• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of jbtJBT IndexAssociation Homepage
J Biomol Tech. Sep 2005; 16(3): 239–247.
PMCID: PMC2291727

Optimization of in Vitro Transcription and Full-Length cDNA Synthesis Using the T4 Bacteriophage Gene 32 Protein

Abstract

We evaluated the effect of the T4 bacteriophage gene 32 protein (T4gp32) on in vitro transcription and reverse transcription. T4gp32 doubled the yield of in vitro transcripts obtained with T7 RNA polymerase and increased the yield of cDNA synthesis when used in combination with an RNaseH-deficient Moloney murine leukemia virus [Au: ok] reverse transcriptase. The positive effect could be correlated with the RNA chaperone activity of T4gp32. T4gp32 stimulated the synthesis of long cDNAs, particularly species longer than 7 kb. By comparison, thermal activation of reverse transcriptase with trehalose only boosted the production of shorter cDNAs. For the construction of an Arabidopsis thaliana cDNA library, where the average cDNA size is 1.2 kbp, both the presence of T4gp32 under standard reaction conditions as well as thermal activation resulted in similarly high percentages of full-length cDNA. However, the inclusion of T4gp32 in a standard reverse transcription reaction resulted in the highest cDNA yield. We conclude that the addition of T4gp32 in standard reverse transcription reactions can increase the quality and yield of full-length cDNA libraries.

Keywords: Reverse transcription, full-length cDNA, T4gp32, CAP trapper

The availability of full-length cDNA libraries greatly facilitates the rapid analysis of gene functions. In standard cDNA libraries, the percentage of full-length cDNAs has been estimated to be around 30%.1 Most of the partial cDNAs arise from the blockage of the reverse transcriptase (RT) at a hairpin or another structured region of the mRNA template.2 Recently, full-length cDNAs libraries have been constructed using trehalose to thermoactivate the RT, allowing the RT reaction to be performed between 50°C and 60°C.3;4 Point-mutated avian myeloblastosis virus (AMV) RT with no RNase H activity and a high temperature optimum is also commercially available now and has been successfully employed in reverse transcriptase polymerase chain reaction (RT-PCR) and 5′–RACE (rapid amplification of cDNA ends) with highly structured mRNA templates that could not be reverse transcribed under standard conditions.5

Unfortunately, although high temperature contributes to resolving secondary structures of RNA, it also augments the breakdown of RNA, which is thermolabile and susceptible to metal-catalyzed degradation. Since reverse transcriptases have an absolute requirement for divalent cations, significant RNA degradation can occur by incubation in RT buffer at a temperature higher than 55°C.6

In living cells, RT copes with hairpins and stably folded RNA templates with the help of RNA chaperones. All retroviruses described so far have an RNA chaperone, the nucleocapsid (NC) protein. The NC protein acts as an essential accessory protein at many steps of the retrovirus’ life cycle including the dimerization of viral RNA, the formation of primer tRNA:viral template hybrid, strand transfer steps after the initiation of reverse transcription, and the removal of hairpins in RNA templates during reverse transcription. NC proteins are small, highly basic proteins that bind viral RNA at high affinity, and other RNA at lower affinity. They act as RNA chaperones (reviewed in ref. 7). However, the strong sequence preference of retroviral NC proteins for their respective long-terminal repeats RNA8 restrains the usefulness of these chaperones for cDNA library construction.

In contrast, T4gp32 shows very little if any sequence preference. The requirement of T4gp32 for bacteriophage replication and its implication in many steps of the bacteriophage life cycle is reminiscent of the functions associated with the retroviral NC proteins.9 Since its isolation, T4gp32 has been extensively studied as a single-stranded (ss) DNA binding protein necessary for T4 bacteriophage replication (reviewed in ref. 10). During replication, T4gp32 molecules cooperatively bind ssDNA dissociated by T4 helicase. The relatively low affinity of the chaperone for DNA allows it to slide along the DNA strands, generating unstructured ssDNA while the following T4 polymerase advances over the DNA template.11

T4gp32 has been used as a molecular tool to enhance numerous enzymatic reactions including PCR,12,13 sequencing,14 reverse transcription in RT-PCR,15 and cDNA synthesis.16 The effect of T4gp32 directly on RT, however, has so far not been studied and has only been observed after PCR amplification.

