pmc logo image
Logo of nihpaNIHPA bannerabout author manuscriptssubmit a manuscript
Journal List > NIHPA Author Manuscripts

Formats:
Virology. Author manuscript; available in PMC 2009 May 25.
Published in final edited form as:
Virology. 2008 May 25; 375(1): 170–181.
Published online 2008 March 3. doi: 10.1016/j.virol.2008.01.048.
PMCID: PMC2430019
NIHMSID: NIHMS50824
Copyright notice and Disclaimer
Mutations Generated in Human Immunodeficiency Virus Type 1 Long Terminal Repeat During Vertical Transmission Correlate With Viral Gene Expression
Roshni Mehta, Vasudha Sundaravaradan, and Nafees Ahmad*
Department of Immunobiology, College of Medicine, University of Arizona, Tucson, Arizona 85724
*Corresponding Author: Mailing Address: Department of Immunobiology, College of Medicine, The University of Arizona, 1501 N. Campbell Ave, Tucson, Arizona 85724, Phone: 520-626-7022 Fax: 520-626-2100; Email: nafees/at/u.arizona.edu
Small right arrow pointing to: The publisher's final edited version of this article is available at Virology.
Publisher's Disclaimer
Abstract
We determined the effect of mutations generated in HIV-1 LTR on viral gene expression in six mother-infant pairs following vertical transmission. We show that the functional domains critical for LTR function, the promoter (TATAA), enhancers (three Sp-I and two NFκB sites), the modulatory region (two AP-I sites, two NFAT, one NF-IL6 site, one Ets-1, and one USF-1) and the TAR region were generally conserved among mother-infant pairs, although we observed several patient and pair specific mutations in these important domains. We then determined the promoter activity of our mother-infant LTR sequences by measuring CAT gene expression, which was driven by these LTRs and found that most of these HIV-1 LTRs derived from 6 mother-infant pairs were functional. However, mutations in the important transcription factor binding sites, including TATAA, Sp-I, NFκB, AP-I, NFAT, NF-IL6, Ets-1, USF-1 and TAR resulted in reduced LTR driven CAT gene expression. Taken together, conservation of functional domains in the LTR during vertical transmission supports the notion that a functional LTR is critical in viral replication and pathogenesis and mutations generated during the course of infection correlated with HIV-1 gene expression.
HIV-1 long terminal repeat, or LTR, is a cis-acting sequence that flanks the HIV-1 genome and is necessary for proviral DNA synthesis, integration of proviral DNA into the host genome and transcription of the viral genes and full length genome (Al-Harthi et al., 1998; Gaynor, 1992). The LTR can be divided into three regions: U3, R, and U5 (Pereira et al., 2000). Within U3 there are three functional regions, the promoter (positions -78 to -1) which contains the TATAA box, the enhancer (-105 to -79) which is comprised of two NFκB transcription factor binding sites and three GC rich SpI sites (Gaynor, 1992), and the modulatory region (-454 to -104) which contains two AP-I sites, two NFAT sites, one NF-IL6 site, one USF-1 site, and one Ets-1 site. The R (+1 to +99) region contains a unique enhancer element termed TAR (+1 to +60), or transactivation response element, which is important for Tat activation, efficient reverse transcription, and efficient packaging of viral genomic RNA (Feng and Holland, 1988; Harrich et al., 2000; Helga-Maria et al., 1999). While LTR diversity in infected individuals has been examined (Blackard et al., 2000; Blackard et al., 2001), there has been no systematic study performed that correlates mutations generated during vertical transmission with HIV-1 gene expression.
Vertical transmission of HIV-1 accounts for 90% of all HIV-1 infections in children and occurs at a rate of 30% (Ahmad, 2000; Ahmad, 2005; Ahmad, 2008; Pitt et al., 1997). Vertical transmission can occur at three stages: prepartum (in utero), intrapartum (during birth), and postpartum (breastfeeding). Several parameters have been identified with HIV-1 vertical transmission, including advanced clinical stage of the mother, low maternal CD4+ lymphocyte count, high viral load, prolonged exposure of the infant to maternal body fluids (Mayaux et al., 1995; Pitt et al., 1997; Sperling et al., 1996), and a high viral heterogeneity in the mother (Ahmad et al., 1995; Wolinsky et al., 1992). However, using antiretroviral therapy (ART) during pregnancy can significantly reduce the rate of vertical transmission (Sperling et al., 1996), but it also selects for the transmission of ART resistant strains (Colgrove et al., 1998). We and others have shown, by analyzing the env gene, the HIV-1 minor genotypes (Ahmad et al., 1995; Mulder-Kampinga et al., 1995; Wolinsky et al., 1992) with macrophage tropic and non-syncytium-inducing phenotypes (R5 viruses) (Matala et al., 2001; Salvatori and Scarlatti, 2001) were transmitted from mother to infant. In addition, analysis of HIV-1 regulatory (tat and rev) and accessory (vif, vpr, vpu, and nef) has shown a high conservation of functional domains of these proteins during vertical transmission (Hahn et al., 2003; Husain et al., 2001; Ramakrishnan et al., 2005; Yedavalli and Ahmad, 2001; Yedavalli et al., 1998a; Yedavalli et al., 1998b; Yedavalli et al., 2001). We have also shown that transmitting mothers' vif and vpr sequences were more heterogeneous and more functional compared with non-transmitting mother's sequences. Furthermore, we have recently shown that there was a low degree of genetic diversity and high conservation of functional motifs in HIV-1 LTR in six mother-infant pairs following vertical transmission (Mehta et al., 2008). Based on this analysis, we evaluated the functional activity of mother-infant LTR driven CAT gene expression to measure the strength of HIV-1 promoter as well as the effect of mutations in LTR on HIV-1 gene expression.
We show that the functional domains in the HIV-1 LTR sequences, including the promoter, enhancers and modulatory regions derived from six mother-infant pairs were conserved and correlated with efficient viral gene expression. Furthermore, we found that mutations generated in the promoter, enhancer and/or modulatory regions of the mother-infant LTR sequences resulted in reduced LTR driven CAT gene expression. These results underscore the importance of the functional domains of HIV-1 LTR in viral gene expression, transmission and pathogenesis.
Mutations in HIV-1 LTR in mother-infant pairs
Multiple independent (6 to 8) polymerase chain reactions (PCRs) were performed on peripheral blood mononuclear cells (PBMC) DNA from six mother-infant pairs, a total of 13 patients including one mother that gave birth to HIV-1 infected twins. Eight to fifteen LTR clones, containing U3, R, and a small portion of U5, were obtained from each patient (a total of 218 clones from all patients), cloned upstream of CAT gene and sequenced. These LTR sequences derived from patients' PBMC DNA represent both replicating and non-replicating viruses. The phylogentic analysis was done and we found a low degree of viral heterogeneity and estimates of genetic diversity in HIV-1 LTR from six mother-infant pairs' sequences (Mehta et al., 200). Based on the molecular characterization, we selected 10 clones from each patient and determined the promoter activity of the LTR in the presence of HIV-1 Tat. In addition, 5 clones from each patient were used to determine the basal activity of HIV-1 LTR driven CAT gene expression. The complete LTR sequences of 218 clones from 6 mother-infant pairs can be retrieved from the Genbank (accession numbers DQ848353-DQ848563). In Fig. 1Figure 1, we show only the nucleotide alignment of the important transcription factor binding sites of selected mother-infant HIV-1 LTR clones that exhibited mutations in these sites, as aligned with HIV-1 NL4-3. Each mother-infant pair (B to H) is labeled alpha-numerically with clones derived from mother labeled with M and those derived from infant with I.
