pmc logo image
Logo of cjvetresReference to the Publisher site.Journal Web siteSee also Canadian Journal of Comparative Medicine.Journal Web siteHow to Submit

Formats:

Can J Vet Res. 2008 July; 72(4): 340–349.
PMCID: PMC2442677
Characterization of endothelin receptors in the peripheral lung tissues of horses unaffected and affected with recurrent airway obstruction
Sumanth Polikepahad, Masudul Haque, Joseph Francis, Rustin M. Moore, and Changaram S. Venugopal
Equine Health Studies Program, Departments of Comparative Biomedical Sciences (Polikepahad, Haque, Francis) and Veterinary Clinical Sciences (Moore,Venugopal), School of Veterinary Medicine, Louisiana State University, Baton Rouge, Louisiana, 70803 USA
Address all correspondence to Dr. Changaram S.Venugopal; telephone: (225) 578-9748; fax: (225) 578-9559; e-mail: cvenugopal/at/vetmed.lsu.edu
Dr. Moore’s current address is Department of Veterinary Clinical Sciences, College of Veterinary Medicine, Ohio State University, 601 Vernon L. Tharp Street, Columbus, Ohio, 43210 USA.
Received December 19, 2006; Accepted November 19, 2007.
The purpose of the study was to determine and compare the expression of endothelin (ET) receptors in the peripheral lungs of healthy horses and those affected with recurrent airway obstruction (RAO) using reverse transcriptase polymerase chain reaction (RT-PCR), real-time PCR, Western blot analysis, and immunohistochemical techniques. Two groups of horses (7 healthy and 7 RAO-affected) were selected from a pool of horses destined for euthanasia. The grouping of horses was based on the history, clinical scoring, and pulmonary function testing. After euthanasia, gross postmortem evaluation of the lungs was conducted, and lung samples were collected and either stored at −80°C or fixed in zinc-formalin for 12 h. The RT-PCR was performed by using specific primers for ETA and ETB receptors, and β-actin. To determine the relative gene expression real-time PCR was performed. To detect ET receptor protein expression, Western blotting and immunohistochemical studies were performed using polyclonal antibodies against ETA and ETB receptors and β-actin. The ET receptor expression was determined by performing either densitometric analyses or scoring of immunostaining. Statistical analyses were performed to detect differences in receptor expression within and between the 2 groups. The results indicated that ET receptor expression, particularly ETB receptors, was significantly greater in the peripheral lungs of RAO-affected horses than in those of healthy horses. Clinical trials using ET receptor antagonists, particularly ETB antagonists might help in developing a therapeutic strategy to treat this career-ending disease.
L’objectif de la présente étude était de déterminer et comparer l’expression des récepteurs de l’endothéline (ET) dans les poumons périphériques de chevaux en santé et de chevaux souffrant d’obstruction récurrente des voies respiratoires (RAO) par réaction d’amplification en chaîne par la polymérase à l’aide de la transcriptase réverse (RT-PCR), par PCR en temps réel, par réaction d’immunobuvardage et par techniques immunohistochimiques. Deux groupes de chevaux (7 en santé et 7 atteints de RAO) ont été sélectionnés à partir d’un regroupement de chevaux destinés à l’euthanasie. Le groupement des chevaux s’est fait sur la base de l’anamnèse, le pointage clinique, et un test de fonction respiratoire. Après l’euthanasie, une évaluation des lésions macroscopiques des poumons a été faite, et des échantillons de poumons prélevés et soit entreposés à −80 °C ou fixé pendant 12 h dans une solution de zinc-formaline. L’épreuve de RT-PCR a été effectuée en utilisant des amorces spécifiques pour les récepteurs ETA et ETB, et β-actine. Afin de déterminer l’expression génique relative une épreuve de PCR en temps réel a été effectuée. Afin de déterminer l’expression des récepteurs ET, les épreuves d’immunobuvardage et immunohistochimiques ont été effectuées en utilisant des anticorps polyclonaux contre les récepteurs d’ETA et d’ETB ainsi que ceux pour β-actine. L’expression de récepteur ET a été déterminée en réalisant des analyses densitométriques ou en attribuant un pointage à l’immunocoloration. Les analyses statistiques ont été faites afin de détecter des différences dans l’expression des récepteurs à l’intérieur et entre les 2 groupes. Les résultats indiquent que l’expression des récepteurs ET, en particulier les récepteurs ETB, était significativement plus grande dans les poumons périphériques des chevaux atteints de RAO que ceux des chevaux en santé. Des essais cliniques utilisant des antagonistes des récepteurs ET, plus particulièrement les antagonistes ETB, pourraient aider au développement d’une stratégie pour traiter cette maladie qui met fin à une carrière.
(Traduit par Docteur Serge Messier)
Recurrent airway obstruction (RAO), a common pulmonary condition observed in horses worldwide, is characterized by chronic cough, exercise intolerance, labored expiratory effort, and nasal discharges (1). The inflammatory response in this disease is manifested by airway inflammation, bronchoalveolar lavage fluid (BALF) neutrophilia, and elevated levels of inflammatory mediators such as histamine, bradykinin, leukotrienes, platelet activating factor (PAF), endothelin-1, and 15-HETE (1). This disease has 2 forms, the most widely reported being chronic obstructive pulmonary disease (COPD) commonly referred to as heaves, which occurs in the temperate regions of the world. The other form, known as summer pasture-associated obstructive pulmonary disease (SPAOPD), is a seasonal disease afflicting adult horses in the late summer and early fall. This form is common in the southeastern United States, where the warm and humid climate enhances the growth of certain types of molds in the pasture, which are believed to act as potential aeroallergens in susceptible horses (2). The RAO-affected horses in this study are SPAOPD-affected horses.