We hypothesized that T4gp32 could improve reverse transcription by preventing the formation of hairpins and other structures commonly found in mRNA templates, thus increasing full-length cDNA synthesis. In this report, we evaluate the effect of T4gp32 on the reverse transcription of a population of five polyadenylated RNAs ranging in size from 1.3 to 9.5 kb as well as on mRNA isolated from Arabidopsis thaliana. We also compare the efficacy of full-length cDNAs synthesis when performed either in the presence of T4gp32, or at elevated temperatures, using both trehalose-thermostabilization and heat-stable reverse transcriptase.

MATERIALS AND METHODS

Reagents, Bacterial Strains, and Plasmids

Chemical reagents and oligos [SfiB-dT (ATTCTAGAGGCCGCCTCGGCCGTGCAG T(22)vn) and SfiC-C11 (CACACACACACACACAGGCCATTTAGGCCGTGCAGC(11))] were purchased from Sigma Aldrich and Sigma Genosys, respectively, (Oakville, ON, Canada). Restriction enzymes were from New England Biolabs (Missisauga, ON, Canada). Taq polymerase, terminal transferase, T4 DNA ligase and some restriction enzymes were from Fermentas (Burlington, ON, Canada). Bacterial strain DH5_ FT, reverse transcriptase Superscript II, Thermoscript, 0.24–9.5 kb polyadenylated RNA ladder, rNTPs, and dNTPs were purchased from Invitrogen (Burlington, ON, Canada). Proteinase K, Streptavidin-coated paramagnetic particles, High Pure spin columns, T4gp32, bovine serum albumin, glycogen, plasmid pHelix 1(+) were from Roche Diagnostics (Laval, QC, Canada). RNase ONE, Riboprobe in vitro transcription kit, m7GTP cap analog were from Promega (Madison, WI). MEGAscript T7 in vitro transcription kit was from Ambion (Austin, TX). ExTaq was purchased from TaKaRa (Fisher Scientific, Ottawa, ON, Canada). ImageQuant software, Phosphorscreen and 32P nucleotides were from Amersham Biosciences (Baie d’Urfé, QC, Canada). Plasmid pHelix1(+) was modified to give pHSX-Ci by inserting an adapter between the Eco RI and Kpn I site which contains two Sfi I sites, ggccgcctcggcc (Sfi I-B) and ggccatttaggcc (Sfi I-C) to accommodate directional cloning of cDNA inserts.

RNA Binding Assay

An increasing amount of T4gp32 (0.04 μM, 0.2 μM, 1 μM, 5 μM), or 166 μg/mL bovine serum albumin for the negative control reaction, was added to approximately 100 ng of heat-denatured, radiolabeled 1.89 kb RNA transcript in 15 μL reactions containing 10 mM Tris pH 8.0, 1 mM EDTA, 50 mM KCl, 7.4% glycerol, and incubated for 10 minutes at room temperature. 2.2 μL loading dye (40% sucrose, Xylene Cyanol, Bromophenol Blue) were added to each reaction before loading on a 6 cm long, 4% acrylamide:bisacrylamide gel that had been previously pre-run for 20 minutes at 100V and cooled to 4°C. Electrophoresis was for 3 hours at 100V. The RNA was visualized with a Phosphor Imager.

In Vitro Transcription

A radiolabeled 1.89 kb RNA transcript was synthesized from the pTRI-Xef positive control DNA provided with the MEGAscript T7 in vitro transcription kit and resulted in the 1.89 kb, polyadenylated RNA containing the Xenopus elongation factor 1α gene (GeneBank Acc. no. BC041196). Typically, in vitro transcription was performed on 0.5–1 μg linearized DNA template in a 20-μL reaction using the Riboprobe in vitro transcription system according to the manufacturer’s instructions. The 1.89 kb RNA was further purified on a denaturing poly-acrylamide gel as described in Sambrook and Russel.2 As a positive control for CAP trapper experiments, a 1.3-kb capped RNA was synthesized from a maize cDNA clone containing a poly A-tailed homolog of a putative protein phosphatase (GeneBank Acc. No. AY112251.1), using the T3 Riboprobe in vitro transcription system. The 20-μL reaction contained 1 μg of linearized DNA template, 0.5 mM of each rATP, rUTP and rCTP, 0.05 mM rGTP, 0.5 mM of Ribo m7G Cap Analog, 20 units of T7 RNA polymerase, buffer and dithiothreitol as recommended by the supplier. The reaction was incubated for 2 hours at 37°C. The ratio of 10:1 of cap analog to rGTP is expected to result in over 90% of transcripts that are capped.

