![]() | ![]() |
Formats:
|
||||||||||||
Copyright © 2008, European Molecular Biology Organization Scientific Report Prdm1- and Sox6-mediated transcriptional repression specifies muscle fibre type in the zebrafish embryo 1MRC Centre for Developmental and Biomedical Genetics, University of Sheffield, Firth Court, Western Bank, Sheffield S10 2TN, UK 2Wellcome Trust/Cancer Research-UK Gurdon Institute, The Henry Wellcome Building of Cancer and Developmental Biology, Tennis Court Road, Cambridge CB2 1QN, UK aTel: +44 114 222 2803; Fax: +44 114 276 5413; E-mail: p.w.ingham/at/sheffield.ac.uk Received November 2, 2007; Revised March 20, 2008; Accepted April 2, 2008. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits distribution, and reproduction in any medium, provided the original author and source are credited. This license does not permit commercial exploitation or the creation of derivative works without specific permission. This article has been cited by other articles in PMC.Abstract The zebrafish u-boot (ubo) gene encodes the transcription factor Prdm1, which is essential for the specification of the primary slow-twitch muscle fibres that derive from adaxial cells. Here, we show that Prdm1 functions by acting as a transcriptional repressor and that slow-twitch-specific muscle gene expression is activated by Prdm1-mediated repression of the transcriptional repressor Sox6. Genes encoding fast-specific isoforms of sarcomeric proteins are ectopically expressed in the adaxial cells of ubotp39 mutant embryos. By using chromatin immunoprecipitation, we show that these are direct targets of Prdm1. Thus, Prdm1 promotes slow-twitch fibre differentiation by acting as a global repressor of fast-fibre-specific genes, as well as by abrogating the repression of slow-fibre-specific genes. Keywords: skeletal muscle, fibre type, Blimp1/Prdm1, Sox6, zebrafish, u-boot Introduction During vertebrate development, cells become committed to the myogenic fate through the activation of myogenic regulatory factors in the paraxial mesoderm. Subsequently, the committed cells or myoblasts differentiate into muscle fibres with distinct contractile speeds, the so-called slow- and fast-twitch fibres. Terminal differentiation of these different fibre types requires the expression of specific isoforms of sarcomeric proteins, such as the myosin light and heavy chains (MyLC and MyHC, respectively) and troponins. In the zebrafish embryo, progenitors of the slow- and fast-twitch fibres can be identified on the basis of their morphology and positioning within the segmental plate before somitogenesis (Devoto et al, 1996). Paraxial mesodermal cells that lie in direct contact with the notochord—designated adaxial cells—differentiate into slow myoblasts that migrate out through the developing myotome to form a superficial layer of slow-twitch fibres. These slow fibres are mononuclear, span the entire length of each somite and express the homeodomain protein Prox1, as well as the slow myosin heavy chain 1 (smyhc1) and the slow-specific Troponin C (stnnC; Devoto et al, 1996; Roy et al, 2001; Xu et al, 2006). The fast-twitch fibres derive from more laterally located paraxial mesodermal cells that start to differentiate in the wake of the migrating slow myoblasts (Blagden et al, 1997). In contrast to the slow myoblasts, fast-twitch myoblasts undergo fusion to generate multinucleated fibres (Moore et al, 2007; Srinivas et al, 2007) and express fast MyLC and MyHC isoforms, as well as troponin T3a (tnnt3a) and troponin I2 (tnni2) (Xu et al, 2000; Hsiao et al, 2003). The specification of adaxial cells to follow the slow-twitch fibre differentiation programme depends crucially on inductive signals from the notochord and floorplate mediated by members of the Hedgehog protein family (Currie & Ingham, 1996; Blagden et al, 1997; Du et al, 1997; Lewis et al, 1999; Barresi et al, 2000; Wolff et al, 2003). Reception of the Hedgehog signals by adaxial cells results in the activation of transcription of the u-boot (ubo) gene, the function of which is both necessary and sufficient to drive slow-twitch differentiation in myoblasts (Roy et al, 2001; Baxendale et al, 2004). In ubotp39 mutants, presumptive slow-twitch fibres lose sMyHC and Prox1 expression, and seem to differentiate into fast-twitch fibres (Roy et al, 2001). The ubo gene encodes the B-lymphocyte-induced maturation protein Blimp1 or Prdm1, a PR-domain-containing protein, which, in mammals, is involved in the terminal differentiation process of B lymphocytes, the response to viral