within the mouse brain (Figure 3). We chose the CA1, CA3 and dentate gyrus regions of the hippocampus as our injection sites, largely owing to the fact that the stereotyped cytoarchitecture of the hippocampus led to areas in which large numbers of CCK mRNA-positive cells were in close apposition to CCK-negative cells. This was especially true in the dentate gyrus where, in agreement with previous studies (e.g. Marsicano and Lutz10), CCK mRNA expression was observed to be low or absent in the granule cell layer (comprised of densely packed excitatory cells), but extremely high in the interneurons interdigitating the horns of Ammon (polymorph layer of the dentate gyrus, PoDG, Figure 3b).

Figure 3
CCK mRNA expression. CCK mRNA was examined using in situ hybridization, demonstrating high levels of expression within the hippocampal formation (low power: a; high power: b, c) and within the basolateral complex of the amygdala (d). Intense CCK mRNA ...

Representative sections of LacZ expression in virally infected animals are depicted in Figure 4. In addition to assessing LacZ reporter activity, we assessed the expression of CCK mRNA in the same sections subjected to LacZ staining, allowing us to visually colocalize LacZ with CCK mRNA. In situ hybridization rather than double-labeled immunocytochemistry was used to label CCK-positive cells owing to its higher sensitivity, and propensity to yield robust somatic staining (as opposed to the diffuse neuropil staining expected from immunocytochemical staining for the mature CCK-8 peptide). Additionally, identification of CCK-positive cells using hybridization for full-length CCK mRNA avoids the potential complication that distinct cell types may process the immature CCK peptide into different, mature peptide products.

Figure 4
LacZ expression parallels CCK mRNA expression. RosaLacZ Cre-reporter mice were injected with CCK-Cre virus (2 μl/side) and killed 10–12 days later. LacZ expression (blue precipitate) and CCK mRNA expression (silver grains) were assessed ...

We observed that LacZ staining closely paralleled CCK mRNA expression in the dentate, CA1 and CA3 regions of the hippocampus (Figures 3 and and4).4). Colocalization in the dentate was particularly interesting, as the expression of LacZ was largely absent from the pyramidal (presumably excitatory) cells in the upper and lower blades of the dentate, whereas it was extremely high in the interneuron-rich sections in-between the pyramidal cell layers (Figure 3a and c). Notably, this pattern of LacZ expression closely resembles the expression of CCK mRNA, suggesting that whereas the large number of CCK-negative pyramidal neurons in the dentate gyrus were likely infected, that Cre expression was restricted to the minority of CCK mRNA-positive cells. Indeed, when we performed similar injections of CMV-Cre virus into the dentate, we found that these dentate pyramidal cells could readily be induced to express LacZ (Figure 4f). Taken together, these observations suggest that the CCK promoter length used was capable of producing highly selective expression in the appropriate sub-population of cells. Additionally, non-cell-type-specific LacZ expression seen in animals infected with CMV-Cre virus strongly suggested the selectivity of Cre expression was due to the promoter used, rather than to the innate viral tropism.

Assessing the potential for transgene expression in vivo

In the foregoing experiments, following Cre-mediated excision of the stop codon preceding the LacZ coding sequence in the RosaLacZ transgene, the expression of the reporter becomes independent of Cre-recombinase expression driven by the CCK promoter. This uncoupling of LacZ expression from promoter-driven transgene expression, although providing high sensitivity, leaves open the question of the amount of transgene expression generated by the CCK promoter in vivo.

We addressed this question by performing hippocampal injections of viral particles in which the CCK promoter drove the expression of GFP (CCK-GFP). We observed that GFP expression in various subfields of the hippocampus was generally similar to the patterns of expression seen in our prior experiments. More specifically, we observed that the expression of GFP in the dentate was contained to the interneuron-rich regions in-between the pyramidal cell layers of the dentate, reflecting the expression patterns seen for CCK mRNA in the dentate and the pattern of LacZ expression in the higher sensitivity CCK-Cre experiments. The high level of GFP expression seen in these experiments suggests that the CCK promoter length used here may be suitable to drive selective expression of transgenes in vivo. Additionally, the high levels of expression generated by this promoter may make it useful in the generation of transgenic mouse strains.