Reverse Transcription Assays

In the first assay, the 0.24–9.5 kb polyadenylated RNA ladder was used as template for reverse transcription. Briefly, 200 ng template and 50 pmole SfiB-dT primer were heat-denatured for 2 min at 65°C and quickly cooled on ice. T4gp32 (final conc. 0.12, 0.6, and 3 μM), was added and the mix incubated for 5 min at room temperature before addition of the RT mix (final 1 X Superscript II buffer, 10 mM dithiothreitol, 1 mM dNTPs, 1 μL 32P(dCTP) (3000 Ci/mmole), 100 units Superscript II) and incubated for 15 min at 37°C. The RT was stopped by the addition of ethylenediaminetetraacetic acid to 10 mM, sodium dodecyl sulfate (0.2%) and Proteinase K (70 μg/mL) in a total volume of 200 μL. The reaction was incubated for 15 min at 45°C before phenol:chloroform:isoamyl (24:24:2) extraction and alcohol precipitation with 5 μg of glycogen. The radioactive pellet was resuspended in 10 μL water. A 3-μL aliquot was loaded on a 1% alkaline agarose gel which was run at 100 mA until the bromophenol blue reached two-thirds of the length of the gel, fixed in 10% trichloroacetic acid, dried and exposed to a Phosphorscreen. The volume of each band was quantified with the ImageQuant software after correcting the background using the local median.

In the second assay, two RT reactions were assembled as described above except that one contained 4.5 μM T4gp32 and the other 23% trehalose. The reaction containing trehalose was placed in a thermocycler programmed to cycle five times between 60°C (10 sec) and 50°C (5 min). The reaction containing T4gp32 was split in two: one half was incubated as described for the first assay, and the other half was incubated as described for the second assay. The completed reactions were processed as described above.

Full-Length cDNA Library Production Using the CAP Trapper Method

Six tubes, each containing 1 μg of A. thaliana mRNA, isolated as described elsewhere,17 and 180 pmoles of SfiB-dT primer in a total volume of 4 μL, were placed at 65°C for 5 min then immediately cooled on ice. Three micrograms of T4gp32 were added on ice to tubes 2, 4 and 6. Reactions 1 and 2 were reverse transcribed with 100 units of Superscript II (Invitrogen) in a 20-μL reaction containing 1X Superscript II buffer, 10 mM dithiothreitol, 0.5 mM dNTPs and 1 μL 32P(dCTP). Reactions 3 and 4 were reverse transcribed with the same mix as 1 and 2, plus 23% trehalose. Reactions 5 and 6 were reverse transcribed with 1 μL of Thermoscript in 20 μL reaction volume. Reactions 1 and 2 were incubated for 40 min at 45°C. Reactions 3 to 6 were assembled at 45°C, then immediately transferred to a thermocycler pre-heated to 60°C and programmed to cycle five times between 60°C 10 sec) and 50°C (5 min). The entire routine took 40 min. All the reactions were stopped at the same time and treated with Proteinase K as described above. The efficiency of the reverse transcription was evaluated by counting 0.05 volumes of the resuspended first strand cDNA in 5-mL scintillation cocktail.

The CAP trapper method was performed as described elsewhere.18 The captured RNA:cDNA duplexes were eluted by a 5-min incubation at room temperature in 200 μL 0.2 M NaOH then ethanol precipitated. Both the supernatant and eluate fractions were loaded on an alkaline 1% agarose gel as described above. The volume of each cDNA smear was quantified with the Image Quant software after correcting the background using the local object feature.

Two controls were performed in parallel with the RT samples. The positive control template was a capped, polyadenylated 1.3 kb in vitro transcript, reverse transcribed and CAP trapped in the same conditions as the RT reaction 1. As a negative control, we reverse transcribed with RT condition 1, and CAP trapped the 0.24–9.5 kb RNA ladder in which the RNA fragments are polyadenylated but uncapped. For both controls, we quantified the CAP trapped and the non-trapped fractions using the ImageQuant software as we did for samples 1 to 6.