Figure 1
Figure 1
Figure 1
Multiple nucleotide sequence alignment of the important transcription factor binding sites and TAR in mutated HIV-1 LTR sequences from mother-infant pairs B, C, D, E, G, and H. Complete 218 LTR sequences from 6 mother-infant pairs can be obtained from (more ...)
Analysis of functional domains in mother-infant LTR sequences
HIV-1 LTR contains the promoter (TATAA), enhancers (NFκB, Sp1) and other transcription factors binding sites (AP-I, NFAT, NF-IL6, USF-I and Ets-1) and TAR (Gaynor, 1992). We analyzed and compared each transcription factor binding site of our mother-infant LTR sequences (accession numbers DQ848353-DQ848563) with that of HIV-1 NL4-3 (Mehta et al., 2008) and previous mutational analysis studies related to HIV-1 LTR (Gaynor, 1992; Hiebenthal-Millow et al., 2003; Naghavi et al., 1999; Pereira et al., 2000; Reddy and Dasgupta, 1992). We show those mother-infant LTR clones that exhibited variability compared with HIV-1 NL 4-3 in Fig. 1Figure 1. In these clones, the TATAA element that is critical for both basal and Tat-induced LTR transcription (Berkhout and Jeang, 1992; Garcia et al., 1989) showed a mutation from T to A at the third nucleotide in pair G sequences (Fig. 1Figure 1), which may alter the binding site for the TATAA binding protein (TBP) and possibly hindering RNA Pol II initiation of transcription (Hampsey, 1998). However, this pair has a CATAA box starting two nucleotides upstream of wild type TATAA box, similar to TATAA box of HIV-1 subtype E LTR (Montano et al., 1998; van Opijnen et al., 2004), which initiates transcription with similar efficiency (van Opijnen et al., 2004).
Our analysis of the two NFκB binding sites located within the HIV-1 LTR (Sweet et al., 2005) showed that most LTR sequences were conserved for the two NFκB sites (Mehta et al., 2008). However, five infant clones from pair-B (IB2, IB5, IB9, IB14, IB26) showed mutations in both sites, one clone from pair-D (MD14), one clone from pair-E (ME11), one clone from pair-G (IG2), and in pair-H three clones (MH13, IH1-1, IH1-5) showed mutations in the second site (Fig. 1Figure 1). It has been reported that mutations of NFκB motifs in HIV-1 LTR CAT constructs results in marked decreases in gene expression following transfection into lymphoid cells with or without Tat (Nabel and Baltimore, 1987). Several studies have also shown that when the upstream NFκB site is mutated, gene expression is reduced five-fold and this effect is more profound when the first site was altered (Berkhout and Jeang, 1992; Montano et al., 1998). We found that the first NFκB site was mostly conserved with the exception of 5 infant clones from pair-B. We also observed in pair-G, all mother clones and some infant clones, contain a 27 base pair insertion 12 base pairs upstream from the second NFκB site (full sequence can be accessed in Genbank).
Our analysis of the three SpI binding sites in HIV-1 LTR (Gaynor, 1992) showed that our mother-infant LTR sequences were generally conserved for the first and second sites, with a majority of changes occurring in the third site (Mehta et al., 2008). While mutations in SpI-III site have little effect on HIV-1 gene expression (Berkhout and Jeang, 1992), mutations in all three SpI binding sites can markedly decrease Tat induced activation of the LTR (Harrich et al., 1989). In pair-B, all mother sequences had a G to A substitution in SpI-II site and four infant-B sequences (IB2, IB5, IB9, IB14, IB26) harbored GG to AA mutation in SpI-I site and GG to AA and G to A in SpI-II site (Fig. 1Figure 1). These infant-B sequences also had a 6 base pair insertion between SpI-II and SpI-III sites. All sequences from pair-C showed a G to A mutation in SpI-III site and an insertion of G one nucleotide upstream of SpI-III site, whereas some mother's sequences harbored an additional C to T substitution in the SpI-III site (Fig. 1Figure 1). Three sequences from pair-D (ID11, ID17, ID22) showed mutations in the first site, where only one sequence from pair-E (IE7) showed a mutation in the second site (Fig. 1Figure 1). All sequences from pair-G showed C to T and most of the mother's sequences T to G mutation and all pair-H sequences showed an insertion of an A in SpI-III site.
Transcription factor binding site for AP-I has a consensus sequence of ACTGGT for the first site and CTCAGTC for the second site (Li et al., 1994) and was found to be fairly conserved in our mother-infant LTR sequences. While the first site was mostly conserved in pairs C, D, E, G, and H (Mehta et al., 2008), mutations were generally found in the second site (Fig. 1Figure 1). Single mutation in AP-I does not affect LTR transcription as well as substitution of T to G/C (consensus sequence) in both AP-I sites had little effect on both basal levels and PMA activation of the LTR (Li et al., 1994). We observed that all pair-B sequences had mutations in the first site from AC to TG/TA. In the second site, pairs-B, D, IH1 and IH2 showed a GT to AC mutation, pair-C a GT to CC mutation, and pair-G and MH had a G to A mutation (Fig. 1Figure 1).
The two NFAT transcription factor binding sites, NFAT-I and NFAT-II (Gaynor, 1992), were found that most of our mother-infant LTR sequences were generally conserved (Mehta et al., 2008), however pair specific substitutions in both sites were also found. Pair-B sequences showed mutations from a T to G and G to A in the first site, A to G and CC to AT/AC in the second site as well as three infant-B (IB2, IB5, IB9) sequences showing mutations in both sites (Fig. 1Figure 1). In pair-C, all sequences showed A to G mutation in the first site, AA to GC and C to A in the second site, all mother's sequences T to A mutation and all infant's sequences T to G mutation in the first site (Fig. 1Figure 1). Pair-D, E and G sequences had mutations in both sites, with a T to G and G to A in the first site and in the second site A to G and C to A (pair-D), TA to CG, G to A and C to A (pair-E) and A to G and CC to AT (pair-G) (Fig. 1Figure 1). In pair-H sequences, the first site showed a T to G and an A to G mutations, whereas C to A, A to C, and two A to G mutations were found in the second site (Fig. 1Figure 1).
NF-IL6 has a binding site in the HIV-1 LTR (Rohr et al., 2003) and increases HIV-1 LTR driven gene expression (Akira and Kishimoto, 1992; Buckner et al., 2002; Ruocco et al., 1996; Tesmer and Bina, 1996). When we analyzed our mother-infant pairs' LTR sequences, we found that the NF-IL6 binding site was generally conserved, although some pair specific as well as patient specific mutations were observed (Mehta et al., 2008). However, we found that pair-B sequences had A to G and T to C, pair-D sequences A to G and G to A, most pair-E sequences A to G and G to A, mother-G sequences T to C and GT to AC, and infant-G and infant-H1 G to A mutations (Fig. 1Figure 1).
The analysis of Ets-1 and USF-1 binding domains in our LTR sequences were generally conserved (Mehta et al., 2008). These two proteins interact cooperatively to activate HIV-1 LTR (Sieweke et al., 1998) and the USF-1 binding site also overlaps with NF-IL6 by 4 base pairs (Buckner et al., 2002). These proteins interact via their DNA binding domains and bind cooperatively to the USF-1 and Ets-1 binding sites in HIV-1 LTR (Sieweke et al., 1998). We also observed some mutations in both sites, including G to A (infant-B and pair-G) in Ets-1 site (Fig. 1Figure 1). Moreover, we found G to A (pair-D, infant-E, pair-G, and infant-H1) in USF-1 site (Fig. 1Figure 1). Mutations in these binding domains may affect induction of HIV-1 LTR transcription.