Transgene expression for fluorescence-guided electrophysiologic recordings in rats

One of the main advantages of virally mediated transgene expression is the potential for using these vectors in a number of different species. Building on this possibility, we examined the suitability of using the CCK-GFP virus in rats, as a means of identifying CCK-positive interneurons for the purpose of electrophysiologic recording (Figure 5). Following on previous work from the laboratory of Donald Rainnie characterizing the electrophysiologic properties of interneurons in the rat brain,1113 we explored the use of the CCK-GFP virus as a means to label cells for fluorescently guided electrophysiologic recording in vitro. Twelve days following in vivo infection, acute brain slices were prepared and electrophysiologic recordings were obtained from visually identified CCK-GFP-infected neurons of the rat hippocampus. An example of such a recording is shown in Figure 6, and demonstrates the viability of using cell-type-selective viral promoters to label and characterize the electrophysiologic properties of sub-populations of neurons. Using such a method to label cell types of interest allows for their targeted recording, which can be particularly advantageous if the desired cell type is present in low numbers or is found in close apposition to other cell types, as is commonly the case. Efforts are currently underway to use this technique to characterize the CCK-containing interneurons of the basolateral amygdala, a region in which routine recordings generally provide a low yield of interneurons in general, and an even lower yield of CCK+ neurons, owing to the fact that CCK+ interneurons represent a modest percentage (<5%) of the total neuronal population of the basolateral amygdala.14

Figure 5
GFP expression in vivo. Virus encoding CCK-GFP was injected into the dentate gyrus of C57/BL6 adult mice (2 μl/side over 10 min). Animals were killed 10 days later and fluorescence was assessed on sectioned, fixed tissue. Examples from sections ...
Figure 6
Example recording from rat interneurons. Acute brain slices were prepared from juvenile rats 12 days post-infusion of CCK-GFP into the CA1 region of the hippocampus (ad). GFP fluorescence (b) was first used to identify a putative CCK interneuron ...

Identified promoter lengths can be used to generate transgenic animals

Although the aforementioned viral vectors can be used to induce transgene expression in restricted regions, in many cases widespread transgene expression is desirable. To assess the suitability of using promoter lengths identified in the aforementioned manner for the production of transgenic mice, we subcloned the coding sequence for Cre-IRES-DsRed into the CCK-GFP vector. This new plasmid (CCID) was then linearized and microinjected into C57/BL6 embryos. These injections yielded three founders carrying the CCID gene, and these were subsequently mated with RosaLacZ reporter mice to assess transgene expression. The patterns of Cre-mediated LacZ expression, depicted in Figure 7, suggest that the CCK promoter was capable of driving Cre expression in the transgenic construct. The expression of LacZ varied widely among the three founder lines, although ubiquitous, non-selective expression was not observed in any of the lines. The variability of expression suggests that there may be significant silencing of transgene expression depending on the insertion site of the recombinant sequence, a commonly observed phenomenon in neural systems15 (this was especially true for the DsRed portion of the gene, which appeared to be completely silenced in all three transgenic lines). Animals from CCID line B showed the widest expression of LacZ, which was essentially identical to endogenous CCK gene expression (Figure 7a and c), suggesting that they may be suitable for use in generating CCK-selective knockouts when crossed with animals containing floxed transgenes.

Figure 7
LacZ expression in transgenic animals. Linearized template DNA in which the coding sequence for Cre-IRES-DsRed was placed under the control of the CCK promoter (CCID) was used to create transgenic mice according to the procedures described in the Materials ...

Discussion

We have described the production of a viral vector incorporating a cell-type-specific promoter (CCK) that generates high levels of gene expression with a high degree of specificity, and can be used in multiple species. More broadly, given the time and expense involved in the production of transgenic animals (and the sizable chance that an appropriate gene insert will not be found), we outlined an alternative means of screening usable promoter lengths in vivo. As part of this screening process, we described high-sensitivity screens for the cell-type specificity of particular promoters by making use of Cre-mediated recombination in reporter mouse strains. This high-sensitivity approach was complemented by using the same promoter to express a fluorescent-reporter gene to assess in vivo activity of the promoter length chosen. This technique was also used to label sub-populations of neurons for in vitro electrophysiologic characterization in rats. Finally, the identified promoter was used to produce transgenic animals, through injection of purified DNA. Additionally, the possibility exists for using these same vectors to achieve virally mediated transgenesis of oocytes or spermatogonia.16,17 In addition to these applications, cell-type-selective viral vectors could potentially be used to generate region-specific, cell-type-selective expression of desired transgenes, as well as region-specific, cell-type-selective, post-developmental knockout of floxed genes.