RT condition 2 was scaled up in order to build an A. thaliana full-length cDNA library. Ten micrograms mRNA was used as starting material. RT was performed as described above in the presence of 1 nmole SfiB-dT primer and 20 μg T4gp32, in a total volume of 40 μL. CAP trapping was performed exactly as described above. The CAP trapped, full-length, enriched first strand cDNA was dG-tailed in presence of 0.1 mM dGTP, 1X TdT buffer, and 40 Units Terminal transferase in a total volume of 20 μL for 15 min at 37°C. After phenol:chloroform extraction and ethanol precipitation, the cDNA pellet was resuspended in 20 μL H2O and rendered double-stranded with 10 Units ExTaq thermostable polymerase in 1X ExTaq buffer, 1 μM SfiC-C11 primer and 0.125 mM dNTPs in a total volume of 100 μL. The reaction was incubated in a thermocycler (Biometra, Montreal, QC, Canada) for 2 min at 95°C, 30 min at 68°C, and 10 min at 72°C. After ethanol precipitation and resuspension in 40 μL H2O, cDNA was digested with 100 Units Sfi I in a 100-μL reaction for 3 h at 50°C. The cDNA was size fractionated on a CL-4B column equilibrated in STE buffer as described elsewhere.2 Fractions containing cDNA greater than 0.3 kbp were pooled, precipitated, and ligated into pHSX-Ci. The ligation mix was used to transform ultra-competent DH5α-FT cells. A library titer of 1.4 × 106 was obtained. A sample of 200 clones was sequenced from the 5′ end with a Li-Cor sequencer. Raw sequences were trimmed and submitted to a Mega BLAST (NCBI) analysis. Hits were analysed manually for the presence of the AUG start codon.

RESULTS

T4gp32 Binds to RNA and Relaxes Secondary Structures

A radiolabeled 1.89 kb in vitro transcript was used as template. The 1.89 kb RNA alone migrated as a sharp band on a denaturing gel (Fig. 1A1A),), but as a smear on a native polyacrylamide gel (Fig. 1B1B,, lane 1). The presence of bovine serum albumin at 166 μg/mL (Fig. 1B1B,, lane 2) or T4gp32 at the lowest concentration tested (0.04 and 0.2 μM, lanes 3 and 4) did not alter the migration pattern of this RNA. However, at a T4gp32 concentration of 1 μM, and even more at 5 μM, the RNA smear was compressed into a sharper, slower migrating cluster of bands, presumably resulting from the relaxation of secondary RNA structures (Figure 1B1B,, lanes 5, 6).

FIGURE 1
T4gp32 binds and denatures RNA. A: 1.89-kb radiolabeled in vitro transcript, run on a 4% acrylamide: bisacrylamide (30:1)/7 M urea gel. B: Native polyacrylamide gel electrophoresis of the same in vitro transcript, free (lane 1), incubated with bovine ...

T4gp32 Activates Both In Vitro and Reverse Transcription

The effect of T4gp32 on in vitro transcription (Figure 2A2A)) and on reverse transcription (Figure 2B2B)) was evaluated. No significant effect was observed at the lower concentrations of T4gp32 tested (0.12 and 0.6 μM). However, at a concentration of 3 μM, a positive effect was observed for both, the in vitro transcription (1.8–2-fold increase; n=2) of a 1.89 kb template and the reverse transcription (1.1–1.4-fold increase; n=4) of a 2.4 kb RNA template (Figure 2C2C)) Superscript II was used at 37°C instead of 42–45°C as recommended by the manufacturer, in order to exemplify the potential effect of the chaperone. We also repeated the same experiment with incubations at 42°C and 45°C, for 5 min to 1.5 hours, always with similar results (not shown).

FIGURE 2
T4gp32 activates both in vitro transcription and reverse transcription. A: 1.89-kb radiolabeled in vitro transcript synthesized in the presence of increasing amounts of T4gp32. The transcripts are resolved on a 4% acrylamide/7M urea gel. B: Alkaline agarose ...

Comparison of cDNA Synthesis Performed in Five Different RT Conditions

Figure 33 shows the comparison of five different RT reactions of an RNA ladder, composed of 5 poly-adenylated RNAs, devoid of secondary structures based on computer prediction (Vienna RNA folding procedure according to Zuker’s RNA folding method) using GeneQuest 5 (DNAStar) with a set temperature of 37°C, and ranging from 1.4 kb to 9.5 kb. The radiolabeled cDNAs synthesized under each condition are shown in Figure 3A3A;; a histogram of the size distribution of the cDNA resulting from each condition is shown in Figure 3B3B.. In this experiment, the only two factors that resulted in an increased synthesis of cDNA compared with the standard condition (lane 1) were the presence of T4gp32 at 45°C (1.3-fold overall stimulation, lane 2) and the trehalose stabilisation at 50–60°C (2-fold overall stimulation, lane 5). The stimulating effect of T4gp32 is more pronounced on longer cDNA products: 1.1-fold for the 1.4 kb band, 1.3-fold for the 2.2–7.5 kb bands and 1.7-fold for the 9.5 kb band. The combination of trehalose/high incubation temperature favoured the synthesis of all cDNAs, except the longer 9.5 kb product: a 2-fold increase for the cDNA bands below 7.5 kb, compared with a 1.7-fold increase for the 7.5 kb and a 0.3-fold increase for the 9.5 kb product. Incubation at a high cycling temperature (50–60°C) without the addition of trehalose clearly led to a reduced cDNA yield (lane 3) even in the presence of T4gp32 (lane 4). Similar observations were obtained in three independent experiments (not shown).

FIGURE 3FIGURE 3
cDNA synthesis using five different RT conditions. A: Radiolabeled first strand cDNA synthesized from a 0.24–9.5 kb RNA ladder in five different conditions: incubation at 45°C in standard RT buffer (lane 1); with 4.5 μM T4gp32 ...

Selection of a Full-Length cDNA Population by CAP Trapping

We tested the effect of T4gp32 on the first strand synthesis of A. thaliana mRNA using three alternative protocols. First, we reverse transcribed with Superscript II for 40 min at 45°C, in the absence (RT1) versus the presence (RT2) of T4gp32. Figure 4A4A shows the unbound and incomplete cDNA (−) fractions, as compared with the bound and full-length cDNA (+) fractions, for each RT condition. These results are visualized in the histogram presented in Figure 4B4B,, which shows the RT efficiency for each RT condition and the percentage of first-strand cDNA that was CAP trapped. The presence of T4gp32 had very little effect on the overall RT efficiency (RT1: 19.6% without T4gp32; RT2: 21.2% with T4gp32), but improved drastically the amount of full-length cDNA that was CAP trapped (from 26.6% without to 44.3% with T4gp32).

FIGURE 4FIGURE 4
A. thaliana full-length cDNA libraries made under different RT conditions. A: CAP trapping of 6 first-strand cDNA libraries: RT1 and RT2 were done with Superscript II at 45°C, RT3 and RT4 with trehalose thermostabilized Superscript II, and RT5 ...

In a second setup (RT3 and RT4), we tested the reverse transcriptase (Superscript II) thermostabilized with 23% trehalose. The RT reaction was carried out by cycling five times between 60°C (10 sec) and 50°C (5 min). This approach is comparable to what has been recommended elsewhere.3;4 The reaction efficiency was comparable to that obtained with RT1 and RT2: 21.2% without T4gp32, (RT3) and 19.2% with T4gp32, (RT4). Under these conditions, the presence of T4gp32 did not affect the population of CAP trapped cDNA (34.6% without and 35.1% with T4gp32).

In a third setup (RT5 and RT6), the reaction conditions were identical to that of RT3 and RT4, but a thermostable enzyme (Thermoscript) was used instead and trehalose was omitted from the reaction. The overall RT efficiency was lower (11.2% without, and 13.2% with T4gp32) than what was observed in RT1–4); however, the proportion of full-length cDNA was high, even in the absence of T4gp32 (41.7%, RT5), but did increase to 44.2% in the presence of T4gp32 (RT6).

The efficiency and specificity of the method was evaluated by analyzing the positive and negative controls. The CAP trapped positive control amounted to 50% of bound material (Fig. 4A4A,, lane 3). Most of the unbound cDNA was smaller, partial cDNA (Fig. 4A4A,, lane 2). Less than 5% of the negative control remained on the beads (not shown).