TAR region is an mRNA that base pairs with itself creating a secondary stem-loop structure is required for processivity of transcription (Harrich et al., 1994). Within TAR there are two important regions known as the 3-nucleotide non-base paired bulge and a 6-nucleotide G-rich loop (Harrich et al., 1994) which is required along with the stem for Tat transactivation (Gaynor, 1992). Tat along with host factors bind to this bulge/loop region (Pumfery et al., 2003; Sune and Garcia-Blanco, 1995) stabilizing the stem loop structure and allowing transcription to continue. Mutations in these regions will affect secondary stem loop structure and ultimately hinder the ability of transcription factors to bind. In general, we found that the TAR region from our mother-infant LTR sequences were conserved, especially the bulge and loop motifs (Mehta et al., 2008). However, some mutations were found in the loop, including GG to AA (infant-B) and T to C (infant-G) sequences. In addition, five sequences (MB9, IB2, IB5, IB9, IB26) showed mutations in the loop region (Fig. 1Figure 1), and these same clones showed mutations in the stem possibly altering a correct stem-loop formation. Other mutations, including two GG to AA (positions +2 to +3 and +53 to +54) and two G to A (+12 and +44) in four pair-B sequences, G to A (+12) and A to G (+48) in all pair-C sequences, T to C (+14) in all infant-C sequences, A to G (+52) in most of pair-D sequences, A to G (+49) in four infant-E sequences and G to A (+12) and AA to GG (+48 to +49) in all pair-H sequences were observed. These mutations may alter correct TAR formation and HIV-1 transcription.
Characterization of biological activity of LTR from mother-infant pairs
To evaluate the promoter and enhancer activities of our six mother-infant LTR sequences, we selected 10 LTR clones from each mother and infant based on molecular characterization as described previously (Mehta et al., 2008). These LTR sequences were cloned to drive expression of a CAT reporter gene. Since it is difficult to transfect primary T-lymphocytes efficiently, we utilized 293 cells to transfect these LTR- CAT clones along with Tat into 293 as these cells can provide the same levels of transcription factors to mother and infant LTR driven CAT constructs. We also assessed the basal levels of LTR driven transcription from our mother-infant LTR clones (five clones from each patient) by transfecting into 293 cells without Tat. To ensure similar transfection efficiencies, we used a CMV-β-galactosidase expression plasmid as a control for normalization of transfections. We used two LTR-CAT controls: pHIV-CAT (LTR from 3′LTR positions 8890 to 9611) and pHIV-1 NL4-3 LTR –CAT (NL59-CAT) that contains HIV-1 NL4-3 LTR (positions 9030 to 9681, U3, R and some U5). NL59-CAT has the same length of LTR as all mother-infant LTR clones because same primers ere used to amplify HIV-1 NL4-3 LTR. Results are expressed as ratios of CAT expression to β-galactosidase expression. In general, we found that most of the selected mother-infant LTR sequences were functional, with variability in HIV-1 gene expression, and this variability correlated with mutations generated in important transcription factor binding sites in the LTR.
Figure 2Figure 2 shows LTR-CAT expression with and without Tat for pair-B and C sequences. We found that most of the pair-B LTRs were functional with Tat, however several clones (MB6, MB9, MB11, IB2, IB5, IB19) had decreased levels of transcription (Fig. 2AFigure 2). When we assessed the levels of basal transcription, we found these same clones had little to no expression in the absence of Tat (Fig. 2BFigure 2). We then examined if mutations found in important transcription binding sites were responsible for the decreased level of LTR-CAT expression. We found that MB6 and MB11 had mutations in SpI-II (Fig. 1Figure 1) as well as upstream of the AP-I sites (in GenBank), MB9 in SpI-II, USF-1 (Fig. 1Figure 1), TAR loop (Fig. 1Figure 1) and upstream of the AP-I sites (in GenBank), and IB19 upstream of the AP-I sites. In addition, IB2 and IB5 had four substitutions in the second AP-I site (Fig. 1Figure 1), multiple mutations between the AP-I and NFAT sties (in GenBank), one in Ets-1, two in each NFκB site, three in SpI-II, two in SpI-I, and several in TAR (Fig. 1Figure 1). Similarly, pair-C LTR-CAT clones showed comparable CAT expression to the wild type (NL4-3 LTR-CAT) and NL59 with Tat (Fig. 2CFigure 2) and without Tat (Fig. 2DFigure 2). However, some clones showed variable levels of CAT expression compared with wild type LTR, pHIV-CAT and NL59, including MC1, MC2 and IC12. We found these clones had mutations, MC1 had mutations downstream of TAR, MC2 upstream of AP-I sites, and IC12 upstream of AP-I sites, and between AP-I and NFAT sites. These mutations are likely altering LTR-CAT expression of these clones.
Figure 2
Figure 2
Figure 2
HIV-1 gene expression in 293 cells of mother-infant LTR sequences driven CAT gene expression. Mother-infant pair B LTRs driven CAT constructs were transfected in 293 cells with Tat (A) and without Tat (B) and pair C LTRs driven CAT constructs with Tat (more ...)
When we analyzed LTR-CAT expression in pair-D, we found that majority of LTR clones with Tat were expressing comparable levels of CAT to wild type pHIV-CAT and NL59, however MD12, MD14, MD16, ID8, ID12, ID7, ID20 had impaired LTR function (Fig. 3AFigure 3). Similarly, basal levels of transcription of MD14, MD16, ID8, ID17, ID20 showed little to no activity (Fig. 3BFigure 3). Upon examination of the sequences, we noticed that MD14 had a mutation in NFκB-II site (Fig. 1Figure 1), upstream of AP-I sites, between AP-I and NFAT and one in TAR, MD12 between NFAT and NF-IL6, MD16 upstream of AP-I, ID8 upstream of AP-I sites, between SpI-I and TATAA box, and several in U5, ID12 upstream of AP-I, in NF-IL6 and Ets-1, ID17 upstream of AP-I sites, in USF-1, between SpI-II and SpI-I, upstream of TATAA, and downstream of TAR, ID20 upstream of AP-I sites, in API-II, in USF-1, in TAR and in U5, and ID22 upstream of AP-I sites, between AP-I and NFAT, in USF-1, in SpI-I, in TAR, downstream of TAR and in U5. In addition, these infant clones had multiple mutations in TAR. Likewise, the majority of pair-E LTRs showed comparable levels of CAT expression with Tat to that of the controls (HIV-CAT and NL59) (Fig. 3CFigure 3). However, we observed that ME6, ME7, ME10, IE4, IE5, IE6, and IE7 had lower levels of CAT expression compared with wild type. In addition, basal levels of transcription of these LTRs without Tat were non-functional, except IE1 and IE9 (Fig. 3DFigure 3). Furthermore, we found ME2 had mutations upstream of AP-I sites, between AP-I and NFAT, between NFAT sties, in NF-IL6, in Ets-1, between NFκB and Ets-1, between TATAA and TAR and one in TAR, ME5 between AP-I sites, between AP-I and NFAT, in NF-IL6 and USF-1, ME6 upstream of AP-I sites, between AP-I and NFAT, between NFAT sites, between NFAT and NF-IL6 and between USF-1 and Ets-1, ME10 upstream of AP-I sites, between AP-I and NFAT, and downstream of TAR, and ME11 between USF-1 and Ets-1, in NFκB-II and downstream of TAR. In addition, the infant sequences also contained mutations, including IE1 which had several mutations upstream of AP-I, between AP-I and NFAT, in NFAT-I, between NFAT and NF-IL6, upstream of TATAA, in TAR and in U5, IE4 between AP-I and NFAT, between NFAT and NF-IL6, in TAR and in U5, IE6 upstream of AP-I sites, between NFAT and NF-IL6, between Ets-1 and NFκB-II, and in TAR, IE7 upstream of AP-I, several between AP-I and NFAT, between NFAT and Ets-1, in Ets-1, in SpI-II, upstream of TATAA and in TAR, and IE9 between AP-I and NFAT, between NFAT and NF-IL6, and in TAR. These mutations are most likely altering LTR-CAT expression in these LTR clones.