infection and primordial germ cell specification (Keller & Maniatis, 1991; Turner et al, 1994; Ohinata et al, 2005; Kallies & Nutt, 2007). In these contexts, Prdm1 has been shown to mediate transcriptional repression, acting as a scaffold that recruits co-repressors and chromatin-modifying enzymes to specific target genes (Yu et al, 2000; Gyory et al, 2004). Here, we investigate the nature of Prdm1 function and the regulatory networks underlying fibre type specification, and identify several direct targets of Prdm1. Results And Discussion Adaxial cells transform from slow into fast in ubotp39 mutants In wild-type embryos, adaxial cells are characterized by their expression of a slow isoform of the MyHC—detected by the S58 antibody—but are devoid of staining with F310—a fast MyLC isoform-specific antibody. Differentiation of adaxial cells into slow-twitch muscle starts several hours earlier than that of the fast-twitch fibres. Previous studies of ubo mutants have shown that loss of Prdm1 expression causes adaxial cells to transform from slow- to fast-twitch character (Roy et al, 2001). Consistent with this, we found that adaxial cells were labelled with F310 in ubotp39 homozygotes well before the normal onset of fast-muscle differentiation. To confirm that this represents the precocious differentiation of adaxial cells into fast-twitch fibres, we constructed a reporter gene, using sequences upstream from the previously uncharacterized fMyHC gene, which drives green fluorescent protein (GFP) expression strictly in fast-muscle cells (Fig 1A–C
Prdm1 acts as a repressor to promote slow twitch fibre type To investigate whether Prdm1 acts as an activator or repressor of transcription during slow-twitch muscle development in zebrafish, constructs in which the Prdm1 DNA-binding domain is fused to either the Engrailed (Eng) repressor or the VP16 activator domain (Kessler, 1997) were tested for their ability to substitute for the wild-type protein. Sequences encoding the fusion constructs were cloned downstream from a heat-shock-inducible promoter that simultaneously drives expression of the fluorescent protein tdTomato. Transient expression of the Eng–Prdm1 protein induced by heat shock was sufficient to rescue the expression of Prox1 in ubotp39 mutant embryos (Fig 2C
Prdm1 regulates Sox6—a repressor of slow fibre identity In mice, the transcription factor Sox6 acts as a repressor of fetal slow-twitch fibre differentiation (Hagiwara et al, 2005, 2007). We analysed expression of the zebrafish sox6 gene and found that it was expressed in the fast-muscle progenitor domain of the somites but excluded from adaxial cells (Fig 3A
Fast-twitch-specific genes are direct targets of Prdm1 The coordinated repression of multiple genes encoding fast-twitch isoforms of sarcomeric proteins could be accomplished by Prdm1-mediated repression of a fast-specific global transcriptional activator; alternatively, Prdm1 might itself act directly to repress transcription of these genes. To distinguish between these two scenarios, we used chromatin immunoprecipitation (ChIP) to test for binding of the protein to upstream regulatory regions of the putative targets. A polyclonal antibody was raised against 186 amino acids from the Prdm1 PR domain; as expected, this labelled adaxial cell nuclei during early- and mid-myogenesis (Fig 4A
The mylz2 promoter has functional Prdm1 binding sites Expression of a GFP reporter gene containing 2.3 kb of the mylz2 promoter sequence is specifically repressed in adaxial cells by Prdm1 activity (Fig 4D Identification of Prdm1 target genes by ChIP on chip To confirm and extend the findings of our candidate gene analysis, we used a recently constructed zebrafish promoter array, consisting of 60-mer probes for more than 11,000 genes within the zebrafish genome (Wardle et al, 2006), to probe the DNA isolated by ChIP of myoblast extracts (supplementary information online, accession code GSE10883 at GEO). By setting the gene array threshold for enrichment to the level of mylz2, which was at the level of significant P-value 0.0078 and P[Xbar] 0.0075, we identified 381 putative target genes (supplementary information online). Gene ontology analysis showed various genes enriched in the ChIP-on-chip sample: 11% were documented transcription factors, 24% were new genes or genes without known function, 15% were genes encoding proteins with enzyme activity, such as kinases and phosphatases, whereas others had gene ontology terms linking them to the immune and haematopoietic systems, cell-cycle regulation or apoptosis. Significantly, we found several genes encoding fast-fibre-specific isoforms of sarcomeric proteins, including those encoding fast MyHC and troponins described above, whereas no genes encoding slow-specific sarcomeric proteins or Prox1 were identified (supplementary information online). Surprisingly, sox6 was not among the transcription factor-encoding genes identified in this analysis. However, we note that representation of regulatory regions on the gene array is restricted to sequences 9 kb upstream from the 5′ end of the complementary DNAs used in its design (Wardle et al, 2006). We have identified additional sox6 sequences 30 kb upstream from the transcription start site used in the array (J.v.H., S.E. & P.W.I., unpublished data); whether sox6 is a direct target of Prdm1 remains to be determined. Conclusion Our data underline the pivotal role of Prdm1 in switching between alternative muscle fibre type programmes in the zebrafish embryo. We have shown that it accomplishes its function in two ways: first, by repressing the transcription of a repressor of slow-specific gene transcription, sox6, in a manner analogous to its repression of Pax5 in B cells (Lin et al, 2002) and, second, by acting directly as a global repressor of fast-specific differentiation genes. Although Prdm1 is expressed in the myotome of the mouse (Chang et al, 2002; Vincent et al, 2005), at present it is unclear whether it has an analogous role in fibre type specification in amniotes. Our finding that Sox6 suppresses slow-twitch fibre specification in zebrafish, however, establishes that at least some aspects of the regulatory network underlying fibre type specification (Hagiwara et al, 2005, 2007) have been conserved in evolution. Methods Fish strains, cloning of gene promoters and injection of embryos. Zebrafish mutants ubotp39 and smob641, and the transgenic line Tg(actal:GFP)zf13 have been described previously (van Eeden et al, 1996; Higashijima et al, 1997; Barresi et al, 2000; Chen et al, 2001; Roy et al, 2001; Baxendale et al, 2004). The Tg(prdm1:gfp)i111 and Tg(prdm1:gfp)i106 are described by Elworthy et al (2008). The mylz2:GFP promoter construct was generated by using 2,239 bp of the mylz2 upstream region (Ju et al, 2003; Moore et al, 2007) to generate a stable line Tg(mylz2:GFP)i135. The mylz2:GFP plasmid was also used as a template for in vitro mutagenesis of the five sites containing the Prdm1 GAAAG core sequence using the QuikChange® Multi Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) following the manufacturer's instructions to generate the Tg((5M)mylz2:GFP)i130 transgenic line. A 6.8 kb fragment upstream from the fMyHCx ATG was isolated by PCR from bacterial artificial chromosome zCR392328 by using a left primer containing an AscI restriction site (TGGCGCGCCTGCATGGTGTTTGACA) and a right primer containing NcoI (ACCCATGGTGGCGGCTTACCGT). The promoter DNA was in all cases subcloned into a GFP vector with flanking I-sceI sites. One-cell-stage embryos were microinjected with 4–8 nl of plasmid at a concentration of 40 ng/nl. Embryos were kept at 28.5°C and analysed for GFP at the 12-somite stage. Ubo morpholino-mediated knockdown of Prdm1 activity was carried out as described previously (Baxendale et al, 2004). The sox6 translation targeted morpholino (GTGGCTTGCTTGGAAGACATGATTC) was injected into one-cell-stage embryos at 0.9 mM. All fish were raised, staged and maintained as described previously (Kimmel et al, 1995; Westerfield, 2000). Prox1 rescue assay. Eng–Prdm1 and VP16–Prdm1 fusion constructs (gifts from Dr Johaness Bischof; for details, see the supplementary information online) were used in attempts to rescue Prox1 expression. Both constructs and the complete sox6 cds (EU532205) were subcloned into a pSGH2 vector containing a bidirectional heat-shock promoter (Bajoghli et al, 2004) that drives expression of both the fusion protein and the fluorescent protein tdTomato. One-cell-stage embryos were microinjected with plasmid at a concentration of 40 ng/μl. At the three- to four-somite stage, the injected embryos were heat shocked by incubation at 39°C for 2 h. Injected embryos were fixed in 4% paraformaldehyde at 24 hpf (hours post fertilization) and analysed by using confocal microscopy. Antibodies, immunohistochemistry and ChIP. A Prdm1 polyclonal antibody was raised against a fragment of the protein corresponding to amino acids 161–346 expressed as a His-tag fusion protein using the pET19b vector (Novagen, Darmstadt, Germany). Immunoprecipitation using the Prdm1 antibody was carried