Both the RT efficiency (25%) and the proportion of CAP trapped cDNA (42%) achieved in the full-length cDNA library experiment were similar to that obtained for the small-scale reaction (Fig. 3A3A)) whereby the positive control was CAP trapped at 43% and less than 5% of the negative, uncapped control remained on the beads (not shown). The library titer was 1.4 × 106 cfu, with less than 1% background of vector colonies. The cDNA insert size averaged 1.5 kbp. The sequences of 200 expressed sequence tags (ESTs) from the RT2 library were subjected to a BLAST search using the NCBI A. thaliana database. Of these, 138 sequences matched with annotated complete coding sequences (cds), of which 93% had an AUG start codon. The average 5′ UTR length was 95 bp.

The CAP trapper selection of A. thaliana full-length cDNAs was repeated with Superscript III reverse transcriptase. A higher yield of cDNAs was achieved compared with Superscript II, but the percentage of CAP trapped full-length cDNA was similar (not shown). Other plant full-length cDNA libraries were also obtained with Superscript III, including one library from developing corn kernels and one library from developing wheat endosperm. In all cases, the presence of T4gp32 protein resulted in a CAP trapped selection of around 40% of the total cDNAs (not shown).

DISCUSSION

The addition of T4gp32 to in vitro transcription as well as to reverse transcription reactions led to an increase in product quantity compared with standard reactions. This stimulation was observed at a T4gp32 concentration of 3 to 4.5 μM, which is in the range of the minimal concentration required for cooperative binding in vitro.19 The effect of T4gp32 in RT reactions correlates well with its effect on RNA conformation, suggesting that T4gp32 exerts this mechanism through nucleic acid chaperone activity.

In the case of in vitro transcription, binding of T4gp32 to nascent RNA could lead to an increased template recycling. It has been shown recently, that E. coli ssDNA binding protein binds RNA newly synthesized by the bacteriophage N4 virion RNA polymerase (vRNAP), thus preventing it fromforming a stable RNA:DNA duplex with the DNA template. Such RNA-protein interaction is essential for template recycling because the vRNAP does not have any RNA binding domain, like T7 RNA polymerase does.20 Moreover, T7 in vitro transcription was shown to be enhanced by the binding of the E. coli cold shock protein A (CspA), an RNA chaperone, to the nascent transcript.21 A similar mechanism could take place with T4gp32.

In the case of reverse transcription, considerable evidence suggests that binding of T4gp32 to RNA increases full-length cDNA synthesis. Interaction of T4gp32 with four different components of the RT system is feasible:

  1. Binding to the RNA template. T4gp32-bound ssDNA or RNA adopt a linear, rope-like structure22 devoid of hairpins and other RNA structures susceptible to stop the RTase. In addition, the unstacking of bases that occurs at the T4gp32 binding site11 decreases misincorporation events, thus increasing enzyme fidelity, as has been observed for DNA polymerases.23;24 Since after a misincorporation, Moloney murine leukemia virus Moloney murine leukemia virus (MMLV) only resumes reverse transcription at about 50% of the time, it can be concluded that an increased fidelity of RTase would result in more full-length cDNA synthesis.25
  2. Binding to nascent CDNA. The association of T4gp32 to the newly synthesized cDNA may prevent it from forming a stable RNA:cDNA duplex which would then lead to an increased synthesis rate. The addition of MMLV nucleocapsid protein for instance, was found to speed the strand displacement synthesis up to two times.9
  3. Binding to SSDNA primer. T4gp32 binds ssDNA at a higher affinity than ssRNA. RNA chaperones have been shown to increase the speed and specificity of oligo annealing, thus increasing the turnover rate of the reaction.26
  4. Binding to reverse transcriptase. The cooperative binding of T4gp32 could also be attributed to its capacity to engage in protein-protein interactions. Interactions between the nucleocapsid (NC) protein and viral reverse transcriptase for instance, have been demonstrated.27 The structure of the very acidic COOH terminal domain of T4gp32 was shown to mimic DNA structure, which could explain its affinity for many DNA binding proteins involved in replication, recombination, repair, and late transcription.28 Because T7 RNA polymerase and MMLV reverse transcriptase both have such RNA binding domains, it seems reasonable to hypothesize that they can interact directly with T4gp32.

The comparison of the effects of heat and T4gp32 binding on reverse transcription led to the realization that, if both treatments increased the overall cDNA synthesis, their effects were qualitatively not the same. When a mix of five RNA templates ranging in size from 1.4 to 9.5 kb was reverse transcribed under elevated temperatures, a strong over-representation of the low- to medium-sized cDNAs and a diminished proportion of the very long cDNA (9.5 kb) could be observed. Similar results were reported when both trehalose and sorbitol were used to thermoactivate the reverse transcriptase.4 We interpret this as the consequence of increased reaction efficiency at high temperature, but coupled with an increased thermal degradation of the RNA template. In contrast, T4gp32 binding tended to counterbalance the size bias observed in cDNA synthesis. As a result, the cDNA population synthesized in the presence of T4gp32 better reflects the actual size distribution of the mRNA population

In addition to the structured RT experiments with defined RNA templates, we also evaluated the usefulness of T4gp32 in full-length cDNA library production. We observed that the efficiency of reverse transcription of an mRNA population is somewhat dependent on the type of reverse transcriptase used, but is not influenced much by the presence of T4gp32 since the average size of an A. thaliana cDNA is only 1.2 kbp, and the largest cDNA isolated so far from that plant is 7.5 kbp.29 The amount of CAP trapped cDNA, however, was clearly larger in the presence of T4gp32 than in the standard reaction, reflecting perhaps a higher degree of secondary structures in the population than in the controlled experiment. In our experiments, the maximal proportion of cDNA that was CAP trapped was around 45%. This result was achieved in a standard reaction with T4gp32 at 45°C as well as in RT reactions at elevated temperatures using a thermostable enzyme with and without T4gp32. The effect of T4gp32 was pronounced at 45°C, but almost not noticeable at 50–60°C. A comparison of the two best conditions revealed that both reactions produced a comparative proportion of full-length cDNAs, but the standard reaction with T4gp32 gave more cDNA products.

Altogether, these data indicate that T4gp32 has a positive effect on in vitro transcription reactions as well as on the reverse transcription of mRNAs. This could represent a significant improvement for the production of full-length cDNA libraries, in particular mammalian cDNA libraries, where the average cDNA size is considerably larger than in plants.

Acknowledgments

This work was entirely funded by the Canadian Crops Genomics Initiative. We would like to thank Hélène Rocheleau and Titus Tao for helpful assistance. The helpful discussions of this work with Dr. Laurian Robert and Dr. David Wilkinson are gratefully acknowledged.

REFERENCES

1. Sugahara Y, Carninci P, Itoh M, et al. Comparative evaluation of 5′-end-sequence quality of clones in CAP trapper and other full-length-cDNA libraries. Gene 2001; 263:93–102. [PubMed]
2. Sambrook J, Russel DW. Molecular Cloning, a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001.
3. Carninci P, Nishiyama Y, Westover A, et al. Thermostabilization and thermoactivation of thermolabile enzymes by trehalose and its application for the synthesis of full length cDNA. Proc Natl Acad Sci USA 1998;95:520–524. [PMC free article] [PubMed]
4. Carninci P, Shiraki T, Mizuno Y, Muramatsu M, Hayashizaki Y. Extra-long first-strand cDNA synthesis. BioTechniques 2002;32:984–985. [PubMed]
5. Demeke T, Morris F. Molecular characterization of wheat polyphenol oxidase (PPO). Theor Appl Genet 2002;104:813–818. [PubMed]
6. Das M, Harvey I, Chu LL, Sinha M, Pelletier J. Full-length cDNAs: More than just reaching the ends. Physiol Genomics 2001;6:57–80. [PubMed]
7. Rein A, Henderson LE, Levin JG. Nucleic-acid-chaperone activity of retroviral nucleocapsid proteins: Significance for viral replication. TIBS 1998;23:297–301. [PubMed]
8. Darlix J-L, Lapadat-Tapolsky M, de Rocquigny H, Roques BP. First glimpses at structure-function relationships of the nucleocapsid protein of retroviruses. J Mol Biol 1995;254:523–537. [PubMed]
9. Kelleher CD, Champoux JJ. Characterization of RNA strand displacement synthesis by Moloney murine leukemia virus reverse transcriptase. J Biochem Chemistry 1998;273:9976–9986. [PubMed]
10. Alberts B, Sternglanz R. Recent excitement in the DNA replication problem. Nature 1977;269:655–661. [PubMed]
11. Shamoo Y, Friedman AM, Parsons MR, Konigsberg WH, Steitz TA. Crystal structure of a replication fork single-stranded DNA binding protein (T4 gp32) complexed to DNA. Nature 1995;376:362–366. [PubMed]
12. Tebbe CC, Vahjen W. Interference of humic acids and DNA extracted directly from soil in detection and transformation of recombinant DNA from bacteria and a yeast. Appl Environ Microbiol 1993;59:2657–2665. [PMC free article] [PubMed]
13. Schwartz K, Hansen-Hagge T, Bartram C. Improved yields of long PCR products using gene 32 protein. Nucleic Acids Res 1990;18:1079. [PMC free article] [PubMed]
14. Kaspar P, Zadrazil S, Fabry M. An improved double stranded DNA sequencing method using gene 32 protein. Nucleic Acids Res 1989;17:3616. [PMC free article] [PubMed]
15. Chandler DP, Wagnon CA, Bolton H. Reverse transcriptase (RT) inhibition of PCR at low concentrations of template and its implication for RT-PCR. Appl Environ Microbiol 1998;64:669–677. [PMC free article] [PubMed]
16. Villalva C, Touriol C, Seurat P, Trempat P, Delsol G, Brousset P. Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system. BioTechniques 2001;31:81–86. [PubMed]
17. Piché C, Schernthaner J. Background priming during reverse transcription by oligo(dT) carried over from mRNA isolation. BioTechniques 2003;34:720–724. [PubMed]
18. Carninci P, Hayashizaki Y. High-efficiency full-length cDNA cloning. Methods Enzymol 1999;303:19–44. [PubMed]
19. Bittner M, Burke RL, Alberts BM. Purification of the T4 gene 32 protein free from detectable deoxyribonuclease activities. J Biochem Chemistry 1979;254:9565–9572. [PubMed]
20. Davydova E, Rothman-Denes LB. Escherichia coli single-stranded DNA-binding protein mediates template recycling during transcription by bacteriphage N4 virion RNA polymerase. Proc Natl Acad Sci USA 2003; 100:9250–9255. [PMC free article] [PubMed]
21. Bae W, Xia B. Inouye M, Severinov K. Escherichia coli CspA-family RNA chaperones are transcription antiterminators. Proc Natl Acad Sci USA 2000;97:7784–7789. [PMC free article] [PubMed]
22. Delius H, Mantell NJ. Characterization by electron microscopy of the complex formed between T4 bacteriophage gene 32-protein and DNA. J Mol Biol 1972; 67:341–350. [PubMed]
23. Topal MD, Sinha NK. Products of bacteriophage T4 genes 32 and 45 improve the accuracy of DNA replication in vitro. J Biochem Chemistry 1983;258:12274–12279. [PubMed]
24. Sandhu DK, Keohavong P. Effects of the T4 bacteriophage gene 32 product on the efficiency and fidelity of DNA amplification using T4 DNA polymerase. Gene 1994;144:53–58. [PubMed]
25. Fu GK, Stuve LL. Improved method for the construction of full-length enriched cDNA libraries. BioTechniques 2003;34:954–957. [PubMed]
26. Herschlag D. RNA chaperones and the RNA folding problem. J Biochem Chemistry 1995;270:20871–20874. [PubMed]
27. Druillennec S, Canneparo A, de Rocquigny H, Roques BP. Evidence of interactions between the nucleocapsid protein NCp7 and the reverse transcriptase of HIV-1. J Biochem Chemistry 1999;274:11283–11288. [PubMed]
28. Boltrek Krassa K, Green LS, Gold L. Protein-protein interactions with the acidic COOH terminus of the single-stranded DNA-binding protein of the bacteriophage T4. Proc Natl Acad Sci USA 1991;88:4010–4014. [PMC free article] [PubMed]
29. Seki M, Carninci P, Nishiyama Y, Hayashizaki Y, Shinozaki, K. High-efficiency cloning of Arabidopsis full-length cDNA by biotinylated CAP trapper. Plant J 1998;15:707–720. [PubMed]

Articles from Journal of Biomolecular Techniques : JBT are provided here courtesy of The Association of Biomolecular Resource Facilities

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...