The identification of a functioning CCK mini-promoter will be quite useful for studies aimed at understanding the function of the CCK sub-population of inter-neurons10,18 within cortical and subcortical regions. CCK has been implicated in a variety of psychiatric disorders,5,19,20 and the ability to now specifically manipulate activity of CCK-specific neurons in vivo will allow a greater understanding of the circuit-specific functions of this population.

Taken together, the method outlined here represents a streamlined technique, which allows for the reliable assessment of promoter specificity in vivo, whereas at the same time producing useful viral tools usable in a variety of different contexts. This, in turn, may lead to the more rapid development of tools to dissect out the roles of various cell types in complex neural circuits. Eventually, the identification of mammalian promoters that provide this sort of restricted, cell-type-specific expression may lead to the development of more precisely targeted gene delivery vectors for use in clinical settings.

Materials and methods

Plasmid design and construction

Primers were designed to amplify a region of the CCK gene containing the ATG transcription start sequence and upstream stretch of ~3 kb base pairs, using mouse fibroblast DNA as a template. The resulting polymerase chain reaction (PCR) products were then cloned into topo v2.1 (Invitrogen Corp., Carlsbad, CA, USA), and subsequently into a lentiviral packaging construct, pCMV-GFP-dNhe21 (kind gift of Inder Verma, Salk Institute, La Jolla, CA, USA). Incorporated into the original primers were custom restriction sites used for subcloning this promoter length into the PCMV-GFP-dNhe (5 ′ Cla1: ccatcgattcccagggaagatgaagaaaccatggctac; 3′ BamH1 tag gatccctcttcatggctatgggaagcaaaggcag) vector to generate CCK-green fluorescent protein (GFP). Subsequently, the GFP coding sequence from CCK-GFP was removed (BamH1/Sal1 fragment) and replaced with the coding sequence for Cre-recombinase (with an N-terminus nuclear localization sequence; BamH1/Sal1 fragment) to generate the CCK-Cre vector.

Viral production procedures have been described in detail22,23 and follow from procedures initially outlined by Verma and co-workers.4,24,25 In brief, active viral particles were produced by co-transfecting these lentiviral packaging constructs with plasmids coding for delta8.9 (env) and vesicular stomatitis virus G into HEK293T cells. The packaged, unconcentrated virus was collected over a period of 5 days post-transfection, and then concentrated using ultracentrifugation and resuspension in sterile phosphate-buffered saline (PBS)/1% bovine serum albumin. The resulting titer was assessed in HEK293T cells, and the observed titer of the virus used here ranged from 5 × 108 to 1 × 109 infectious particles per ml

Animal subjects

The procedures used were approved by the Institutional Animal Care and Use Committee of Emory University and in compliance with National Institutes of Health (NIH) guidelines for the care and use of laboratory animals. Breeding pairs for transgenic Cre-reporter mice were obtained from Jackson Labs, Bar Harbor, ME, USA. Male animals carrying the RosaB26-floxed LacZ insert (RosaLacZ9) and aged 6–10 weeks were anesthetized with a 4:5 mixture of Ketamine and Domitor (given intraperitoneally), and then injected bilaterally into the hippocampus with 2 μl (per side) of concentrated CCK-Cre virus in a stereotaxic apparatus (0.2 μl/min; coordinates with respect to bregma: AP: −1.8 mm; ML: ± 1.0 mm; DV: −1.5 mm). Similar procedures were used for CCK-GFP injections into wild-type, C57-BL6 animals (Jackson Labs), and into juvenile (4–6 weeks old) Sprague–Dawley rats (Charles River, Raleigh, NC, USA) (infusion parameters: 0.2 μl/min; coordinates with respect to bregma: AP: −2.0 mm; ML: ± 1.4 mm; DV: −2.4 mm).