Figure 3
Figure 3
Figure 3
HIV-1 gene expression in 293 cells of mother-infant LTR sequences driven CAT gene expression. Mother-infant pair D LTRs driven CAT constructs were transfected in 293 cells with Tat (A) and without Tat (B) and mother-infant pair E LTRs driven CAT constructs (more ...)
When we analyzed transcriptional activity of pair-G clones, we found that most clones with the exception of MG4, MG5, MG6, IG9, IG14, and IG16 showed CAT expression with Tat similar or higher to that of the control, HIV-CAT (Fig. 4AFigure 4). The basal transcriptional efficiency of these LTRs without Tat showed comparable or higher levels of activity, except MG4, MG6, IG9, IG13, and IG16 that showed lower levels of CAT expression (Fig. 4BFigure 4). Upon closer examination of the sequences we found MG4 had a mutation in U5, MG5 upstream of AP-I sites and between NFAT, MG6 and IG9 between NFAT and NF-IL6 with IG9 also having a mutation in U5, IG14 upstream of AP-I sites, and between SpI-I and TATAA, and IG16 upstream of AP-I sites, in NFAT-II, in TAR and in U5. All of the sequences in this pair had a mutation in the TATAA box, TATAA to TAAAA (Fig. 1Figure 1), which is similar to the TATAA box of subtype E LTRs (Montano et al., 1998; van Opijnen et al., 2004). Upon examination of the sequences this pair had a CATAA box instead of a TATAA box. It was also observed all mother and some infant clones had a 27 base pair insertion 11 base pairs upstream from NFκB-II (the full sequences can be accessed in Genbank). In pair-H sequences, the CAT expression was equal or higher to that of the HIV-CAT and NL59 controls both with (Fig. 4CFigure 4) and without Tat (Fig. 4DFigure 4). Specifically, MH11, IH1-3, IH1-9, IH1-12, and IH2-5 showed higher levels of CAT as compared to the wild type. However, we found that the basal transcriptional activity of MH13 and IH1-1 were lower than wild type and NL59 and could be due to mutations in the NFκB-II site and between AP-I and NFAT (MH13) and between SpI-I and TATAA (IH1-1) (Fig. 1Figure 1).
Figure 4
Figure 4
Figure 4
HIV-1 gene expression in 293 cells of mother-infant LTR sequences driven CAT gene expression. Mother-infant pair G LTRs driven CAT constructs were transfected in 293 cells with Tat (A) and without Tat (B) and mother-infant pair H LTRs driven CAT constructs (more ...)
We have recently shown that the functional domains required for HIV-1 LTR activity were mostly conserved in six mother-infant pairs following vertical transmission (Mehta et al., 2008). Furthermore, the biological characterization of the promoter (TATAA), enhancers (three SP-I sites, two NFκB sites), the modulatory region (two NFAT sites, two AP-I sites, one NF-IL6 site, one Ets-1 site, and one USF-1 site) and the TAR region revealed that these important motifs were generally conserved and functional, although several mutations were found in these sites that correlated with an altered LTR driven CAT gene expression. While the majority of the 146 clones analyzed for biological activity in this study showed a functional LTR, we observed 36 clones that had a gene expression lower than that of the control either with or without Tat (Figs. 2Figure 2 to to4)4Figure 4) contained mutations in either promoter, enhancer or modulatory regions (Fig. 1Figure 1). Taken together, these findings suggest that conservation of functional domains in HIV-1 LTR and correlation of mutations generated during vertical transmission with HIV-1 gene expression is consistent with an important role of HIV-1 LTR in viral replication and pathogenesis (Freed, 2001; Garcia et al., 1989; Gaynor, 1992; Reddy and Dasgupta, 1992).
Of the 36 clones that had decreased gene expression in our study, 10 clones showed mutations within the enhancer region. More specifically IB2, IB5, IB9, and MD14 all showed mutations within the NFκB sites. The three IB clones had mutated GGG sequences of NFκB to AAG in both sites and showed a markedly reduced gene expression with and without Tat induction (Figs. 2A and 2BFigure 2), as also seen with a CTC mutation previously described (Berkhout and Jeang, 1989). Mutations of the NFκB motifs in HIV-1 LTR CAT constructs results in marked decreases in gene expression following transfection into lymphoid cells with or without Tat (Nabel and Baltimore, 1987). Several studies have also shown that when the upstream NFκB site is mutated, gene expression is reduced five-fold and this effect is more profound when the first site was altered (Berkhout and Jeang, 1992; Montano et al., 1998) as we have observed with these three IB clones. Interestingly, the majority of clones from Pair G harbored a 27 base pair insertion 12 bases upstream from the second NFκB site and the BLAST search revealed no similarity to published sequences. Similar insertions known as the most frequent naturally occurring length polymorphisim (MFNLP), which is located just upstream of the NFκB binding sites of variable lengths, has been described before with little effect on transcriptional activity and replication (Hiebenthal-Millow and Kirchhoff, 2002). However, others studies have shown that MFNLP has a positive effect (Chen et al., 2000; Golub et al., 1990), a negative effect (Golub et al., 1990; Koken et al., 1992), or no effect on HIV-1 transcription (Estable et al., 1996). Within the SpI sites we found that MB6, MB9, MB11, IB2, IB5, IB9, IE7 and IH2-3 had mutations, and IG9 showed a mutation downstream of SpI-I. In vitro transcription studies of mutations in Sp-I binding sites have shown that elimination of site III did not affect in vitro transcription of the HIV-1 LTR, but mutations in sites I, II, and III resulted in 10-fold decreases in transcription in vitro (Jones et al., 1986). While mutations in SpI-III site have little effect on HIV-1 gene expression (Berkhout and Jeang, 1992), mutations in all three SpI binding sites can markedly decrease Tat induced activation of the LTR (Harrich et al., 1989). We did not see that any of the clones studied had mutations in all three sites. We also found that all of pair-G sequences (Fig. 1Figure 1) harbored a mutation of a T to A at the third position of the TATAA element. Mutational analysis of the TATAA box in yeast and human model systems has revealed that the third position is one of the most critical residues and must be a T (Hoopes et al., 1998; Patikoglou et al., 1999; Wobbe and Struhl, 1990). From this it was expected that pair-G clones should not be functional, however, these sequences possess a CATAA box, also found in HIV-1 subtype E LTR (Montano et al., 1998; van Opijnen et al., 2004), which is used by approximately 12% of all cellular pol II promoters that initiate transcription as efficiently as a TATAA box (van Opijnen et al., 2004).
The TAR region (+1 to +60) is critical for HIV-1 Tat induced HIV-1 transcription and mutations within TAR can significantly reduce LTR driven transcription. Tat along with host factors bind to this bulge/loop region (Pumfery et al., 2003; Sune and Garcia-Blanco, 1995) stabilizing the stem loop structure allowing continued transcription. Mutations in these regions will affect secondary stem loop structure and ultimately hinder the ability of transcription to continue. We found that 10 clones (MB9, IB2, IB5, IB9, IG9, IG16, MH3, MH12, IH2-3, IH2-7) had mutations in the TAR region with almost half of them showing mutations within the loop region and two clones showing mutations downstream of TAR. It has been reported that mutations in the hexanucleotide loop region of TAR decreases the level of cooperative Cyclin T1 and Tat binding (Helga-Maria et al., 1999). In addition, mutations in TAR region may affect secondary stem loop structure (Das et al., 1997; Feng and Holland, 1988) and decrease Tat and cellular factor binding to the TAR. The three infant-B clones IB2, IB5 and IB9 had mutations within the loop region which have been previously reported (Garcia et al., 1989) and little to no CAT expression. Garcia et. al, showed that the mutation of the loop region from CTGGGA to CTAAAA drastically reduced HIV-1 LTR driven gene expression (Garcia et al., 1989).
Of the 36 clones that had a lower gene expression than the control, 24 sequences had mutations within the modulatory region. More specifically MB6, MB9, MB11, MC2, IC12, MG5, IG14, IG16, MH3 and MH12 had mutations upstream of the AP-I site whereas, IB2, IB5, IB9, and ID20 had mutations within AP-I sites. It has been reported that single mutation in AP-I does not affect LTR transcription and that a substitution of T to G/C in both sites had little effect on basal levels as well as PMA activation of the LTR (Li et al., 1994). From our mother-infant sequences we also observed IC12 had mutations between AP-I and NFAT sites, but IB2, IB5, IB9, ID12, ME6, ME7, IE5 and IE7 had mutations within the NFAT sites whereas ME2, MG9 and IG9 had mutations downstream of the NFAT sites. Only one clone, ID12 had a mutation within the NF-IL6 site. It has been shown that NF-IL6 can bind to and increase HIV-1 LTR driven gene expression (Akira and Kishimoto, 1992; Buckner et al., 2002; Ruocco et al., 1996; Tesmer and Bina, 1996), therefore mutations in this site may alter LTR gene expression. USF-1 and Ets-1 interact cooperatively to increase HIV-1 gene expression (Sieweke et al., 1998) and we saw that 5 clones (MB9, ID8, ID17, ID20, and ME5) had mutations within USF-1 and 6 clones (IB2, IB5, IB9, ID12, IE7, and ME2) had mutations within Ets-1.
The 5′ LTR does not encode proteins capable of interacting with the immune system. However, Nef overlaps a region of the 3′ LTR and immune pressure exerted on these regulatory proteins may indirectly influence LTR diversity (Blackard et al., 2000). It is also known that the LTR is responsive to cytokines, transcriptional activators, as well as viral proteins. Nucleotide changes within regions responsible for binding these regulators may affect transcriptional fitness. One study has demonstrated that a single point mutation in the LTR abolished responsiveness to one cellular protein while simultaneously increasing responsiveness to another (Verhoef et al., 1999). These observations suggest that HIV-1 gene regulation by the LTR maybe be linked to transmission (Al-Harthi et al., 1999; Al-Harthi et al., 1998; Hashemi et al., 1999; Montano et al., 1997). Those LTRs that respond better to host factors will likely be activated at higher levels than those that do not respond, resulting in higher viral gene expression, and ultimately influencing transmission. Better understanding of the mechanisms of vertical transmission needs to be accomplished. Previously, we have characterized many of the viral genes associated with vertical transmission (Hahn et al., 1999; Hahn et al., 2003; Husain et al., 2001; Matala et al., 2001; Ramakrishnan et al., 2005; Sundaravaradan et al., 2005; Wellensiek et al., 2006; Yedavalli and Ahmad, 2001; Yedavalli et al., 1998a; Yedavalli et al., 1998b; Yedavalli et al., 2001), which has allowed researchers to gain a better understanding of molecular mechanisms of vertical transmission. The data presented in this study emphasizes the importance of LTR in viral gene regulation and pathogenesis.
Patient population and sample collection
This study was approved by the Human Subjects Committee of the University of Arizona, Tucson, Arizona and the Institutional Review Board of the Children's Hospital Medical Center, Cincinnati, Ohio. Written informed consent was obtained from patients participating in this study. Blood samples were collected from mother-infant pairs; the infants' ages at the time of specimen collection were 4.75 months (infant B), 14 months (infant C), 28 months (infant D), and 34 months (infant E) 24 months (infant G) and 7 months (infant twins H). The demographic, clinical and laboratory findings for the HIV-1-infected mother-infant pairs are shown in Table 1. Each mother-infant pair is labeled alpha-numerically with clones derived from mother labeled with M and those derived from infant with I.
Table 1
Table 1
Demographic, clinical and laboratory parameters of HIV-1 infected mother-infant pairs
Isolation of DNA from peripheral blood mononuclear cells
The peripheral blood mononuclear cells (PBMCs) were isolated by a single-step Ficoll-Paque procedure (Pharmacia-LKB, Piscataway, NJ) from the whole blood of HIV-1-positive mothers and their infants. DNA was isolated according to a modified procedure as described previously (Ahmad et al., 1995). Approximately 106 PBMCs were centrifuged at 12,000 rpm for 2 min and the cell pellet was resuspended in 0.5ml of TNE buffer (0.5 M Tris HCl [pH 7.5], 0.1M NaCl, 1mM EDTA). The suspension was treated with 0.5% sodium dodecyl sulfate (SDS) and proteinase K (10μg/ml; Boehringer Mannheim, Indianapolis, IN) at 60°C for 3hr, followed by several extractions with phenol and chloroform. The DNA was precipitated with ethanol and dissolved in 50-100μl of TE buffer (10mM Tris-HCl [pH 7.5], 1mM EDTA).
Polymerase chain reaction amplification
A two-step polymerase chain reaction (PCR) amplification, first with outer primers and then with nested or inner primers, was performed to detect the presence of HIV-1 in infected patients PBMCs (Ahmad et al., 1995). An equal amount of HIV-1 PBMC DNA (approximately 25-50 copies, minimum) was used from each patient as determined by end-point dilution. DNA oligonucleotide outer primers LTR1 (5′ CTCAGGTACCTTTAAGACCAATGACT, sense) and LTR2 (5′ TAGAGATTTTCCACACTGACTAAAA antisense) and inner primers LTR3 (5′ GGGGACAAGTTTGTACAAAAAAGCAGGCTAAGGCAGCTGTAGATCTTAGCCACT, sense) and LTR4 (5′ GGGGACCACTTTGTACAAGAAAGCTGGGTCTGAGGGATCTCTAGTTACCAGAGT, antisense) were designed according to published HIV-1 sequences of NL4-3. The PCRs were performed according to the procedure of Ahmad et al. (Ahmad et al., 1993) in 25μl reaction mixtures, each containing 2.5μl of 10X PCR buffer (100mM Tris-HCl [pH 8.3], 100mM KCl, 0.02% Tween 20), 2.5mM MgCl2, 400μM each of dATP, dCTP, dGTP, and dTTP, 0.2 to 1.0μM each of outer primers and 2.5U of TaKaRa LA Taq polymerase enzyme (TaKaRa Biomedicals, Shiga, Japan). The reactions were carried out for 35 cycles, each cycle consisting of 94°C for 30sec, 45°C for 45sec, and 72°C for 3min. After the first round of PCR, 5μl of the product was amplified using the corresponding inner primers for 35 cycles using the same parameters. The PCR products were analyzed by electrophoresis on a 1.2% agarose gel.
Construction of an HIV-1 LTR driven CAT gene expression vector
To determine the biological relevance of HIV-1 LTR, we constructed a CAT gene expression vector, which is under the control of HIV-1 LTR cloned from six mother-infant pairs following vertical transmission. To do this, we enzymatically digested CMV-CAT plasmid with HindIII and XbaI in a total volume of 50μl to remove the CMV promoter such that the CAT gene is left behind. We then made blunt ends, which were dephosphorylated using shrimp alkaline phosphate [SAP (USB)] to prevent the ends from rejoining. This promoterless vector was then used in a ligation reaction with 10-20ng of GATEWAY Cloning System Reading Frame Cassette C (Invitrogen), and 1U of T4 DNA ligase in ligase buffer, incubated at 16°C overnight. One microliter of the ligation was transformed into DB3.1 Competent Cells as these cells are not killed by the ccdB gene, which is lethal to any other strain. DNA was isolated from these transformed cells and restriction digests were performed using many different enzymes to ensure the GATEWAY Cloning System Reading Frame Cassette C was inserted in the correct orientation. This is the Destination Vector (DestVC) that was used in the second step of the GATEWAY cloning system (Invitrogen).
Cloning and DNA sequencing
The PCR products amplified by inner primer pair LTR3/LTR4, which contains U3, R and some U5 regions, were cloned into the GATEWAY cloning system, using DestVC, upstream of CAT gene. Individual bacterial colonies were screened for the presence of recombinants by restriction enzyme analysis of plasmid DNA. The clones with correct sized inserts were selected for large scale DNA preparation, followed by manual sequencing of 8 to 15 clones for each patient. Sequencing was performed using either Sequenase version 2, Thermosequenase cycle sequencing protocol (U.S. Biochemical, Cleveland, Ohio) or ABI PRISM® 3700 DNA automated sequencing system at the University of Arizona Biotechnology center.
Cell lines and DNA transfections
293 cells were cultured in MEM supplemented with 10% FBS (Invitrogen) and 1X penicillin/streptomycin and split as cells reached 75% confluency. Once cells were trypsinized and washed, 293 cells were plated in 6 well plates at 180,000 cells/well 12-18 hours before transfection was performed. On day of transfection, 1.4μg of LTR-CAT constructs, 0.4μg Tat DNA, and 0.15μg of CMV-β-galactosidase (transfection efficiency control DNA) were cotransfected using a lipid based transfection method, Trans-It 293 (Mirus). Briefly, for every microgram of DNA, 2μl of lipid was used. Lipid was added to 200μl of Opti-MEM (Invitrogen) and allowed to incubate for 20 min at room temperature. After 20 min, the lipid-Opti-MEM mixture was added dropwise to the DNA. This was then allowed to incubate for 30 min at room temperature. After incubation, fresh media was added to plated cells and 200μl of lipid-Opti-MEM-DNA mixture was added dropwise to cells. Cells were then lysed with 1X Reporter Lysis Buffer 48 hours post-transfection. Lysates were either used for enzymatic assays or frozen and stored at -80°C for future use.
CAT, β -Galactosidase and Protein Assays
Lysates from transfected 293 cells were then assayed for levels of CAT, β-galactosidase and total cellular protein. CAT was assayed using a CAT-ELISA kit (Roche) per manufacturer's instructions. Briefly, 200μl of cell lysate was added to the well and allowed to incubate at 37°C for one hour. The wells were then washed, and an Anti-CAT-DIG antibody was added and incubated for one hour at 37°C. This was then washed and Anti-DIG-POD was added for another hour at 37°C. After washing, POD substrate was added and allowed to incubate for 15-30 minutes at room temperature. After color development the absorbance was measured at 480nm. β-galactosidase levels were determined using a β -Galactosidase Enzyme Assay System with Reporter Lysis Buffer (RLB) (Promega). Briefly, 20μl of cell lysate was placed into a 96-well plate along with 20μl of 2X Assay Buffer (200mM sodium phosphate buffer [pH 7.3], 2mM MgCl2, 100mM β-mercaptoethanol, and 1.33mg/ml o-nitrophenol galactopyranoside [ONPG]) and allowed to incubate at 37°C for 30 min. Absorbance was read immediately at 418nm in a plate reader. Total cellular protein was assayed using the Protein Assay ESL kit (Roche). Briefly, 20μl of lysate was pipetted into a 96-well plate. Reagent A was then added (20μl) and allowed to incubate for 10-15 minutes at room temperature. Following incubation, 200μl of Reagent B was then added, and the plate was read immediately at 480m. Appropriate controls were performed for each assay done.
Acknowledgments
We thank the AIDS Reference and Reagent Program (Germantown, MD) for providing the cell lines. This work was supported by grants to NA from the National Institute of Allergy and Infectious Diseases Grant (AI-40378-06) and Arizona Biomedical Research Commission (7002, 8001).
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
  • Ahmad N. Molecular mechanisms of human immunodeficiency virus type 1 mother-infant transmission. Adv Pharmacol. 2000;49:387–416. [PubMed]
  • Ahmad N. The vertical transmission of human immunodeficiency virus type 1: molecular and biological properties of the virus. Crit Rev Clin Lab Sci. 2005;42(1):1–34. [PubMed]
  • Ahmad N. Molecular mechanisms of HIV-1 vertical transmission and pathogenesis in infants. Adv Pharmacol. 2008;58:453–508. [PubMed]
  • Ahmad N, Baroudy BM, Baker RC, Chappey C. Genetic analysis of human immunodeficiency virus type 1 envelope V3 region isolates from mothers and infants after perinatal transmission. J Virol. 1995;69(2):1001–12. [PubMed]
  • Ahmad N, Kuramoto IK, Baroudy BM. A ribonuclease protection assay for the direct detection and quantitation of hepatitis C virus RNA. Clin Diagn Virol. 1993;1(4):233–44. [PubMed]
  • Akira S, Kishimoto T. IL-6 and NF-IL6 in acute-phase response and viral infection. Immunol Rev. 1992;127:25–50. [PubMed]
  • Al-Harthi L, Roebuck KA, Olinger GG, Landay A, Sha BE, Hashemi FB, Spear GT. Bacterial vaginosis-associated microflora isolated from the female genital tract activates HIV-1 expression. J Acquir Immune Defic Syndr. 1999;21(3):194–202. [PubMed]
  • Al-Harthi L, Spear GT, Hashemi FB, Landay A, Sha BE, Roebuck KA. A human immunodeficiency virus (HIV)-inducing factor from the female genital tract activates HIV-1 gene expression through the kappaB enhancer. J Infect Dis. 1998;178(5):1343–51. [PubMed]
  • Berkhout B, Jeang KT. trans activation of human immunodeficiency virus type 1 is sequence specific for both the single-stranded bulge and loop of the trans-acting-responsive hairpin: a quantitative analysis. J Virol. 1989;63(12):5501–4. [PubMed]
  • Berkhout B, Jeang KT. Functional roles for the TATA promoter and enhancers in basal and Tat-induced expression of the human immunodeficiency virus type 1 long terminal repeat. J Virol. 1992;66(1):139–49. [PubMed]
  • Blackard JT, Renjifo B, Chaplin B, Msamanga G, Fawzi W, Essex M. Diversity of the HIV-1 long terminal repeat following mother-to-child transmission. Virology. 2000;274(2):402–11. [PubMed]
  • Blackard JT, Renjifo B, Fawzi W, Hertzmark E, Msamanga G, Mwakagile D, Hunter D, Spiegelman D, Sharghi N, Kagoma C, Essex M. HIV-1 LTR subtype and perinatal transmission. Virology. 2001;287(2):261–5. [PubMed]
  • Buckner AE, Tesmer VM, Bina M. Regulation of HIV-1 transcription by NF-IL6 in activated Jurkat T cells. Virus Res. 2002;89(1):53–63. [PubMed]
  • Chen P, Flory E, Avots A, Jordan BW, Kirchhoff F, Ludwig S, Rapp UR. Transactivation of naturally occurring HIV-1 long terminal repeats by the JNK signaling pathway. The most frequent naturally occurring length polymorphism sequence introduces a novel binding site for AP-1 factors. J Biol Chem. 2000;275(27):20382–90. [PubMed]
  • Colgrove RC, Pitt J, Chung PH, Welles SL, Japour AJ. Selective vertical transmission of HIV-1 antiretroviral resistance mutations. Aids. 1998;12(17):2281–8. [PubMed]
  • Das AT, Klaver B, Klasens BI, van Wamel JL, Berkhout B. A conserved hairpin motif in the R-U5 region of the human immunodeficiency virus type 1 RNA genome is essential for replication. J Virol. 1997;71(3):2346–56. [PubMed]
  • Estable MC, Bell B, Merzouki A, Montaner JS, O'Shaughnessy MV, Sadowski IJ. Human immunodeficiency virus type 1 long terminal repeat variants from 42 patients representing all stages of infection display a wide range of sequence polymorphism and transcription activity. J Virol. 1996;70(6):4053–62. [PubMed]
  • Feng S, Holland EC. HIV-1 tat trans-activation requires the loop sequence within tar. Nature. 1988;334(6178):165–7. [PubMed]
  • Freed EO. HIV-1 replication. Somat Cell Mol Genet. 2001;26(16):13–33. [PubMed]
  • Garcia JA, Harrich D, Soultanakis E, Wu F, Mitsuyasu R, Gaynor RB. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation. Embo J. 1989;8(3):765–78. [PubMed]
  • Gaynor R. Cellular transcription factors involved in the regulation of HIV-1 gene expression. Aids. 1992;6(4):347–63. [PubMed]
  • Golub EI, Li GG, Volsky DJ. Differences in the basal activity of the long terminal repeat determine different replicative capacities of two closely related human immunodeficiency virus type 1 isolates. J Virol. 1990;64(8):3654–60. [PubMed]
  • Hahn T, Matala E, Chappey C, Ahmad N. Characterization of mother-infant HIV type 1 gag p17 sequences associated with perinatal transmission. AIDS Res Hum Retroviruses. 1999;15(10):875–88. [PubMed]
  • Hahn T, Ramakrishnan R, Ahmad N. Evaluation of genetic diversity of human immunodeficiency virus type 1 NEF gene associated with vertical transmission. J Biomed Sci. 2003;10(4):436–50. [PubMed]
  • Hampsey M. Molecular genetics of the RNA polymerase II general transcriptional machinery. Microbiol Mol Biol Rev. 1998;62(2):465–503. [PubMed]
  • Harrich D, Garcia J, Wu F, Mitsuyasu R, Gonazalez J, Gaynor R. Role of SP1-binding domains in in vivo transcriptional regulation of the human immunodeficiency virus type 1 long terminal repeat. J Virol. 1989;63(6):2585–91. [PubMed]
  • Harrich D, Hooker CW, Parry E. The human immunodeficiency virus type 1 TAR RNA upper stem-loop plays distinct roles in reverse transcription and RNA packaging. J Virol. 2000;74(12):5639–46. [PubMed]
  • Harrich D, Hsu C, Race E, Gaynor RB. Differential growth kinetics are exhibited by human immunodeficiency virus type 1 TAR mutants. J Virol. 1994;68(9):5899–910. [PubMed]
  • Hashemi FB, Ghassemi M, Roebuck KA, Spear GT. Activation of human immunodeficiency virus type 1 expression by Gardnerella vaginalis. J Infect Dis. 1999;179(4):924–30. [PubMed]
  • Helga-Maria C, Hammarskjold ML, Rekosh D. An intact TAR element and cytoplasmic localization are necessary for efficient packaging of human immunodeficiency virus type 1 genomic RNA. J Virol. 1999;73(5):4127–35. [PubMed]
  • Hiebenthal-Millow K, Greenough TC, Bretttler DB, Schindler M, Wildum S, Sullivan JL, Kirchhoff F. Alterations in HIV-1 LTR promoter activity during AIDS progression. Virology. 2003;317(1):109–18. [PubMed]
  • Hiebenthal-Millow K, Kirchhoff F. The most frequent naturally occurring length polymorphism in the HIV-1 LTR has little effect on proviral transcription and viral replication. Virology. 2002;292(1):169–75. [PubMed]
  • Hoopes BC, LeBlanc JF, Hawley DK. Contributions of the TATA box sequence to rate-limiting steps in transcription initiation by RNA polymerase II. J Mol Biol. 1998;277(5):1015–31. [PubMed]
  • Husain M, Hahn T, Yedavalli VR, Ahmad N. Characterization of HIV type 1 tat sequences associated with perinatal transmission. AIDS Res Hum Retroviruses. 2001;17(8):765–73. [PubMed]
  • Jones KA, Kadonaga JT, Luciw PA, Tjian R. Activation of the AIDS retrovirus promoter by the cellular transcription factor, Sp1. Science. 1986;232(4751):755–9. [PubMed]
  • Koken SE, van Wamel JL, Goudsmit J, Berkhout B, Geelen JL. Natural variants of the HIV-1 long terminal repeat: analysis of promoters with duplicated DNA regulatory motifs. Virology. 1992;191(2):968–72. [PubMed]
  • Li Y, Mak G, Franza BR., Jr In vitro study of functional involvement of Sp1, NF-kappa B/Rel, and AP1 in phorbol 12-myristate 13-acetate-mediated HIV-1 long terminal repeat activation. J Biol Chem. 1994;269(48):30616–9. [PubMed]
  • Matala E, Hahn T, Yedavalli VR, Ahmad N. Biological characterization of HIV type 1 envelope V3 regions from mothers and infants associated with perinatal transmission. AIDS Res Hum Retroviruses. 2001;17(18):1725–35. [PubMed]
  • Mayaux MJ, Blanche S, Rouzioux C, Le Chenadec J, Chambrin V, Firtion G, Allemon MC, Vilmer E, Vigneron NC, Tricoire J, et al. Maternal factors associated with perinatal HIV-1 transmission: the French Cohort Study: 7 years of follow-up observation. The French Pediatric HIV Infection Study Group. J Acquir Immune Defic Syndr Hum Retrovirol. 1995;8(2):188–94. [PubMed]
  • Mehta R, Ramakrishnan R, Doktor K, Sundaravaradan V, Ahmad N. Genetic Characterization of HIV Type 1 Long Terminal Repeat Following Vertical Transmission. AIDS Res Hum Retroviruses. 2008 In press.
  • Montano MA, Nixon CP, Essex M. Dysregulation through the NF-kappaB enhancer and TATA box of the human immunodeficiency virus type 1 subtype E promoter. J Virol. 1998;72(10):8446–52. [PubMed]
  • Montano MA, Novitsky VA, Blackard JT, Cho NL, Katzenstein DA, Essex M. Divergent transcriptional regulation among expanding human immunodeficiency virus type 1 subtypes. J Virol. 1997;71(11):8657–65. [PubMed]
  • Mulder-Kampinga GA, Simonon A, Kuiken CL, Dekker J, Scherpbier HJ, van de Perre P, Boer K, Goudsmit J. Similarity in env and gag genes between genomic RNAs of human immunodeficiency virus type 1 (HIV-1) from mother and infant is unrelated to time of HIV-1 RNA positivity in the child. J Virol. 1995;69(4):2285–96. [PubMed]
  • Nabel G, Baltimore D. An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature. 1987;326(6114):711–3. [PubMed]
  • Naghavi MH, Schwartz S, Sonnerborg A, Vahlne A. Long terminal repeat promoter/enhancer activity of different subtypes of HIV type 1. AIDS Res Hum Retroviruses. 1999;15(14):1293–303. [PubMed]
  • Patikoglou GA, Kim JL, Sun L, Yang SH, Kodadek T, Burley SK. TATA element recognition by the TATA box-binding protein has been conserved throughout evolution. Genes Dev. 1999;13(24):3217–30. [PubMed]
  • Pereira LA, Bentley K, Peeters A, Churchill MJ, Deacon NJ. A compilation of cellular transcription factor interactions with the HIV-1 LTR promoter. Nucleic Acids Res. 2000;28(3):663–8. [PubMed]
  • Pitt J, Brambilla D, Reichelderfer P, Landay A, McIntosh K, Burns D, Hillyer GV, Mendez H, Fowler MG. Maternal immunologic and virologic risk factors for infant human immunodeficiency virus type 1 infection: findings from the Women and Infants Transmission Study. J Infect Dis. 1997;175(3):567–75. [PubMed]
  • Pumfery A, Deng L, Maddukuri A, de la Fuente C, Li H, Wade JD, Lambert P, Kumar A, Kashanchi F. Chromatin remodeling and modification during HIV-1 Tat-activated transcription. Curr HIV Res. 2003;1(3):343–62. [PubMed]
  • Ramakrishnan R, Hussain M, Holzer A, Mehta R, Sundaravaradan V, Ahmad N. Evaluations of HIV type 1 rev gene diversity and functional domains following perinatal transmission. AIDS Res Hum Retroviruses. 2005;21(12):1035–45. [PubMed]
  • Reddy EP, Dasgupta P. Regulation of HIV-1 gene expression by cellular transcription factors. Pathobiology. 1992;60(4):219–24. [PubMed]
  • Rohr O, Marban C, Aunis D, Schaeffer E. Regulation of HIV-1 gene transcription: from lymphocytes to microglial cells. J Leukoc Biol. 2003;74(5):736–49. [PubMed]
  • Ruocco MR, Chen X, Ambrosino C, Dragonetti E, Liu W, Mallardo M, De Falco G, Palmieri C, Franzoso G, Quinto I, Venuta S, Scala G. Regulation of HIV-1 long terminal repeats by interaction of C/EBP(NF-IL6) and NF-kappaB/Rel transcription factors. J Biol Chem. 1996;271(37):22479–86. [PubMed]
  • Salvatori F, Scarlatti G. HIV type 1 chemokine receptor usage in mother-to-child transmission. AIDS Res Hum Retroviruses. 2001;17(10):925–35. [PubMed]
  • Sieweke MH, Tekotte H, Jarosch U, Graf T. Cooperative interaction of ets-1 with USF-1 required for HIV-1 enhancer activity in T cells. Embo J. 1998;17(6):1728–39. [PubMed]
  • Sperling RS, Shapiro DE, Coombs RW, Todd JA, Herman SA, McSherry GD, O'Sullivan MJ, Van Dyke RB, Jimenez E, Rouzioux C, Flynn PM, Sullivan JL. Maternal viral load, zidovudine treatment, and the risk of transmission of human immunodeficiency virus type 1 from mother to infant. Pediatric AIDS Clinical Trials Group Protocol 076 Study Group. N Engl J Med. 1996;335(22):1621–9. [PubMed]
  • Sundaravaradan V, Hahn T, Ahmad N. Conservation of functional domains and limited heterogeneity of HIV-1 reverse transcriptase gene following vertical transmission. Retrovirology. 2005;2:36. [PubMed]
  • Sune C, Garcia-Blanco MA. Transcriptional trans activation by human immunodeficiency virus type 1 Tat requires specific coactivators that are not basal factors. J Virol. 1995;69(5):3098–107. [PubMed]
  • Sweet T, Sawaya BE, Khalili K, Amini S. Interplay between NFBP and NF-kappaB modulates tat activation of the LTR. J Cell Physiol. 2005;204(2):375–80. [PubMed]
  • Tesmer VM, Bina M. Regulation of HIV-1 gene expression by NF-IL6. J Mol Biol. 1996;262(3):327–35. [PubMed]
  • van Opijnen T, Kamoschinski J, Jeeninga RE, Berkhout B. The human immunodeficiency virus type 1 promoter contains a CATA box instead of a TATA box for optimal transcription and replication. J Virol. 2004;78(13):6883–90. [PubMed]
  • Verhoef K, Sanders RW, Fontaine V, Kitajima S, Berkhout B. Evolution of the human immunodeficiency virus type 1 long terminal repeat promoter by conversion of an NF-kappaB enhancer element into a GABP binding site. J Virol. 1999;73(2):1331–40. [PubMed]
  • Wellensiek BP, Sundaravaradan V, Ramakrishnan R, Ahmad N. Molecular characterization of the HIV-1 gag nucleocapsid gene associated with vertical transmission. Retrovirology. 2006;3(1):21. [PubMed]
  • Wobbe CR, Struhl K. Yeast and human TATA-binding proteins have nearly identical DNA sequence requirements for transcription in vitro. Mol Cell Biol. 1990;10(8):3859–67. [PubMed]
  • Wolinsky SM, Wike CM, Korber BT, Hutto C, Parks WP, Rosenblum LL, Kunstman KJ, Furtado MR, Munoz JL. Selective transmission of human immunodeficiency virus type-1 variants from mothers to infants. Science. 1992;255(5048):1134–7. [PubMed]
  • Yedavalli VR, Ahmad N. Low conservation of functional domains of HIV type 1 vif and vpr genes in infected mothers correlates with lack of vertical transmission. AIDS Res Hum Retroviruses. 2001;17(10):911–23. [PubMed]
  • Yedavalli VR, Chappey C, Ahmad N. Maintenance of an intact human immunodeficiency virus type 1 vpr gene following mother-to-infant transmission. J Virol. 1998a;72(8):6937–43. [PubMed]
  • Yedavalli VR, Chappey C, Matala E, Ahmad N. Conservation of an intact vif gene of human immunodeficiency virus type 1 during maternal-fetal transmission. J Virol. 1998b;72(2):1092–102. [PubMed]
  • Yedavalli VR, Husain M, Horodner A, Ahmad N. Molecular characterization of HIV type 1 vpu genes from mothers and infants after perinatal transmission. AIDS Res Hum Retroviruses. 2001;17(11):1089–98. [PubMed]

PubMed articles by these authors
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph