• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of cjvetresCVMACanadian Journal of Veterinary ResearchSee also Canadian Journal of Comparative MedicineJournal Web siteHow to Submit
Can J Vet Res. Apr 2008; 72(3): 242–248.
PMCID: PMC2327245

Language: English | French

Prevalence of Actinobacillus pleuropneumoniae, Actinobacillus suis, Haemophilus parasuis, Pasteurella multocida, and Streptococcus suis in representative Ontario swine herds

Abstract

Tonsillar and nasal swabs were collected from weanling pigs in 50 representative Ontario swine herds and tested for the presence of 5 important bacterial upper respiratory tract pathogens. All but 1 herd (2%) tested positive for Streptococcus suis by polymerase chain reaction (PCR); 48% of herds were S. suis serovar 2, 1/2 positive. In all but 2 herds there was evidence of Haemophilus parasuis infection. In contrast, toxigenic strains of Pasteurella multocida were detected by a P. multocida — enzyme-linked immunosorbant assay (PMT-ELISA) in only one herd. Seventy-eight percent of the herds were diagnosed positive for Actinobacillus pleuropneumoniae by apxIV PCR. Sera from finishing pigs on the same farms were also collected and tested by ELISA for the presence of A. pleuropneumoniae antibodies. Seventy percent of the herds tested had evidence of antibodies to A. pleuropneumoniae including serovars 1–9–11 (2%), 2 (4%), 3–6–8–15 (15%), 5 (6%), 4–7 (26%), and 12 (17%). This likely represents a shift from previous years when infection with A. pleuropneumoniae serovars 1, 5, and 7 predominated. At least 16% and possibly as many as 94% of the herds tested were Actinobacillus suis positive; only 3 of the 50 herds were both A. pleuropneumoniae and A. suis negative as judged by the absence of a positive PCR test for apxII. Taken together, these data suggest that over the past 10 years, there has been a shift in the presence of pathogenic bacteria carried by healthy Ontario swine with the virtual elimination of toxigenic strains of P. multocida and a move to less virulent A. pleuropneumoniae serovars. As well, there appears to be an increase in prevalence of S. suis serovar 2, 1/2, but this may be a reflection of the use of a more sensitive detection method.

Résumé

Des écouvillons nasaux et des amygdales ont été prélevés chez des porcs sevrés dans 50 troupeaux ontariens représentatifs et éprouvés pour la présence de 5 agents pathogènes bactériens importants du tractus respiratoire supérieur. Tous les troupeaux sauf un (2 %) se sont avérés positifs par réaction d’amplification en chaîne par la polymérase (PCR) pour la présence de Streptococcus suis; 48 % des troupeaux étaient positifs pour S. suis sérovars 2, 1/2. Il y avait des évidences d’infection par Haemophilus parasuis dans tous les troupeaux sauf 2. Par contre, des souches toxinogéniques de Pasteurella multocida, détectées au moyen d’une épreuve immunoenzymatique (PMT-ELISA), n’ont été mises en évidence que dans un seul troupeau. Quatre-vingts pourcents des troupeaux ont été déclarés positifs pour la présence d’ Actinobacillus pleuropneumoniae par PCR détectant apxIV. Des échantillons de sérum provenant de porcs en finition sur la même ferme ont été prélevés et testés par ELISA pour la présence d’anticorps envers A. pleuropneumoniae. Soixante-dix pourcents des troupeaux avaient des animaux positifs pour la présence d’anticorps envers A. pleuropneumoniae incluant les sérovars 1–9–11 (2 %), 2 (4 %), 3–6–8–15(15 %), 5 (6 %), 4–7 (26 %) et 12 (17 %). Ceci représente un changement par rapport aux années précédentes alors que les infections par les sérovars 1,5 et 7 d’ A. pleuropneumoniae prédominaient. Au moins 16 % et possiblement jusqu’à 94 % des troupeaux éprouvés étaient positifs pour Actinobacillus suis; seulement 3 des 50 troupeaux étaient négatifs pour la présence d’ A. pleuropneumoniaeet A. suis, à en juger par l’absence d’un test positif par PCR pour apxII. Pris dans son ensemble, ces résultats suggèrent qu’au cours des 10 dernières années, il y a eu un changement dans la présence des bactéries pathogènes portées par les porcs ontariens en santé, avec une élimination presque totale des souches toxinogéniques de P. multocida et un mouvement vers des sérovars moins virulents d’A. pleuropneumoniae. Également, il semble y avoir une augmentation de la prévalence de S. suis sérovars 2, 1/2, mais ceci pourrait être un reflet de l’utilisation de méthode de détection plus sensible.

(Traduit par Docteur Serge Messier)

Introduction

A number of important bacterial pathogens of swine can reside as commensal flora in the upper respiratory tract of swine. Under conditions that are poorly understood, these organisms can cause disease in the colonized animal or be spread to other animals, particularly if they are of a different age or health status. Although there have been many studies of these organisms in diseased animals, much less is known about the distribution of these pathogens in clinically healthy swine.

Haemophilus parasuis, the causative agent of Glasser’s disease, has been historically associated with sporadic disease in immunocompromised or stressed piglets (1,2). In high health status herds, H. parasuis can cause fibrinous polyserositis, arthritis, and meningitis in pigs of all ages. Haemophilus parasuis is also reported to cause pneumonia often, but not always, in the presence of other pathogens (1). Some serovars of H. parasuis are thought to be more virulent than others, but to date, no true virulence factors have been described. Although there is some debate regarding its primary site of colonization, H. parasuis can consistently be isolated from the nasal cavity, and it is presumably from this site that the organism initially gains access to the bloodstream.

Actinobacillus suis, another upper respiratory tract colonizer, has been historically associated with sporadic cases of septicemia in very young animals (3). More recently, A. suis has been associated with disease in high health status animals of all ages and has been reported to cause a wide range of pathological conditions including septicemia, arthritis, pneumonia, enteritis, meningitis, abortion, endocarditis, and erysipelas-like lesions (3). Little is known about the virulence factors of A. suis, but it is supposed that homologs of those in its close relative Actinobacillus pleuropneumoniae including the apxI and apxII toxins, urease, and several iron binding proteins are important in its pathogenesis (4).

Streptococcus suis is another early colonizer of swine that can be isolated from the tonsils and nasal tracts of piglets. Initial infection likely occurs via the respiratory tract during suckling or from the vaginal tract during birth. Streptococcus suis is reported to cause a wide range of clinical conditions including meningitis, septicemia, arthritis, pneumonia, endocarditis, vaginitis, and abortion (5). To date, 33 different serovars and a large number of virulence factor candidates have been proposed, but there is no clear association between a particular serovar or virulence factor and the clinical picture (6). Serovar 2 strains, however, are generally considered to be the most virulent, and importantly, they can cause serious disease in humans (5).

Actinobaccillus pleuropneumoniae was historically thought of as a primary pathogen that could cause an acute fibrinous pleuropneumonia in pigs of all ages (7,8). Morbidity and mortality was high, and animals that survived the initial infection were frequently “poor-doers” and had chronic lung lesions. Over the last 10 y, A. pleuropneumoniae has continued to be a problem in some parts of the world, but fewer large outbreaks have been reported in North America. Transmission of A. pleuropneumoniae occurs by the aerosol route or by direct contact, and the tonsil is the primary site of colonization. To date, 15 serovars of A. pleuropneumoniae have been described. Most serovars carry either the apxI and apxII or apxII and apxIII toxin genes, and in addition, all serovars carry the apxIV toxin gene. It is generally believed that serovars that carry the apxI and apxII genes (serovars 1, 5, 9, and 11) are more virulent than other serovars (9).

Pasteurella multocida is another common inhabitant of the upper respiratory tract of swine. Together with Bordetella bronchiseptica, toxigenic strains of P. multocida can cause progressive atrophic rhinitis (10). Both toxigenic and nontoxigenic strains of P. multocida can also cause pneumonic pasteurellosis, usually in conjunction with Mycoplasma hyopneumoniae or Aujezky’s virus (11). To date, 5 capsule types: A, B, D, E, and F have been described, but only types A, B, and D have been recovered in swine. Aside from the dermonecrotic toxin, the virulence factors of P. multocida are poorly characterized. In North America and Europe, P. multocida is typically associated with subacute or chronic pleuritis. Both vertical and horizontal transmission occurs, with the most common form of transmission being nose-to-nose contact.

The objective of this research project was to estimate the prevalence of S. suis, toxigenic strains of P. multocida, A. pleuropneumoniae, A. suis, and H. parasuis in the upper respiratory tract of asymptomatic nursery-aged pigs from 50 herds chosen as representative of the Ontario swine industry using a variety of different molecular methods.

Materials and methods

Study design

Herds were chosen using a convenience sampling of 50 herds from approximately 4000 pork producers in Ontario. Care was taken to have representation from all agricultural regions in southern Ontario, and inclusion of a wide variety of farm types including high-health units, multi-site farms, and various types of farrow-to-finish or farrow-to-feeder pig farms.

Sampling procedures

Herds were sampled from May through August of 2003. In each herd, 10 pigs of approximately 6 wk of age were chosen and samples were taken; where possible, a single pig per pen was selected. None of the pigs sampled had been vaccinated against any of the organisms tested for in this study, and only pigs that appeared healthy were used. The pig’s mouth was held open using a gag, and 2 swabs were taken from the tonsils, and 2 swabs were used to sample each nostril. Swabs were streaked over the entire surface of selective plates (see following text). After overnight incubation at 37°C (5% CO2) 1 mL of sterile phosphate buffered saline (PBS) was used to flood each plate, and the bacteria were removed to a 1.5 mL microfuge tube. These mixed cultures were then used for PCR analysis. One nasal swab was used directly in the DAKO PMT ELISA (DAKO North America, Carpintera, California, USA). In addition, blood samples were collected from pigs approximately 5 mo of age in the grower-finisher barn on each farm and tested for the presence of antibodies against A. pleuropneumoniae. If no A. pleuropneumoniae antibodies were detected in the first 10 sera tested, up to an additional 30 sera were tested.

Haemophilus parasuis PCR

Nasal swabs were plated on pleuropneumonia-like organisms (PPLO) selective medium containing 0.1 μg/mL crystal violet, 5.0 μg/mL bacitracin, 1.5 μg/mL lincomycin, 0.02% NAD and 2.0% heat inactivated horse serum. For these studies, mixed cultures from 3 animals were tested individually, and if at least 2 of the 3 cultures were not positive, up to 7 additional cultures were tested. Haemophilus parasuis 16S rRNA PCRs were performed using the method of Oliveira et al (12). Briefly, 50 μL of the pooled bacteria PBS suspension was boiled for 10 min, centrifuged for 5 min, and then the supernatant was placed in a fresh tube and stored at −20°C. The 20 μL PCRs contained 2.0 μL 10 × PCR buffer (Invitrogen, Burlington, Ontario), 0.6 μL 50 mM magnesium chloride (MgCl2) (2.0 μL 1.0 mM deoxyribonucleotide triphosphates (dNTPs), 2.0 μL 3.0 μM HPS-Forward (5’GTGATGAGGAAGGGTGGTGT 3’), 2.0 μL 3.0 μM HPS-Reverse (5’GGCTTCGTCACCCTCTGT 3’), 0.5 μL Taq polymerase (Invitrogen) plus 1.0 to 5.0 μL template. The PCR run conditions were: 95°C for 5 min followed by 30 cycles of 94°C for 30 s, 59°C for 30 s and 72°C for 2 min with a final elongation step at 72°C for 5 min.

ApxII PCR and ApxIV PCR

Tonsillar swabs were plated on selective sheep blood agar plates containing 1 μg/mL crystal violet, 10 μg/mL bacitracin, and 0.01% nicotinamide adenine dinucleotide (NAD). For these studies, 2 groups of 5 individual mixed cultures were pooled for testing. The apxIIA PCRs were done using a modification of the method of Frey et al (13). Briefly, 100 μL of PBS suspension was boiled for 10 min, centrifuged for 2 to 3 min, and the supernatant was placed in a fresh tube and stored at −20°C. The 25 μL PCRs contained 2.5 μL 10 × PCR buffer, 0.75 μL 2.5 mM dNTPs, 1.0 μL L 50 mM MgCl2, 2.0 m 25 μM APXIIL1 (5’TTCTGGAGCATCTGCAGGTC 3’), 1.0 μL 25 μM APXIIR1 (5’TGAGCTAGCATCACCATCTG 3’), 0.25 μL Taq plus 5.0 μL template. The PCR run conditions were: 94°C for 1 min followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min with a final elongation step at 72°C for 7 min.

For apxIVA detection, 2 pools of 5 independent mixed cultures were tested initially with an “un-nested” PCR using primers APXIVA-1L and APXIVA-1R as described by Schaller et al (14). Where results were ambiguous, cultures were tested singly or were tested using the nested PCR protocol of Schaller et al (14). Briefly, 100 μL of PBS suspension was boiled for 10 min, centrifuged for 2 to 3 min, and then the supernatant was placed in a fresh tube and stored at −20°C. The 25 μL PCRs contained 2.5 μL 10 × PCR buffer, 0.75 μL 50 mM L 2.5 mM dNTPs, 1.0 μL 25 μM MgCl2, 2.0 m APXIVA-1L (5’TGGCACTGACGGTGATGA3’), 1.0 μL 25 μM APXIVA-1R (5’GGCCATCGACTCAACCAT 3’), 0.25 μL Taq plus 1.0 μL template. Nested PCR reactions were performed with primers APXIVANESTI-1L (5’GGGGACGTAACTCGGTGATT3’) and APXIVANESTI-1R (5’GCTCACCAACGTTTGCTCAT3’) using 5 μL of the first reaction as template. The PCR run conditions were: 94°C for 1 min followed by 30 cycles of 94°C for 30 s, 52°C for 30 s and 72°C for 30 s with a final elongation step at 72°C for 7 min.

Actinobacillus pleuropneumoniae serology

Sera from 10 finishing pigs per herd were tested for the presence of antibodies to A. pleuropneumoniae. If the first 10 sera were negative, an additional 30 sera were tested, Serology was done using a long-chain lipopolysaccharides (LC-LPS) ELISA at the Université de Montréal as previously described (1517) for serotypes 1–9–11, 2, 3–6–8–15, 4–7, 5a–5b, 10, and 12. None of the animals tested had been vaccinated against A. pleuropneumoniae.

Pasteurella multocida toxin detection

Pasteurella multocida toxin detection was done at the Animal Health Laboratory at the University of Guelph. Nasal swabs were processed and toxin assays were done using a DAKO PMT ELISA (DAKO North America) according to the manufacturer’s instructions.

Streptococcus suis PCRs

Tonsillar swabs were plated on Todd Hewitt selective plates containing 2 μg/mL crystal violet, 12.5 μg/mL colistin, 25 μg/mL nalidixic acid, and 50 μg/mL sodium azide. For these studies, 2 pools of 5 mixed cultures were tested using a multiplex PCR for S. suis and S. suis 2 and/or 1/2 based on the gdh and the cps2J genes (18,19) Briefly, 100 μL of PBS suspension was boiled for 10 min, centrifuged for 2 to 3 min and the supernatant was placed in a fresh tube and stored at −20°C. For the cps multiplex PCR, the 25 μL reaction contained 2.5 μL 10 × PCR buffer, 0.75 μL 1 mM L 50 mM MgCl2, 2.5 m dNTPs, 0.84 μL 30 μM JP4 (5’GCAGCGTATTCTGTCAAACG3’), 0.84 μL 30 μM gp5 (5’CCATCCATGGACAGATAAAGATGG3’), 0.21 μL 30 μM cps2J (5’CAAACGCAAGGAATTACGGTATC3’), 0.21 μL 30 μM cps2R (5’GAGTATCT AAAGAATGCCTATTG3’), 0.25 μL Taq plus 2.5 μL template. The PCR run conditions were: 94°C for 5 min followed by 35 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min with a final elongation step at 72°C for 7 min.

Results and discussion

Although the different selective media reduced the “contaminating” microflora recovered from nasal and tonsillar swabs, very complex mixed cultures were recovered. For example, at least 4 different hemolytic colony types could be seen when tonsillar swabs were plated on selective blood agar plates (Figure 1). Although little is known about the complexity of the normal upper respiratory tract microflora of swine, members of the family Pasteurellaceae and gram positive organisms such as Streptococcus spp., Rothia nasimurium, and Staphylococcus aureus have been reported (20,21).

Figure 1
A— Tonsillar swab plated on Actinobacillus selective medium. B — Individual hemolytic colonies streaked for single colony isolation on selective medium.

All but 1 herd (#14) tested positive for S. suis by the gdh PCR assay (Figure 2A). As expected, this herd was also negative for S. suis serovars 2 and 1/2. This result is consistent with the study of Brisebois et al (22), who cultured S. suis from the nasal cavities of 94% of 4- to 8-week-old piglets on 98% of the farms studied. In contrast to the current study, where 48% of the farms tested were serovar 2, 1/2 PCR positive, in the Brisbois et al (22) study, only 5% of the isolates were serovar 1/2 and 9% were serovar 2 culture positive (Table I). This apparent inconsistency could indicate an actual difference in prevalence of the sevovars present in the 2 studies or, more probably, serovar 2, 1/2 isolates might not be the predominant strains in healthy animals and as such, less likely to be cultured, but present at a level still detectable by PCR. In studies by Marois et al (23) a PCR test based on S. suis cps2J was found to be 20× more sensitive than a culture for detection of S. suis serovar 2, 1/2. The relatively high (48%) prevalence of S. suis serovar 2, 1/2 detected in the current study in clinically healthy animals is consistent with an earlier study in which 25 to 35% of S. suis isolates recovered from clinical cases of S. suis in Quebec were serovar 1/2 or 2 (24). The prevalence of S. suis serovar 2, 1/2 in Canada, however, is not as high as has been reported in some European countries (25).

Figure 2
A — Ethidium bromide stained amplicons of ghd (present in all serovars of S. suis) and cps2J (present in S. suis serovar 2, 1/2 ). Lane 1 — 100 bp ladder; Lanes 2 to 15 — pooled tonsillar samples; Lane 16 — S. suis serovar ...
Table I
Farm properties, PCR, and serology results

Haemophilus parasuis is often described as a common commensal bacterium of the upper respiratory tract of swine, although there have been few systematic surveys of this organism. In 1989, Smart et al (26) reported that 16/19 SPF herds in Ontario contained clinically healthy H. parasuis carriers and in an earlier study, showed that healthy swine from both conventional and SPF herds carried several strains of H. parasuis (27). In the current study, H. parasuis was detected in all but 2 herds (Table I; Figure 2B). In the case of herd #60, which was positive for all the other organisms tested, it is most likely that despite all precautions taken, H. parasuis numbers became greatly reduced during transport as this was the most distant farm sampled.

Seventy-eight percent of the herds tested were A. pleuropneumoniae positive based on positive apxII and apxIV tests (Table I, Figures 2C and 2D). As well, 70% of the herds tested had antibodies to A. pleuropneumoniae serovars 1 (9, 11) (2%), 2 (4%), 3 (6, 8, 15) (15%), 5 (6%), 7 (4) (26%) and 12 (17%). Although there have been no systematic surveys of A. pleuropneumoniae in clinically healthy swine in Ontario, this result is consistent with the reduction seen in serovars 1 and 5, which were the most prevalent clinical isolates in Quebec and Ontario herds in the 1980’s and 1990’s, and the increase in serovars 7 and 12 clinical isolates (28). This result is also consistent with the findings of Levonen et al (29) who found antibodies in 61% of the animals tested, although antibodies to serovar 2 (26%) and 3 (56%) were most prevalent. This shift toward less virulent serovars is likely the result of increased testing and monitoring, improved biosecurity, and the use of procedures such as all-in/ all-out management in nurseries and grower barns and the limiting of commingling of animals from multiple sources. In Ontario there is a provincial health program for the control of A. pleuropneumoniae serovars 1 and 5 in breeding stock, which presumably has influenced the prevalence of these serovars in commercial herds.

Three herds (29, 32, and 59) were A. pleuropneumoniae positive by apxIV PCR, but negative on serology. Although up to 40 sera were tested in PCR positive herds, it is possible that the prevalence in the finisher animals was relatively low and that more sera were needed to confirm the infection. In addition, although the sera were tested for almost all of the serovars known to be present in Canada (1, 2, 3, 4, 5, 6, 7, 8, 10, 12, and 15) (30), it is possible that animals in these 3 herds were infected with a serovar 13 or an untypable strain. It might also be noted that the small inconsistency seen could result from the fact that the serology was done on a farm basis and the animals tested by serology were not the same animals or same cohort of animals that were tested by PCR.

Only 8 of the herds tested had evidence of A. suis, but not A. pleuropneumoniae infection based on a positive apxII test in the absence of apxIV amplification (Table I, Figure 2C). Since apxII is common to both A. suis and A. pleuropneumoniae it was not possible to determine how many of the apxII and apxIV positive herds were dually infected. A similar problem is encountered when herds are tested using hemolysin serology (31).

Only 1 herd had evidence of toxigenic P. multocida based on a PMT ELISA. This low incidence is comparable to that reported by Hariharan et al (32) and Jamaludin et al (33). It likely reflects the increased use of vaccines to control atrophic rhinitis and is consistent with the low prevalence of atrophic rhinitis in Ontario. The low incidence may also reflect the fact that the PMT ELISA is not as sensitive as the toxA PCR test, but nevertheless suggests that toxigenic P. multocida strains are rare in Ontario herds.

Although the goal of the research was not to look at herd level risk factors we did, however, record certain basic farm characteristics such as herd size and whether the herd employed multi-site production (Table I). There were no obvious trends to suggest either factor is clearly related to the presence or absence of an organism. For H. parasuis, it was difficult to do any kind of analysis with regard to herd information because the organism was present on almost all the farms; with P. multocida, the opposite situation existed with only 1 positive herd. As well, there were 5 herds in this study that used off-site nurseries (multi-site production). It has been suggested that this type of management would result in reduced spread of disease because the vulnerable nursery pigs are segregated from older disease-carrying animals. The findings in this limited study do not support this hypothesis at least with respect to A. pleuropneumoniae or S. suis, with 4 of 5 multi-site herds being positive for A. pleuropneumoniae and 5 of 5 being positive for S. suis.

To our knowledge, this is the first comprehensive study of bacterial pathogens in clinically healthy Ontario swine. Although it is not possible to extrapolate these results to the entire Ontario pig population without caution because the herds used in the study were not a true random sample, care was taken to choose farms that represented a wide range of farm size, type, and geographical distribution. In the current study it was demonstrated that infection with toxigenic P. multocida is very rare, while H. parasuis, A. pleuropneumoniae (particularly serovars 7 and 12), and S. suis are present in most herds. As well, A. suis may be present in up to 90% of Ontario herds. Only 6% of herds tested were found to be free of both A. pleuropneumoniae and A. suis. Almost half of the herds tested carried S. suis serovar 2 or 1/2, or both. Although the positive results may have been due the presence of serovar 1/2 strains, in view of the zoonotic potential of serovar 2 strains, further studies may be warranted. Studies are also needed to better understand the interactions between these bacterial species and viral pathogens such as PRRSV and porcine circovirus type 2.

Acknowledgments

This work was supported by grants from Ontario Pork, the Natural Sciences and Engineering Research Council of Canada, and the Ontario Ministry of Agriculture and Food.

References

1. Rapp-Gabrielson VJ, Oliveira S, Pijoan C. Haemophilus parasuis. In: Straw BE, Zimmerman JJ, D’Allaire S, et al., editors. Diseases of Swine. Vol. 9. Ames, Iowa: Blackwell Pub; 2006. pp. 681–690.
2. Oliveira S, Pijoan C. Haemophilus parasuis: New trends on diagnosis, epidemiology and control. Vet Microbiol. 2004;99:1–12. [PubMed]
3. MacInnes JI, Desrosiers R. Agents of the “suis-ide diseases” of swine: Actinobacillus suis, Haemophilus parasuis, and Streptococcus suis. Can J Vet Res. 1999;63:83–89. [PMC free article] [PubMed]
4. Bahrami F, Niven DF. Iron acquisition by Actinobacillus suis: Identification and characterization of a single-component haemoglobin receptor and encoding gene. Microb Pathog. 2005;39:45–51. [PubMed]
5. Higgins R, Gottschalk M. Streptococcal diseases. In: Straw BE, Zimmerman JJ, D’Allaire S, et al., editors. Diseases of Swine. 9. Ames, Iowa: Blackwell Pub.; 2006. pp. 769–784.
6. Hill JE, Gottschalk M, Brousseau R, Harel J, Hemmingsen SM, Goh SH. Biochemical analysis, cpn60 and 16S rDNA sequence data indicate that Streptococcus suis serotypes 32 and 34, isolated from pigs, are Streptococcus orisratti. Vet Microbiol. 2005;107:63–69. [PubMed]
7. Gottschalk M, Taylor DJ. Actinobacillus pleuropneumoniae. In: Straw BE, Zimmerman JJ, D’Allaire S, et al., editors. Diseases of Swine. 9. Ames, Iowa: Blackwell Pub; 2006. pp. 563–576.
8. Sebunya TN, Saunders JR. Actinobacillus pleuropneumoniae infection in swine: A review. J Am Vet Med Assoc. 1983;182:1331–1337. [PubMed]
9. Frey J. Virulence in Actinobacillus pleuropneumoniae and RTX toxins. Trends Microbiol. 1995;3:257–261. [PubMed]
10. Pijoan C. Pneumonic Pasteurellosis. In: Straw BE, Zimmerman JJ, D’Allaire S, et al., editors. Diseases of Swine. 9. Ames, Iowa: Blackwell Pub; 2006. pp. 719–726.
11. de Jong MF. Progressive and nonprogressive atrophic rhinitis. In: Straw BE, Zimmerman JJ, D’Allaire S, et al., editors. Diseases of Swine. 9. Ames, Iowa: Blackwell Pub; 2006. pp. 577–602.
12. Oliveira S, Galina L, Pijoan C. Development of a PCR test to diagnose Haemophilus parasuis infections. J Vet Diagn Invest. 2001;13:495–501. [PubMed]
13. Frey J, Beck M, Nicolet J. Typing of the apx toxin gene of Actinobacillus pleuropneumoniae using PCR. Schweiz Arch Tierheilkd. 1996;138:121–124. [PubMed]
14. Schaller A, Djordjevic SP, Eamens GJ, et al. Identification and detection of Actinobacillus pleuropneumoniae by PCR based on the gene apxIVA. Vet Microbiol. 2001;79:47–62. [PubMed]
15. Dubreuil JD, Jacques M, Brochu D, Frenette M, Vadeboncoeur C. Surface location of HPr, a phosphocarrier of the phospho-enolpyruvate: Sugar phosphotransferase system in Streptococcus suis. Microbiology. 1996;142:837–843. [PubMed]
16. Gottschalk M, Altman E, Charland N, De Lasalle F, Dubreuil JD. Evaluation of a saline boiled extract, capsular polysaccharides and long-chain lipopolysaccharides of Actinobacillus pleuropneumoniae serotype 1 as antigens for the serodiagnosis of swine pleuropneumonia. Vet Microbiol. 1994;42:91–104. [PubMed]
17. Gottschalk M, Altman E, Lacouture S, De Lasalle F, Dubreuil JD. Serodiagnosis of swine pleuropneumonia due to Actinobacillus pleuropneumoniae serotypes 7 and 4 using long-chain lipopolysac-charides. Can J Vet Res. 1997;61:62–65. [PMC free article] [PubMed]
18. Smith HE, Veenbergen V, van der Velde J, Damman M, Wisselink HJ, Smits MA. The cps genes of Streptococcus suis serotypes 1, 2, and 9: Development of rapid serotype-specific PCR assays. J Clin Microbiol. 1999;37:3146–3152. [PMC free article] [PubMed]
19. Okwumabua O, O’Connor M, Shull E. A polymerase chain reaction (PCR) assay specific for Streptococcus suis based on the gene encoding the glutamate dehydrogenase. FEMS Microbiol Lett. 2003;218:79–84. [PubMed]
20. Baele M, Chiers K, Devriese LA, et al. The gram-positive tonsillar and nasal flora of piglets before and after weaning. J Appl Microbiol. 2001;91:997–1003. [PubMed]
21. Møller K, Andersen LV, Christensen G, Kilian M. Optimalization of the detection of NAD dependent Pasteurellaceae from the respiratory tract of slaughterhouse pigs. Vet Microbiol. 1993;36:261–271. [PubMed]
22. Brisebois LM, Charlebois R, Higgins R, Nadeau M. Prevalence of Streptococcus suis in four to eight week old clinically healthy piglets. Can J Vet Res. 1990;54:174–177. [PMC free article] [PubMed]
23. Marois C, Bougeard S, Gottschalk M, Kobisch M. Multiplex PCR assay for detection of Streptococcus suis species and sero-types 2 and 1/2 in tonsils of live and dead pigs. J Clin Microbiol. 2004;42:3169–3175. [PMC free article] [PubMed]
24. Higgins R, Gottschalk M. Distribution of Streptococcus suis capsular types in 2000. Can Vet J. 2001;42:223. [PMC free article] [PubMed]
25. Berthelot-Hérault F, Morvan H, Kéribin AM, Gottschalk M, Kobisch M. Production of muraminidase-released protein (MRP), extracellular factor (EF) and suilysin by field isolates of Streptococcus suis capsular types 2, 1/2, 9, 7 and 3 isolated from swine in France. Vet Res. 2000;31:473–479. [PubMed]
26. Smart NL, Miniats OP, Rosendal S, Friendship RM. Glasser’s disease and prevalence of subclinical infection with Haemophilus parasuis in swine in southern Ontario. Can Vet J. 1989;30:339–343. [PMC free article] [PubMed]
27. Smart NL, Miniats OP, MacInnes JI. Analysis of Haemophilus parasuis isolates from southern Ontario swine by restriction endonuclease fingerprinting. Can J Vet Res. 1988;52:319–24. [PMC free article] [PubMed]
28. Mittal KR, Higgins R, Larivière S, Nadeau M. Serological characterization of Actinobacillus pleuropneumoniae strains isolated from pigs in Quebec. Vet Microbiol. 1992;32:135–148. [PubMed]
29. Levonen K, Seppänen J, Veijalainen P. Antibodies against 12 sero-types of Actinobacillus pleuropneumoniae in Finnish slaughter sows. Zentralbl Veterinarmed B. 1996;43:489–495. [PubMed]
30. Dubreuil JD, Jacques M, Mittal KR, Gottschalk M. Actinobacillus pleuropneumoniae surface polysaccharides: Their role in diagnosis and immunogenicity. Anim Health Res Rev. 2000;1:73–93. [PubMed]
31. Devenish J, Rosendal S, Bossé JT, Wilkie BN, Johnson R. Prevalence of seroreactors to the 104-kilodalton hemolysin of Actinobacillus pleuropneumoniae in swine herds. J Clin Microbiol. 1990;28:789–791. [PMC free article] [PubMed]
32. Hariharan H, Cepica A, Qian B, Heaney S, Hurnik D. Toxigenic and drug resistance properties of porcine Pasteurella multocida isolates from Prince Edward Island. Can Vet J. 2000;41:798. [PMC free article] [PubMed]
33. Jamaludin R, Blackall PJ, Hansen MF, Humphrey S, Styles M. Phenotypic and genotypic characterisation of Pasteurella multocida isolated from pigs at slaughter in New Zealand. N Z Vet J. 2005;53:203–207. [PubMed]

Articles from Canadian Journal of Veterinary Research are provided here courtesy of Canadian Veterinary Medical Association
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...