Endothelin-1 (ET-1) is a potent smooth muscle constrictor and an inflammatory mediator. It elicits its actions by acting through 2 types of receptors, namely endothelin-A (ETA) and endothelin-B (ETB), both of which are G-protein coupled heptameric transmembrane receptors. Physiologically, ET-1 plays an important role in the maintenance of vascular and airway tone (3). Endothelin-1 can cause potent contraction of vascular and nonvascular smooth muscles in vivo and in vitro by directly acting through its receptors (3). This receptor can also cause vasodilatation and bronchodilatation by releasing nitric oxide and prostaglandin E2 (PGE2) from vascular endothelium and airway epithelium, respectively (47). Additionally, ET-1 can potentiate cholinergic nerve-mediated contractions of isolated mouse and human tracheae by acting through ETB receptors (8,9). Endothelin-1 can also induce the release of acetylcholine from nerve endings by acting through both ETA and ETB receptors in isolated rat and rabbit tracheae (10,11). Endothelin-1 stimulates deoxyribonucleic acid (DNA) synthesis and cell proliferation in various cells by synergistically acting as a comitogen with other growth factors including epidermal growth factor (EGF), platelet activating factor (PAF), and platelet-derived growth factor (PDGF) (12). Endothelin-1 can elicit proinflammtory effects on airways. Reports indicate that in experimental pulmonary allergic inflammation, ET-1 can up-regulate cytokines such as interleukin (IL)-1, IL-8, tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), and IL-4 (13).
Much evidence suggests that ET-1 plays an important role in the pathogenesis of allergic airway diseases of humans and other species. For example, pulmonary ET-1 levels have been shown to be increased in human asthma, human COPD, and experimental allergic inflammation in rats (1315). Similarly, Benamou et al (16) have reported ET-1 levels in the systemic circulation and BALF that are greater in horses affected with RAO than those of normal horses. These researchers also demonstrated the spasmogenic action of ET-1 in the isolated 3rd-generation pulmonary arteries and bronchi in horses. In these studies, Benamou et al (17) showed that ET-1 elicits in vitro bronchial constriction in horses by acting through both ETA and ETB receptors. Our previous pharmacological studies have revealed that when equimolar concentrations of ET-1 are applied to the bronchial tissues of healthy and RAO-affected horses, the ET-1-induced concentration-dependent contraction was significantly greater in affected horses, suggesting that receptor alterations occur in airway hyperreactivity (18). A follow-up study conducted using immunohistochemical staining methods revealed over-expression of ET receptors, particularly ETB receptors, in the upper airway smooth muscles of affected horses. This seemed to correlate well with the hyperresponsiveness of bronchial rings observed in RAO-affected horses (19). In our pharmacological response studies, the ETB-receptor mRNA expression of the pooled pulmonary tissues showed an increase in affected horses compared with unaffected horses. Although the increase was not statistically significant, this result indicated ETB receptors have a tendency to be up-regulated in RAO. This finding prompted us to hypothesize that the expression of ET receptors would be greater throughout the lung in RAO-affected horses. The objective of the current study, therefore, was to determine and compare the expression of ET receptors in the peripheral lungs of healthy and RAO-affected horses by employing reverse transcriptase-polymerase chain reaction (RT-PCR), real-time PCR, Western blotting, and immunohistochemical techniques.
Horses
This study was approved by the Institutional Animal Care and Use Committee of Louisiana State University, and was part of an ongoing large research program in which horses destined for euthanasia were grouped and donated for research use regularly. After euthanasia, tissues were collected, labeled, and stored at −80°C for further studies. All of the pulmonary tissues used in the present study, therefore, were not obtained from horses used in previous studies; additional horses were added to the pool.
All RAO-affected horses had a history of signs of obstructive pulmonary disease after they were exposed to pasture in the summer (19). Seven healthy (or control) horses, 10- to 20-y old [mean ± standard deviation (s), 15.8 ± 4.1 y] and 7 RAO-affected horses, 10- to 20-y old (16.5 ± 3.2 y) were included in the study.
Clinical evaluation
All RAO-affected horses used in the study were kept on pasture until they began showing exacerbation of clinical signs. Clinical evaluation was conducted by the authors and skilled technical staff immediately after horses started showing signs of RAO. During the clinical evaluation, all affected horses showed characteristic signs of obstructive pulmonary diseases such as cough, exaggerated expiratory effort, and respiratory wheezes on auscultation, abdominal lift, and flared nostrils (18). Rectal temperature (°F), heart rate (beats/min), respiratory rate (breaths/min), nostril flare, and abdominal lift were recorded. In addition, respiratory sounds were assessed by auscultation, and the clinical score (CS) and transpleural pressures (ΔPpl) were determined.
Clinical scoring (CS)
Clinical scores were determined using the following algorithm (20):
equation M1
Each variable in this algorithm was scored from 0 to 4. A score of “0” indicated that the nostril had little movement and the ventral flank showed little or no movement. A score of “4” indicated that the nostril remained maximally flared throughout the respiratory cycle and the abdominal lift resulted in a “heave line” that extended cranially to the 5th intercostal space. Thus, the maximum clinical score of a horse affected with RAO cannot exceed “8.”
Transpleural pressure (ΔPpl)
The transpleural pressure (ΔPpl) was measured indirectly using an esophageal balloon secured over the end of a catheter that was connected to a pressure transducer interfaced with a polygraph (Grass Medical Instruments, Warwick, Rhode Island, USA). A 10-cm long, 3.5-cm circumference balloon was placed over the end of a 2-m long, 2-mm diameter canula. The balloon was inserted through a lubricated nasogastric tube that was passed into the rostral esophagus. Once the balloon was located between the heart and diaphragm, the nasogastric tube was removed. The balloon was inflated with 1.5 mL of water and measurements were recorded for 1 min. Changes in the esophageal pressure (peak inspiratory minus peak expiratory pressures) during tidal breathing reflected the transpleural pressure.
Grouping —
For inclusion in the study, all horses must have had normal reference values of rectal temperature, heart rate, respiratory rate, and thoracic auscultation. In addition, none of the horses included in this study had received any medication for at least 7 d before clinical evaluation. Horses with long-term corticosteroid treatment and those with recent vaccination and de-worming medications were also eliminated from the study. To be included in the RAO-affected group, in addition to the history of RAO, the horses must have had a CS ≥ 5.0 and a ΔPpl ≥ 15.0 cm of H2O. To be included in the healthy group, the horses must have had a CS ≤ 4.0 and a ΔPpl ≤ 10 cm of H2O.