Tissue preparation

Animals were killed 10–12 days post-infection with an overdose of chloral hydrate. In experiments where in situ hybridization was to be performed, the brains were rapidly dissected, snap-frozen and sectioned at 30 μM onto SuperFrost Plus slides, which were then stored at −80°C until processing. In other experiments, intra-cardiac perfusion (PBS, 4% paraformaldehyde), a brief post-fixation step (2 h, 4% paraformaldehyde), and cryoprotection (20% sucrose in PBS, ~16 h at 4°C) preceded sectioning and storage at −80°C.

In situ hybridization

This protocol has been described in detail previously.26,27 A cDNA clone containing the coding sequence of the mouse gene for CCK was linearized after sequence verification. An antisense riboprobe was generated with T3 RNA polymerase. Slide-mounted sections of snap-frozen rodent brain tissue were post-fixed, proteinase K digested, blocked and followed by overnight hybridization of the tissue at 52°C with 35S-UTP labeled riboprobes. After a stringent wash protocol, slides were dipped in an autoradiographic emulsion for 4 weeks and then developed.

LacZ/XGal staining

Before in situ hybridization, slide-mounted tissue was incubated at 37°C overnight in 1 mg/ml XGal dissolved in 150 mM potassium ferricyanide, 150 mM potassium ferrocyanide and 20 mM magnesium chloride, in 1 × PBS. The resulting sections were thoroughly rinsed in 1 × PBS and then processed for in situ hybridization.

Electrophysiologic methods

Ten to twelve days after CCK-GFP virus infusion, rats were decapitated under isoflurane anesthesia (Abbott Laboratories, North Chicago, IL, USA), and the brains rapidly removed and placed in ice-cold kynurenic acid-based artificial cerebrospinal fluid containing (ACSFKA), which contained (in mM): NaCl (130), KCl (3.5), KH2PO4 (1.1), MgCl2 (6.0), CaCl2 (1.0), NaHCO3 (30), glucose (10) and kynurenic acid (2) as described previously.11,12,28 A block of tissue containing the hippocampus was then mounted on the chuck of a Leica VTS-1000 vibrating microtome (Leica Microsystems Inc., Bannockburn, IL, USA), and 350 μm coronal slices were cut. Slices were then hemisected and transferred to a holding chamber containing ACSFKA at room temperature and gassed with a 95–5% oxygen/carbon dioxide mixture for 1 h before being placed in oxygenated control ACSF containing (in mM): NaCl (130), KCl (3.5), KH2PO4 (1.1), MgCl2 (1.3), CaCl2 (2.5), NaHCO3 (30) and glucose (10). Experiments started a minimum of half an hour following the transfer of slices into the control ACSF.

Visual identification of CA1 neurons

To visualize neurons, slices were placed in a Warner Series 20 recording chamber (Warner Instruments, Hamden, CT, USA) mounted on the fixed stage of a Leica DM-LFS microscope (Leica Microsystems). Slices were fully submerged and continuously perfused at a rate of 1–2 ml per min with heated (32°C) and oxygenated ACSF. Neurons were visualized using either infrared (IR) illumination together with differential interference contrast (DIC) optics or fluorescence with a × 40 water immersion objective (Leica Microsystems). Images were recorded using an IR-sensitive charge-coupled device digital camera (Orca ER, Hamamatsu, Tokyo, Japan) coupled to a Meteor-II video frame grabber (Matrox Electronic Systems Ltd, Dorval, Canada), and displayed on a computer monitor using Simple PCI 6.11 software (Compix Inc., Cranberry Township, PA, USA).

Recording procedures

Thick-walled borosilicate glass patch electrodes (WPI, Sarasota, FL, USA) were pulled on a Flaming/Brown micropipette puller (Model P-97), and had resistances ranging from 4 to 8 MΩ, when filled with a standard patch recording solution that contained 0.3% biocytin and (in mM): K-gluconate (138), KCl (2), MgCl2 (3), phosphocreatine (5), K-ATP (2), NaGTP (0.2), N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid (10) and 0.3% biocytin. The patch recording solution was adjusted to a pH of 7.3 with KOH and filtered through a 0.2 μm filter (Altech Associates, Inc., Deerfield, IL, USA). Whole-cell patch clamp recordings were obtained with standard techniques, as described previously.11,12,28 Briefly, recordings were made with an Axopatch-1D amplifier (Molecular Devices, Sunnyvale, CA, USA) using a Digidata 1320A A–D interface and pClamp 8.2 software (Molecular Devices). In cell-attached mode, patch electrode seal resistance was considered acceptable if it was >1.5 GΩ. Whole-cell patch clamp configuration was established in neurons in current-clamp mode, and all data were filtered at 5 kHz. The membrane input resistance (Rm) and intrinsic currents, activated at membrane potentials more negative than −60 mV, were assessed by determining the voltage response to transient (750 mS) current injection ranging from −40 to +23 pA.

Transgenic production

The coding sequence for Cre-recombinase was sub-cloned upstream of the internal ribosomal entry site (IRES) sequence in the pCMV-IRES-DsRed2 vector (Invitrogen). A fragment containing Cre-IRES-DsRed2 was then inserted in place of GFP in the CCK-GFP vector. The resulting plasmid (CCK-Cre-IRES-DsRed2 or CCID) was linearized, purified and microinjected into the pronuclei of one-cell C57/BL6 embryos, which were then implanted into pseudo-pregnant C57/BL6 females. The purification and injections were performed at the Emory University Transgenic Facility. Three founder animals (lines A, B and C) were obtained following these injections. Subsequent to PCR verification of their genotypes, founders were mated to mice hemizygous for the RosaLacZ (see above). F1 animals from these matings were genotyped, and animals carrying both the CCID and RosaLacZ alleles were killed, sectioned and Cre-mediated recombination was assessed through XGal staining, as outlined above. Notably, none of the three lines showed any observable DsRed fluorescence, suggesting that DsRed expression was silenced in all three lines. Furthermore, the low frequency of Cre+ animals from these matings suggested that carriers of the CCID allele may have reduced survival as compared to their CCID-negative littermates.

Acknowledgments

Support was provided by NIH (MH074097, MH069884, MH070218), NARSAD, the Burrough’s Wellcome Fund, the Center for Behavioral Neuroscience (NSF agreement IBN-987675), and by NIH/NCRR base grant (P51RR000165) to Yerkes National Primate Research Center.

References

1. Wong LF, Goodhead L, Prat C, Mitrophanous KA, Kingsman SM, Mazarakis ND. Lentivirus-mediated gene transfer to the central nervous system: therapeutic and research applications. Hum Gene Ther. 2006;17:1–9. [PubMed]
2. Ehrengruber MU, Hennou S, Bueler H, Naim HY, Deglon N, Lundstrom K. Gene transfer into neurons from hippocampal slices: comparison of recombinant Semliki Forest Virus adeno-virus adeno-associated virus lentivirus and measles virus. Mol Cell Neurosci. 2001;17:855–871. [PubMed]
3. Fleming J, Ginn SL, Weinberger RP, Trahair TN, Smythe JA, Alexander IE. Adeno-associated virus and lentivirus vectors mediate efficient and sustained transduction of cultured mouse and human dorsal root ganglia sensory neurons. Hum Gene Ther. 2001;12:77–86. [PubMed]
4. Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L, et al. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol. 1998;72:9873–9880. [PMC free article] [PubMed]
5. Abelson JL. Cholecystokinin in psychiatric research: a time for cautious excitement. J Psychiatr Res. 1995;29:389–396. [PubMed]
6. Hadjiivanova C, Belcheva S, Belcheva I. Cholecystokinin and learning and memory processes. Acta Physiol Pharmacol Bulg. 2003;27:83–88. [PubMed]
7. Moran TH, Schwartz GJ. Neurobiology of cholecystokinin. Crit Rev Neurobiol. 1994;9:1–28. [PubMed]
8. Fink H, Rex A, Voits M, Voigt JP. Major biological actions of CCK – a critical evaluation of research findings. Exp Brain Res. 1998;123:77–83. [PubMed]
9. Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 1999;21:70–71. [PubMed]
10. Marsicano G, Lutz B. Expression of the cannabinoid receptor CB1 in distinct neuronal subpopulations in the adult mouse forebrain. Eur J Neurosci. 1999;11:4213–4225. [PubMed]
11. Rainnie DG, Mania I, Mascagni F, McDonald AJ. Physiological and morphological characterization of parvalbumin-containing interneurons of the rat basolateral amygdala. J Comp Neurol. 2006;498:142–161. [PubMed]
12. McDonald AJ, Mascagni F, Mania I, Rainnie DG. Evidence for a perisomatic innervation of parvalbumin-containing interneurons by individual pyramidal cells in the basolateral amygdala. Brain Res. 2005;1035:32–40. [PubMed]
13. Rainnie D, Asprodini E, Shinnick-Gallagher P. Inhibitory transmission in the basolateral amygdala. J Neurophysiol. 1991;66:99–109.
14. Mascagni F, McDonald AJ. Immunohistochemical characterization of cholecystokinin containing neurons in the rat basolateral amygdala. Brain Res. 2003;976:171–184. [PubMed]
15. McBurney MW, Mai T, Yang X, Jardine K. Evidence for repeat-induced gene silencing in cultured mammalian cells: inactivation of tandem repeats of transfected genes. Exp Cell Res. 2002;274:1–8. [PubMed]
16. Ikawa M, Tergaonkar V, Ogura A, Ogonuki N, Inoue K, Verma IM. Restoration of spermatogenesis by lentiviral gene transfer: offspring from infertile mice. Proc Natl Acad Sci USA. 2002;99:7524–7529. [PMC free article] [PubMed]
17. Hofmann A, Kessler B, Ewerling S, Weppert M, Vogg B, Ludwig H, et al. Efficient transgenesis in farm animals by lentiviral vectors. EMBO Rep. 2003;4:1054–1060. [PMC free article] [PubMed]
18. McDonald AJ. Morphology of peptide-containing neurons in the rat basolateral amygdaloid nucleus. Brain Res. 1985;338:186–191. [PubMed]
19. Bissette G, Nemeroff CB. Do neuropeptide systems mediate some of the effects of antipsychotic drugs? Prog Clin Biol Res. 1985;192:349–353. [PubMed]
20. Bradwejn J, Koszycki D, Meterissian G. Cholecystokinin-tetra-peptide induces panic attacks in patients with panic disorder. Can J Psychiatry. 1990;35:83–85. [PubMed]
21. Tiscornia G, Singer O, Ikawa M, Verma IM. A general method for gene knockdown in mice by using lentiviral vectors expressing small interfering RNA. Proc Natl Acad Sci USA. 2003;100:1844–1848. [PMC free article] [PubMed]
22. Rattiner LM, Davis M, French CT, Ressler KJ. Brain-derived neurotrophic factor and tyrosine kinase receptor B involvement in amygdala-dependent fear conditioning. J Neurosci. 2004;24:4796–4806. [PubMed]
23. Chhatwal JP, Stanek-Rattiner L, Davis M, Ressler KJ. Amygdala BDNF signaling is required for consolidation but not encoding of extinction. Nat Neurosci. 2006;9:870–872. [PMC free article] [PubMed]
24. Miyoshi H, Blomer U, Takahashi M, Gage FH, Verma IM. Development of a self-inactivating lentivirus vector. J Virol. 1998;72:8150–8157. [PMC free article] [PubMed]
25. Pfeifer A, Brandon EP, Kootstra N, Gage FH, Verma IM. Delivery of the Cre recombinase by a self-deleting lentiviral vector: efficient gene targeting in vivo. Proc Natl Acad Sci USA. 2001;98:11450–11455. [PMC free article] [PubMed]
26. Ressler KJ, Sullivan SL, Buck LB. A zonal organization of odorant receptor gene expression in the olfactory epithelium. Cell. 1993;73:597–609. [PubMed]
27. Rattiner LM, Davis M, Ressler KJ. Differential regulation of brain-derived neurotrophic factor transcripts during the consolidation of fear learning. Learn Mem. 2004;11:727–731. [PubMed]
28. Rainnie DG, Holmes KH, Shinnick-Gallagher P. Activation of postsynaptic metabotropic glutamate receptors by trans-ACPD hyperpolarizes neurons of the basolateral amygdala. J Neurosci. 1994;14:7208–7220. [PubMed]
29. Pawelzik H, Hughes DI, Thomson AM. Physiological and morphological diversity of immunocytochemically defined parvalbumin- and cholecystokinin-positive interneurones in CA1 of the adult rat hippocampus. J Comp Neurol. 2002;443:346–367. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links