out according to Link et al (2006) using crude protein extracts from zebrafish embryos at the ten-somite stage. The precipitated proteins were analysed on SDS–polyacrylamide gel electrophoresis gel after Coomassie staining. A Prox1 antibody was raised against recombinant zebrafish Prox1 purified from Escherichia coli (A.M. Taylor & P.W.I., unpublished data). Whole-mount immunohistochemical analysis using F310 fast MyLC (1:50, DSHB), S58 slow MyHC (1:10, DSHB), Prox1 (1:5,000) and Prdm1 (1:15,000) antibodies was performed on embryos fixed in 4% paraformaldehyde (for protocols, see the supplementary information online). For ChIP analysis, α-actin:GFP embryos were injected with dominant negative Protein Kinase A (dnPKA) at the one- to two-cell stage and were kept in embryonic medium until the 12- to 14-somite stage. The chorions were removed using pronase and cells were fixed for 15 min in 1.85% formaldehyde. For the ChIP-on-chip assay (supplementary information online), the embryos were dissociated using collagenase and GFP-positive cells were isolated. In addition to the ChIP on chip, three replicates of 300 embryos were used in the ChIP assay, which was performed as described previously (Wardle et al, 2006) using the Prdm1 antibody or rabbit preserum. Precipitated chromatin was analysed using Custom TaqManR Assays (Applied Biosystems, Foster City, CA, USA), specific to regions within the first 1 kb of upstream sequences from the first codon of mylz2 (NM_131188), fMyHCx (EU115994), tnnt3a (NM_131565), tnni2 (NM_205742), stnnC (AF281003), prox1 (NM_131405) and sMyHC1 (NM_001020507; for oligonucleotides and probes, see the supplementary information online). For whole-mount ISH, antisense digoxigenin (DIG) probes for mylz2, tnnt3a, tnni2, fMyHCx, sox6 and stnnC (subcloned from IMAGE_6899234, zgc:86932; Thisse et al, 2001; Xu et al, 2006) were generated and the ISH was performed as described previously (Thisse & Thisse, 1998). Fluorescent ISH used anti-dig POD (Roche, Basel, Switzerland) at 1:10,000 with tyramide signal amplification (TSA) Cyanine 3 (Perkin Elmer, Waltham, MA, USA). Supplementary information is available at EMBO reports online (http://www.emboreports.org). Supplementary Information Click here to view.(91K, pdf) Supplement Data 1 Click here to view.(42K, xls) Acknowledgments We thank J. Bischof for the Eng–Prdm1 and Vp16–Prdm1 fusion constructs, and A.M. Taylor for generating the His–Prdm1 fusion protein and the Prox1 antibody. This work was funded by a UK MRC Programme Grant (G0100151) to P.W.I., a Wellcome Trust Programme grant (077592) to J.C.S. and the EU FP6 ‘Cells into Organs' Network of Excellence. J.v.H. is a Wenner-Gren Foundation fellow. Footnotes The authors declare that they have no conflict of interest. References
|
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||
Development. 1996 Nov; 122(11):3371-80.
[Development. 1996]Genes Dev. 2001 Jun 15; 15(12):1563-76.
[Genes Dev. 2001]Genetics. 2006 Oct; 174(2):735-52.
[Genetics. 2006]Genes Dev. 1997 Sep 1; 11(17):2163-75.
[Genes Dev. 1997]Development. 2007 Sep; 134(17):3145-53.
[Development. 2007]Nature. 1996 Aug 1; 382(6590):452-5.
[Nature. 1996]Genes Dev. 1997 Sep 1; 11(17):2163-75.
[Genes Dev. 1997]J Cell Biol. 1997 Oct 6; 139(1):145-56.
[J Cell Biol. 1997]Dev Biol. 1999 Dec 15; 216(2):469-80.
[Dev Biol. 1999]Development. 2000 May; 127(10):2189-99.
[Development. 2000]Genes Dev. 2001 Jun 15; 15(12):1563-76.
[Genes Dev. 2001]Proc Natl Acad Sci U S A. 1997 Nov 25; 94(24):13017-22.
[Proc Natl Acad Sci U S A. 1997]Nat Immunol. 2004 Mar; 5(3):299-308.
[Nat Immunol. 2004]Dev Dyn. 2005 Oct; 234(2):301-11.
[Dev Dyn. 2005]Dev Dyn. 2007 Aug; 236(8):2062-76.
[Dev Dyn. 2007]J Immunol. 2004 Nov 1; 173(9):5556-63.
[J Immunol. 2004]Genome Biol. 2006; 7(8):R71.
[Genome Biol. 2006]Mol Cell Biol. 2002 Jul; 22(13):4771-80.
[Mol Cell Biol. 2002]Mech Dev. 2002 Sep; 117(1-2):305-9.
[Mech Dev. 2002]Development. 2005 Mar; 132(6):1315-25.
[Development. 2005]Dev Dyn. 2005 Oct; 234(2):301-11.
[Dev Dyn. 2005]Dev Dyn. 2007 Aug; 236(8):2062-76.
[Dev Dyn. 2007]Development. 1996 Dec; 123():153-64.
[Development. 1996]Dev Biol. 1997 Dec 15; 192(2):289-99.
[Dev Biol. 1997]Development. 2000 May; 127(10):2189-99.
[Development. 2000]Development. 2001 Jun; 128(12):2385-96.
[Development. 2001]Genes Dev. 2001 Jun 15; 15(12):1563-76.
[Genes Dev. 2001]Dev Biol. 2004 Jul 15; 271(2):416-30.
[Dev Biol. 2004]BMC Dev Biol. 2006 Jan 13; 6():1.
[BMC Dev Biol. 2006]Genome Biol. 2006; 7(8):R71.
[Genome Biol. 2006]Genetics. 2006 Oct; 174(2):735-52.
[Genetics. 2006]