Tissue collection and processing
The next day after grouping, horses were humanely euthanatized using an intravenous overdose (90 mg/kg) of sodium pentobarbital (Beuthanasia; Schering-Plough Animal Health, Kenilworth, New Jersey, USA). Gross postmortem evaluation of the lungs was conducted during their removal from the thoracic cavity. Samples were collected from the same region of each lung lobe in each horse. For immunohistochemistry, 5 samples measuring approximately 3 × 3 cm were collected, 1 from each lung lobe, placed in zinc-formalin, and fixed for 12 h. Fixed samples were dehydrated with graded concentrations of ethyl alcohol (70%, 90%, and 100%) and subsequently cleared with xylene; samples were then embedded in paraffin. These paraffin blocks containing tissue sections were stored until used for immunohistochemical studies. For Western blotting, RT-PCR studies, and real-time PCR, 5 samples collected from the same region of each lung lobe as samples collected for immunohistochemistry, were collected from each horse, snap frozen in liquid nitrogen, and stored at −80°C. Rat lung samples, which were used as positive controls, were also collected in a similar manner for all 3 studies.
Antibodies, primers, and controls
The anti-ETA receptor polyclonal primary antibodies (Biodesign International, Saco, Maine, USA) used in the present study were raised in sheep against the immunogen sequence (Q410-E-Q-N-H-N-T-E-R-S-S-H-K422 amino acid residues), which is part of the C-terminal region of rat ETA receptor. Similarly, anti-ETB receptor polyclonal primary antibodies (Biodesign International) were raised in sheep against the immunogen sequence (K424-A-N-D-H-G-Y-D-N-F-R-S-S-N-N438 amino acid residues), which is part of the C-terminal region of rat ETB receptor. For PCR, the following primers were used:
ETA (sense — 5′CTTGGAGACCTTATCTACGTGGTC 3′ and antisense — 3′TCACACCTGTCCATGTCTCGTCA 5′);
ETB (sense — 5′AGTCGAGATGTGTAAGCTGGTGC 3′ and antisense — 3′TCAATAGACGCTTAGACGGACGACGAAGT 5′);
and
β-actin (sense — 5′ 3′ and antisense — 3′TAAGACCGGAGTAACAGGTG 5′).
The ETB receptors of horse and rat share 85% identity (21). Moreover, the C-terminal peptide of rat ETB receptor that was used to generate antibodies bears 100% homology to the C-terminal region of equine ETB receptor at the 424–438 amino acid locations. Similarly, the ETB receptor primer used in this study has 95% identity with the sequence of ETB receptor of rats and humans at the corresponding location on the gene (21). These observations are based on the sequence similarity search on the Swiss Institute of Bioinformatics (SIB) Basic Local Alignment Search Tool (BLAST) network service. However, ETA receptors are not yet sequenced in horses. Owing to the extreme conservation of ET receptor sequences in mammalian species, it was assumed that the antibodies and primers designed for rat ETA receptors would cross-react with equine ETA receptors (21). To confirm the cross-reactivity of antibodies and primers, preliminary Western blot and PCR analyses were performed on rat and equine lung samples. Rat lung samples were also used as positive controls in the immunohistochemical studies; negative controls were used in all 3 studies.
Ribonucleic acid (RNA) extraction
Five independent replications (one/lobe) per horse were used for the RT-PCR studies. Application of RNAse decontamination solution (RNAse Zap; Ambion, Austin, Texas, USA) ensured that all microtubes, gloves, and equipment were RNAse free. Lung samples were thawed on ice and homogenized in 1.0 mL of TRI reagent (Molecular Research Center, Cincinnati, Ohio, USA) with Ultra Turrax T8 (IKA Works, Wilmington, North Carolina, USA). After homogenization, all samples were allowed to settle for 5 min. Chloroform (200 μL) was added to each homogenized samples and immediately the microtubes were vortexed vigorously for 15 s. Samples were allowed to settle on ice until 2 phases of liquid were noticed, after which all microtubes were centrifuged at 16 000 × g at 4°C for 15 min. The clear upper aqueous phases were collected in separate microtubes. Equal volumes of 2-proponol were added, mixed, and allowed to settle for 10 min at room temperature. All microtubes were then centrifuged at 16 000 × g at 4°C for 10 min and the supernatant was decanted carefully from all microtubes. Subsequently, 1 mL of 70% ethanol was added to each tube and the microtubes were centrifuged at 16 000 × g at 4°C for 6 min. Ethanol was decanted, RNA pellets were air-dried, and the total RNA was dissolved in nuclease-free DEPC-treated water. Total RNA was quantified by using spectrophotometer (ND-1000; NanoDrop Technologies, Wilmington, Deleware, USA).
Reverse transcriptase-polymerase chain reaction (RT-PCR)
The RT-PCR was performed as described previously (22). For reverse transcription, 1.5 μg of total RNA was used. To each sample, oligo dT (2.0 μM) and dNTPs (0.5 μM) were added. The mixture was incubated at 65°C for 5 min and the microtubes were quickly cooled on ice. An RT buffer, dithiothreitol (DTT) (0.002M), RT-MLV (10 U), and RNAse inhibitor (2 U) were added to the mixture according to manufacturer’s instructions (M-MLV Reverse Transcriptase and Platinum Pfx DNA Polymerase; Invitrogen, Carlsbad, California, USA). This final mixture was incubated at 37°C for 55 min and at 70°C for 15 min, successively. The PCR mixture contained double distilled water, 1.5 μL cDNA, PCR buffer, 2.5 mM MgSO4, 0.5 mM dNTP, 0.25 U Taq polymerase, and sense and antisense primers (0.5 μM each). The PCR reactions were performed in a PCR machine at 40 cycles (Mastercycler gradient, Eppendorf; Westbury, New York, USA). The following conditions were used for PCR: denaturation at 94°C for 15 s, annealing at 55°C for 15 s for ET-A, and 60°C for 15 s for ET-B and β-actin, and extension at 72°C for 30 s. In each experimental run, negative controls (with out reverse transcriptase) were used. To each microtube containing PCR product, 2 μL of loading buffer was added. The products and the DNA ladder were loaded into 1.4% PCR gel placed in an electrophoresis tank containing Tris-Acetate-EDTA (TAE) buffer. Then electrophoresis was conducted at 80 volts for 40 min and bands were detected by using an imaging system (VersaDoc Model 1000; Bio-Rad Laboratories, Hercules, California, USA).
Real-time polymerase chain reaction (real-time PCR) —
The same cDNA was used for real-time PCR as for RT-PCR. Real-time PCR was conducted by using Biorad’s iTaq SYBR Green Supermix with Rox. All real-time PCR experiments were performed using the Applied Bioscience 7900 Sequence Detection System.
Western blotting
Five independent replications per horse (1/lobe) were performed for Western blot studies. Lung protein extracts were prepared by homogenizing the thawed equine and rat lung samples in Camiolo buffer [0.075M Potassium acetate, 0.3M NaCl, 0.1M L-arginine basic salt, 0.01M EDTA-HCl, and 0.25% Triton X-100] containing a protease inhibitor cocktail. Extracts were centrifuged at 10 000 μg for 15 min at 4°C. Supernatant fractions were assayed for protein concentration (Bradford reagent; Bio-Rad Laboratories, Hercules, California, USA), and were used for Western blot analysis; performed as previously described (23,24). Briefly, protein extracts (40 μg) were separated on 10% denaturing polyacrylamide gels for ETA and ETB receptors. Pre-stained protein markers were also run in the gel. All gels were electrophoretically transferred to polyvinylidene fluoride (PVDF) membranes. Efficiency of protein transfer was evaluated by using Ponceau-S staining (Sigma-Aldrich, St. Louis, Missouri, USA). The membranes were blocked with 5% nonfat dry milk in Tris-buffered saline containing 0.1% Tween-20 (TBS-T). After blocking, the membranes were incubated for 1 h at room temperature with a 1:500 dilution of either ETA or ETB antisera, washed 3 times (for 10 min each wash) with TBS-T, and then incubated with donkey anti-sheep IgG-horseradish peroxidase conjugate (Santa-Cruz Biotechnology, Santa-Cruz, California, USA). The membranes were then washed 3 times (for 10 min each wash) with TBS-T, and protein bands were visualized by enhanced chemiluminescence (Western lightening reagent, PerkinElmer Life Sciences, Boston, Massachusetts, USA) according to manufacturer’s instructions using Bio-Max MR film (Eastman Kodak, Rochester, New York, USA). Protein band sizes were determined using software (Quantity 1-D image analysis; Bio-Rad Laboratories, Hercules, California, USA). The Western blot membranes were stripped in the stripping buffer (62.5 mM Tris at pH of 6.7, 2% SDS and 100 mM β mercaptoethanol) for 30 min at 60°C with occasional agitation. The membranes were washed twice in the washing buffer for 10 min each, and then used for detecting β actin bands by using goat-polyclonal antibodies.
Detection and quantification of bands
Western blot and PCR product (amplicon) bands were analyzed and the average intensity of the bands was determined using software (Bio-Rad Laboratories). Data were collected in terms of average intensity of bands of ETA or ETB receptors per average intensity of bands of β-actin, and imported to a spreadsheet (Excel; Microsoft, Redmond, Washington, USA).
Preparation of slides for immunohistochemistry
Five replications per horse (1 sample/lobe) were performed for immunohistochemical studies. Tissue sections measuring 4 μM thick were cut from each paraffin block and mounted onto clean sialinized slides. Three slides were prepared from each paraffin block; 2 were used to detect the ET receptors (ETA and ETB), and the other slide was used as a negative control (without primary antibody). Tissue sections were deparaffinized with xylene and subsequently rehydrated with graded concentrations of ethyl alcohol (100%, 90%, and 70%, respectively). All of the slides were then subjected to immunohistochemistry (25,26).
Immunohistochemistry
An automated stainer (Dako Autostainer Universal Staining System; DakoCytomation California, Carpinteria, California, USA) was used to perform the immunohistochemical studies. Optimization of the antibody showed that the staining was best when no antigen retrieval method was used. Except when noted, all rinsing steps were conducted with TRIS-Buffered Saline (TBS) at pH 7.6 containing 0.05% Tween-20. After rinsing the slides with TBS, the endogenous peroxidase activity of the tissues was blocked by applying 3% H2O2 for 10 min. Sections were then rinsed and endogenous avidin and biotin were blocked for 10 min each by using a blocking agent (Avidin/Biotin Blocking Kit; Vector Laboratories, Burlingame, California, USA). After rinsing all of the slides, endogenous protein was blocked for 30 min at room temperature by adding normal rabbit serum [Vectastain Elite ABC Kit (Sheep IgG) and Vector NovaRED Substrate Kit for peroxidase; Vector Laboratories]. The blocking serum was prepared following the manufacturer’s guidelines. After blowing off the excess blocking serum, the tissue sections on the slides were incubated with either sheep anti-ETA receptor polyclonal primary antibodies or sheep anti-ETB polyclonal primary antibodies (Biodesign International) at 1:200 dilutions each, for 30 min at room temperature. In the negative controls, the primary antibody was replaced by sheep gamma globulin (Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania, USA) at 1:1000 dilutions. Antibodies and sheep gamma globulins were diluted in antibody diluent (Dako Autostainer Universal Staining System; DakoCytomation California). After rinsing all of the slides, biotinylated rabbit anti-sheep IgG secondary antibodies (Avidin/ Biotin Blocking Kit; Vector Laboratories) were applied to the sections for 30 min. After rinsing the slides, Vectastain elite ABC immunoperoxidase system (Vector Laboratories) was applied to the tissue sections after which all of the tissue sections were washed with TBS. Sites of immunostaining were visualized by developing sections in substrate for peroxidase (Nova Red; Vector Laboratories), which was applied to the sections for 8 min. After washing with TBS followed by deionized water, the slides were counterstained with Mayer’s hematoxylin for 5 min. The slides were then thoroughly washed with TBS and then deionized water. The sections were dehydrated through graded concentrations of ethyl alcohol and cleared with xylene and then mounted with Permount and glass cover slips and allowed to dry.
Evaluation of immunohistochemistry slides
The immunohistochemistry slides were independently evaluated by 2 authors (Polikepahad and Venugopal) for staining intensity. The staining intensities of ETA and ETB receptors were scored after comparing them to that of a negative control, the score of which was considered zero. The results were interpreted as absence of staining (0), weak staining (1+), moderate staining (2+) and strong staining (3+).
Evaluation of slides for pathological changes
One slide from each lobe (5 slides/horse) were evaluated for the presence of pathological changes in the bronchioles, blood vessels, and alveoli. Each slide was evaluated independently by 2 authors (Polikepahad and Venugopal) and scores were assigned based upon the intensity of the pathological change (27). The pathological changes evaluated included Goblet cell metaplasia, epithelial hyperplasia, mucus plugs in the bronchioles, neutrophils in the bronchiolar lumen, peribronchial eosinophils, alveolar macrophages, peribronchiolar inflammation, perivascular inflammation, and alveolar inflammation. The results were interpreted as 0 (absence of the pathological change), 1+ (weak presence), 2+ (moderate presence) and 3+ (strong presence). The results were reported as median and range values.
Statistical analysis
Statistical analysis software (Graphpad Prism ver.4.0; GraphPad Software, San Diego, California, USA) was used for performing all statistical analyses. Parametric tests were used wherever the data followed a normal distribution and nonparametric tests wherever the data was not normally distributed. The CS and ΔPpl data were analyzed and comparisons made between healthy and RAO-affected horses using the Mann-Whitney test. The immunohistochemical staining scores and histopathology scores were evaluated and compared between healthy and RAO-affected horses using the Kruskal-Wallis test. Selected pair-wise comparisons were made using Dunn’s multiple comparison tests. Data pertaining to band intensities for the Western blotting and RT-PCR were statistically analyzed using a two-way analysis of variance (ANOVA). Pair-wise comparisons were made by employing post-hoc Bonferroni tests. All statistical analyses were performed at the level of significance of P ≤ 0.05. The comparative CTor ΔΔCT method was used for analysis of real-time PCR data.
Clinical evaluation
All horses were in relatively good body condition and had a normal appetite and demeanor. All RAO-affected horses had respiratory wheezes on auscultation, nostril flaring, increased abdominal lift, and cough. Few RAO-affected horses showed a marked “heave” line extending along the abdominal wall. The CS (median 5.5; range, 5.0 to 7.0) of RAO-affected horses was significantly greater than that of healthy horses (median 1.5; range, 1.0 to 3.5). Similarly, the ΔPpl of RAO-affected horses (median 25.0 cm of H2O; range 20 to 32) was significantly greater than that of healthy horses (median 7.0 cm of H2O; range, 4.0 to 9.0).
Gross postmortem evaluation of lungs
The lungs of all RAO-affected horses were over-inflated and orange-pink in color. In these horses, after the thoracic cavity was opened, the lungs did not collapse. A tough texture was observed in some regions of the lungs. Non-uniformly distributed pale fibrotic patches were observed on the surface of the lungs of many affected horses. In addition, the surface of the lungs of some affected horses had indentations or impressions caused by pressure from the ribs. Mucus plugs were frequently observed in the bronchi; however, this observation was not uniform throughout the lung fields.
Healthy horses had lungs that were normal in size and texture, and pale pink in color. Neither fibrotic patches nor rib impressions were noticed on the lung surface. The lungs collapsed immediately and completely after opening the thoracic cavity. Bronchial mucus plugs were noticed on only a few occasions.
Microscopic evaluation for histological changes
The microscopic findings are given in Table I. The most consistent finding in the lungs of RAO-affected horses was the presence of mucus plugs in the bronchioles. Other consistent and significant findings in the RAO-lungs were the presence of goblet cell metaplasia, bronchiolar epithelial hyperplasia, infiltration of neutrophils into the bronchiolar lumen and peribronchial inflammation. In addition, weak to moderate infiltration of eosinophils was noticed in 3 of the 7 RAO-affected horses. Few alveolar macrophages and mild perivascular and alveolar inflammation were noticed in all RAO-affected horses, but not at the significant level. None of the RAO-affected lungs had true pulmonary emphysema. In healthy horses, none of the aforementioned changes were observed except for very mild epithelial hyperplasia, and peribronchial and alveolar inflammation in 2 of the 7 horses.
Table I
Table I
Histopathologic findings in the lungs of healthy and RAO-affected horses. Different pathological changes were evaluated and scored from 0 to 3 by two independent observers. The scores were compared statistically between healthy and RAO-affected horses (more ...)
Antibody and primer specificity
The protein band sizes and RT-PCR product sizes of ETA and ETB receptors of rat lungs matched with those of equine lung samples. For the immunohistochemistry, rat lung sections showed intense immunostaining for both receptors and no staining was observed in negative controls. Similarly, the horse lung sections showed immunostaining for both receptors and no staining was detected in the negative control sections.
Findings of RT-PCR studies
There was no difference in the mean intensity of ETA receptor bands between healthy and RAO-affected horses, whereas the mean intensity of ETB receptor bands was significantly greater (~ 4-fold) in RAO-affected horses compared with healthy horses (Figures 1A and BFigure 1). In healthy horses, there was no difference between the mean intensities of ETA and ETB receptors; however, in RAO-affected horses, the mean intensity of ETB receptors was significantly greater (~ 4-fold) than that of ETA receptors.
Figure 1
Figure 1
Figure 1
A — RT-PCR bands of ETA and ETB receptors and β-actin in healthy (n = 7) and RAO-affected horses (n = 7). The mean sizes of the RT-PCR bands for β-actin, and ETA and ETB receptors were 160, 190, and 220 base pairs, respectively. (more ...)
Findings of real-time PCR
The results of the real-time PCR agreed with the results of all 3 of the other methods used in this study. The relative ETB gene expression in the RAO tissues was significantly greater than that of healthy horses. In addition, ETB expression was significantly greater than the ETA expression within the RAO group (Figure 2Figure 2).
Figure 2
Figure 2
Figure 2
Real-time PCR showing the mean (±S[x with macron]) of relative ETA and ETB receptor gene expressions of the lungs of healthy and RAO-affected horses.
Findings of Western blotting studies
The mean band intensities of ETA and ETB receptors were significantly greater (~ 1.6-fold and ~ 2-fold, respectively) in lungs of RAO-affected horses compared with values from healthy horses, respectively (Figures 3A and 3BFigure 3). In healthy horses, there were no differences between the mean intensities of ETA and ETB receptors; however, in RAO-affected horses, the mean intensity of ETB receptors was significantly greater (~ 2-fold) than that of ETA receptors.
Figure 3
Figure 3
Figure 3
A — Western Blot bands of ETA and ETB receptors and β-actin in healthy and RAO-affected horses. The mean sizes of western blot bands for β-actin and ET-receptors were 40 and 60 kDa, respectively. B — Mean ± for (more ...)
Findings of immunohistochemistry studies
The findings of the immunohistochemistry studies were similar to those of Western blotting. Figures 4A, 4B, and 4CFigure 4 illustrate lung tissue immunostaining respectively for negative control in which primary antibody was replaced by sheep gamma globulin; negative control in which anti-ETB receptor antibody was applied; and ETB receptor staining, all at 20× magnification. The mean score for ETA and ETB receptor immunostaining determined was significantly greater (~ 1.7-fold and ~ 2.1-fold, respectively) in lungs of RAO-affected horses compared with values in healthy horses (Figure 4DFigure 4D). In healthy horses, there was no difference between the mean scores for ETA and ETB receptor immunostaining; however, in RAO-affected horses, the mean score of ETB receptor immunostaining was significantly greater (~ 1.6-fold) than that of ETA receptors.
Figure 4
Figure 4
Figure 4
Immunostaining of equine lung tissue (Bar = 500 μm).
Figure 4D
Figure 4D
Figure 4D
Mean (± S[x with macron]) of ETA and ETB receptor immunostaining in the lungs of healthy and RAO-affected horses.
The present study examined the distribution of 2 types of endothelin receptors, ETA and ETB, in the peripheral lung tissues of 2 groups of horses, namely clinically healthy and those affected with RAO. In order to evaluate and compare expression of ETA and ETB receptor expression the peripheral lung of unaffected horses and those affected with RAO, 4 different but complementary methods were used, including RT-PCR, real-time PCR, Western blot analysis, and immunohistochemical staining: 1) RT-PCR demonstrated that the mRNA of ETA and ETB receptors are expressed in the peripheral lungs of healthy and RAO-affected horses, and the expression of ETB receptor mRNA is significantly greater in RAO-affected horses than in clinically healthy horses. However, no change was observed in the ETA receptor mRNA expression between the 2 groups of horses. 2) Real-time PCR showed similar results in that the relative ETB gene expression was significantly increased in the peripheral lung of the RAO-affected horses than in that of clinically healthy horses. The expression of the ETB receptor was also shown to be significantly greater than that of ETA within the RAO group. 3) Western blot analysis and immunohistochemical staining methods showed that ETA and ETB receptors are expressed in equine peripheral lungs and that the expression of these receptors is significantly greater in the lungs of RAO-affected horses than that of clinically healthy horses. 4) All the techniques used revealed that there is no difference between the expression of ETA and ETB receptors in the peripheral lungs of healthy horses; however, ETB receptors are significantly over-expressed in the peripheral lungs of RAO-affected horses, compared with healthy horses and compared with ETA receptors in the RAO group.
Since the present study demonstrated significant differences in the expression of ET-receptors between the 2 groups of horses, confirmation that the grouping of horses was properly performed before making such a conclusion is of paramount importance. The findings in our gross postmortem evaluation and histopathologic evaluation in RAO-affected horses are in agreement with previously published reports (28). The hyper-inflation of the lungs that was noticed during postmortem evaluation of RAO-affected horses is believed to be due to the trapping of air in post-obstructive areas of the lung. This hyper-inflation is the cause of the rib impressions that were observed on the surface of the lungs of some RAO-affected horses. Because of the entrapped air, RAO-affected lungs did not collapse when the thoracic cavity was opened. Histologically, the consistent findings in RAO-affected horses were the presence of neutrophil-filled mucus plugs and goblet cell metaplasia in the bronchioles, and epithelial hyperplasia of bronchi (27). All of these changes contribute substantially to obstruction of the airways in this disease, supporting the accuracy of grouping.
The present study is a continuation of our previous pharmacological (18) and immuno-histochemical (19) studies that support our findings that changes in ET receptors occur in RAO-affected horses. The pharmacological studies have shown that the contractile response of bronchial rings from RAO-affected horses to ET-1 was greater than that of the clinically healthy horses. Also, the ETB receptor mRNA expression of the pooled peripheral lung tissues of the affected horses was observed to be greater than that of the unaffected horses (18). Immunohistochemical (IHC) staining studies for ET receptors was subsequently performed to determine the distribution of ETA and ETB receptors in the bronchial smooth muscles (proximal airways) of RAO-affected and unaffected horses to correlate the receptor distribution and contractile response of bronchial rings. The IHC studies revealed over-expression of both ET receptors, particularly ETB receptors, in the bronchial smooth muscle (19). These 2 studies allowed us to confirm that the hyper-responsiveness of the bronchial rings is due to an up-regulation of ET receptors. Although the IHC staining confirmed a correlation between hyperresponsiveness of bronchial rings and up-regulation of ETB receptors, a need to determine ET receptors in the peripheral lung tissues was inevitable, primarily because RAO is a peripheral airway disease. This prompted us to examine ET receptor distribution and expression in the lung periphery. Thus, the present study constitutes the examination of ET receptor distribution in the peripheral pulmonary tissues of RAO-affected and unaffected horses.
Several other investigators have studied the role of ET in RAO in horses. Benamou et al (16) suggested involvement of ET-1 in the pathogenesis of equine RAO by demonstrating the presence of elevated levels of ET-1 in the pulmonary circulation and BALF of RAO-affected horses. This concept of ET-1 involvement in equine allergic pulmonary disease is complemented by the findings of the present study, which showed that the expression of ET-receptors, especially that of ETB receptors, is significantly increased in the lungs of RAO-affected horses, both in the upper airways (18,19) and also in the peripheral lungs as observed in the present study.
Equine RAO shares common features of human asthma. Compelling evidence exists for the involvement of ET-1 in the pathogenesis of human allergic airway diseases (29). For example, in human asthmatic airways, ET-1 has been shown to stimulate mucus secretion, edema of airway mucosa through microvascular leakage, smooth muscle mitogenesis, and bronchial hyperresponsiveness (28). Similarly, in human COPD, ET-1 has been implicated in the activation of neutrophils, and alveolar macrophages and pulmonary hypertension secondary to COPD (14). As far as the ET-receptors are concerned, there is little information on the alteration of their expression in airway allergic diseases. Moller et al (30) demonstrated that the ratio of ETA and ETB receptor mRNA is altered in the bronchial biopsies from human patients with asthma and chronic airway obstruction. By using conventional RT-PCR techniques, they showed that the bronchial biopsies of these patients express significantly greater ETB receptor mRNA expression compared with ETA receptor mRNA (30). In contrast, by quantitative autoradiography wstudies, Knott et al (31) showed that asthma is not associated with any significant alteration in the densities of ETA and ETB receptors in the peripheral human lung. They also demonstrated that in both asthmatic and non-asthmatic individuals, ~30% of the ET-1 binding was to ETA receptors, and ~70% was to ETB receptors (31). In the current study, all 4 techniques indisputably showed that ETB receptor expression is significantly greater in the peripheral lungs of RAO-affected horses compared with healthy horses. On the contrary, ETA receptor over-expression in RAO horses was supported only by Western blot analysis and immunohistochemical staining studies. The RT-PCR studies did not show an increase in ETA receptors. The reason for this discrepancy of showing an increase in protein expression without an increase in mRNA is not clear at this point. Perhaps the post-transcriptional regulatory mechanisms might have significant influence during the synthesis of ETA receptors. Further studies are required to establish the exact cause of this finding.
In the current study, we also demonstrated that the significant over-expression of ETB receptors in the lungs of RAO-affected horses is much greater than the over-expression of ETA receptors. One could speculate that these findings suggest that ETB receptors might play a greater role than ETA receptors in the pathogenesis of RAO. However, considering the fact that the role of ET-1 is not yet confirmed in the pathogenesis of RAO, it is premature to draw this conclusion. Nevertheless, our findings in this study could form a strong basis for future functional studies regarding the involvement of ET-1 in the pathogenesis of RAO. The physiological role of ETB receptors in the airways has not yet been clearly defined. There are reports that suggest a general functional role for ETB receptors in the elimination of circulating ET-1 (32). Santschi et al (33) reported an association of ETB receptors polymorphism and lethal white foal syndrome in horses. In our previous study, (18) we observed that exposure of equine bronchial rings to graded concentrations of ET-1 after blocking ETA receptors resulted in enhanced contractile response, suggesting ETB receptors are inherently contractile in nature. Using small bronchial rings (0.5–1.0 mm in diameter) from human peripheral lung, Adner et al (34) reported that specific ETB receptor agonist IRL 1620 yielded contractions similar to that of ET-1, and that ETB receptors mediate ET-1 induced contractions. The peripheral lung tissues used in our study, rather than peripheral airways, contain airway smooth muscle, epithelial cells, blood vessels, endothelial cells, and connective tissue. Therefore, in our study the ETB receptor up-regulation observed could be the result of increased expression in any one or more of these components. Based on previous information and the results herein, it can be interpreted that the initiation of over-expression of ETB receptors in RAO may be triggered by high levels of circulating ET-1 that occur after an inflammatory process. Since ETB receptors are involved with elimination of ET-1 (32), it is logical to expect an up-regulation of these receptors. Granstorm et al (35) reported ETB receptor up-regulation in human airway smooth muscle cells following Sephadex-induced airway inflammation. They suggested that ETB receptors play a role in airway hyperreactivity during airway inflammation (35). Since ETB receptors in airways are inherently contractile in nature, the functional consequences of over-expression of ETB would be enhancement of contractility leading to severe airway constriction as observed in RAO.
In conclusion, the present study provides molecular evidence for the presence of ET-receptors in the lungs of healthy and RAO-affected horses. In addition, the study demonstrated for the first time that both types of ET-receptors, particularly ETB receptors, are over-expressed in the lungs of RAO-affected horses. We believe that these findings could form a basis for future clinical studies involving use of ET-receptor antagonists in alleviating the symptoms of this disease and for better management of RAO in horses.
Footnotes
This article was part of the dissertation submitted by Dr. Sumanth Polikepahad in partial fulfillment of a PhD degree.
This study was supported by grants from Equine Health Studies Program and the National Research Initiative of the USDA Cooperative State Research, Education and Extension Service, grant number 2001-35204-10809, School of Veterinary Medicine, Louisiana State University, Baton Rouge, Louisiana, 70803 USA.
1. Robinson NE, Derksen FJ, Olszewski MA, Buechner-Maxwell VA. The pathogenesis of chronic obstructive pulmonary disease of horses. Br Vet J. 1996;152:283–306. [PubMed]
2. Seahorn TL, Beadle RE. Summer pasture-associated obstructive pulmonary disease. Equine pract. 1994;16:39–41.
3. Rubanyi GM, Polokoff MA. Endothelins: Molecular biology, biochemistry, pharmacology, physiology, and pathophysiology. Pharmacol Rev. 1994;46:325–415. [PubMed]
4. de Nucci G, Thomas R, D’Orleans-Juste P, et al. Pressor effects of circulating endothelin are limited by its removal in the pulmonary circulation and by the release of prostacyclin and endothelium-derived relaxing factor. Proc Natl Acad Sci U S A. 1988;85:9797–9800. [PubMed]
5. Tsukahara H, Ende H, Magazine HI, Bahou WF, Goligorsky MS. Molecular and functional characterization of the non-isopeptide-selective ETB receptor in endothelial cells. Receptor coupling to nitric oxide synthase. J Biol Chem. 1994;269:21778–21785. [PubMed]
6. Martin C, Held HD, Uhlig S. Differential effects of the mixed ET(A)/ET(B)-receptor antagonist bosentan on endothelin-induced bronchoconstriction, vasoconstriction and prostacyclin release. Naunyn Schmiedebergs Arch Pharmacol. 2000;362:128–136. [PubMed]
7. Emanueli C, Ricciardolo F, Vergnani L, et al. Characterization of the endothelin receptor subtype mediating epithelium-derived relaxant nitric oxide release from guinea-pig trachea. Br J Pharmacol. 1998;125:963–968. [PubMed]
8. Henry PJ, Goldie RG. Potentiation by endothelin-1 of cholinergic nerve-mediated contractions in mouse trachea via activation of ETB receptors. Br J Pharmacol. 1995;114:563–569. [PubMed]
9. Fernandes LB, Henry PJ, Rigby PJ, et al. EndothelinB (ETB) receptor- activated potentiation of cholinergic nerve-mediated contraction in human bronchus. Br J Pharmacol. 1996;118:1873–1874. [PubMed]
10. Yoneyama T, Hori M, Tanaka T, Matsuda Y, Karaki H. Endothelin ETA and ETB receptors facilitating parasympathetic neurotransmission in the rabbit trachea. J Pharmacol Exp Ther. 1995;275:1084–1089. [PubMed]
11. Knott PG, Fernandes LB, Henry PJ, Goldie RG. Influence of endothelin-1 on cholinergic nerve-mediated contractions and acetylcholine release in rat isolated tracheal smooth muscle. J Pharmacol Exp Ther. 1996;279:1142–1147. [PubMed]
12. Bagnato A, Natali PG. Endothelin receptors as novel targets in tumor therapy. J Transl Med. 2004;2:16. [PubMed]
13. Finsnes F, Lyberg T, Christensen G, Skjønsberg OH. Effect of endothelin antagonism on the production of cytokines in eosinophilic airway inflammation. Am J Physiol Lung Cell Mol Physiol. 2001;280:L659–665. [PubMed]
14. Roland M, Bhowmik A, Sapsford RJ, et al. Sputum and plasma endothelin-1 levels in exacerbations of chronic obstructive pulmonary disease. Thorax. 2001;56:30–35. [PubMed]
15. Hay DW, Goldie RG. Potential pathophysiological role of endothelin-1 in asthma. Drug News Perspect. 1998;11:411–418. [PubMed]
16. Benamou AE, Art T, Marlin DJ, Roberts CA, Lekeux P. Variations in systemic and pulmonary endothelin-1 in horses with recurrent airway obstruction (heaves). Pulm Pharmacol Ther. 1998;11:231–235. [PubMed]
17. Benamou AE, Marlin DJ, Callingham BC, Hiley RC, Lekeux P. Spasmogenic action of endothelin-1 on isolated equine pulmonary artery and bronchus. Equine Vet J. 2003;35:190–196. [PubMed]
18. Venugopal CS, Polikepahad S, Holmes EP, Vanden Heuvel J, Leas TL, Moore RM. Endothelin receptor alterations in equine airway hyperreactivity. Can J Vet Res. 2006;70:50–57. [PubMed]
19. Polikepahad S, Paulsen DB, Moore RM, Cost LRR, Venugopal CS. Immunohistochemical determination of the expression of endothelin receptors in bronchial smooth muscle and epithelium of healthy horses and horses affected by summer pasture-associated obstructive pulmonary disease. Am J Vet Med. 2006;67:348–357.
20. Seahorn TL, Beadle RE. Summer pasture-associated obstructive pulmonary disease in horses: 21 cases (1983–1991). J Am Vet Med Assoc. 1993;202:779–782. [PubMed]
21. Seahorn TL, Beadle RE, McGorum BC, Marley CL. Quantification of antigen-specific antibody concentrations in tracheal lavage fluid of horses with summer pasture-associated obstructive pulmonary disease. Am J Vet Res. 1997;58:1408–1411. [PubMed]
22. Yang GC, Croaker D, Zhang AL, Manglick P, Cartmill T, Cass D. Adinucleotide mutation in the endothelin-B receptor gene is associated with lethal white foal syndrome (LWFS); a horse variant of Hirschsprung disease. Hum Mol Genet. 1998;7:1047–1052. [PubMed]
23. Wendel-Wellner M, Noll T, König P, Schmeck J, Koch T, Kemmer W. Cellular localization of the endothelin receptor subtypes ET(A) and ET(B) in the rat heart and their differential expression in coronary arteries, veins, and capillaries. Histochem Cell Biol. 2002;118:361–369. [PubMed]
24. McMullan DM, Bekker JM, Johengen MJ. Inhaled nitric oxide-induced rebound pulmonary hypertension: Role for endothelin-1. Am J Physiol Heart Circ Physiol. 2001;280:H777–785. [PubMed]
25. Black SM, Johengen MJ, Ma ZD, Bristow J, Soifer SJ. Ventilation and oxygenation induce endothelial nitric oxide synthase gene expression in the lungs of fetal lambs. J Clin Invest. 1997;100:1448–1458. [PubMed]
26. Furuya S, Furuya K, Sokabe M, Hiroe T, Ozaki T. Characteristics of cultured subepithelial fibroblasts in the rat small intestine. II. Localization and functional analysis of endothelin receptors and cell-shape-independent gap junction permeability. Cell Tissue Res. 2005;319:103–119. [PubMed]
27. De Falco M, Laforgia V, Fedele V, et al. Endothelin-B (ET(B)) receptor distribution in tissues of the lizard Podarcis sicula. Cell Tissue Res. 2002;309:381–386. [PubMed]
28. Naylor JM, Clark EG, Clayton HM. Chronic obstructive pulmonary disease: Usefulness of clinical signs, bronchoalveolar lavage, and lung biopsy as diagnostic and prognostic aids. Can Vet J. 1992;33:591–598. [PubMed]
29. Costa LR, Seahorn TL, Moore RM, Taylor HW, Gaunt SD, Beadle RE. Correlation of clinical score, intrapleural pressure, cytologic findings of bronchoalveolar fluid, and histopathologic lesions of pulmonary tissue in horses with summer pasture-associated obstructive pulmonary disease. Am J Vet Res. 2000;61:167–173. [PubMed]
30. Möller S, Uddman R, Granström B, Edvinsson L. Altered ratio of endothelin ET(A)- and ET(B) receptor mRNA in bronchial biopsies from patients with asthma and chronic airway obstruction. Eur J Pharmacol. 1999;365:R1–3. [PubMed]
31. Knott PG, D’Aprile AC, Henry PJ, Hay DW, Goldie RG. Receptors for endothelin-1 in asthmatic human peripheral lung. Br J Pharmacol. 1995;114:1–3. [PubMed]
32. Fukuroda T, Fujikawa T, Ozaki S, Ishikawak K, Yano M, Nishikibe M. Clearance of circulating endothelin-1 by ETB receptors in rats. Biochem Biophys Res Commun. 1994;199:1461–1465. [PubMed]
33. Santschi EM, Purdy AK, Valberg SJ, Vrotsos PD, Kaese H, Mickelson JR. Endothelin receptor B polymorphism associated with lethal white foal syndrome in horses. Mamm Genome. 1998;9:306–309. [PubMed]
34. Ander M, Cardell LO, Sjoberg T, Ottosson A, Edvinsson L. Contractile endothelin-B (ETB) receptors. Eur Respir J. 1996;9:351–355. [PubMed]
35. Granström BW, Xu CB, Nilsson E, Bengtsson UH, Edvinsson L. Up-regulation of endothelin receptor function and mRNA expression in airway smooth muscle cells following Sephadex-induced airway inflammation. Basic Clin Pharmacol Toxicol. 2004;95:43–48. [PubMed]

See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph