• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of immunologyLink to Publisher's site
Immunology. May 2007; 121(1): 113–121.
PMCID: PMC2265927

Evolution of mammalian CD1: marsupial CD1 is not orthologous to the eutherian isoforms and is a pseudogene in the opossum Monodelphis domestica

Abstract

CD1 is a member of the major histocompatibility complex (MHC) class I family of proteins that present lipid antigens to T cells and natural killer (NK) T cells; it is found in both eutherian mammals and birds. In eutherians, duplication of the CD1 gene has resulted in multiple isoforms. A marsupial CD1 homologue was identified in a set of expressed sequence tags from the thymus of the bandicoot Isoodon macrourus. Southern blot and genomic sequence analyses revealed that CD1 is a single copy gene in both I. macrourus and a distantly related marsupial, the opossum Monodelphis domestica, which is currently the only marsupial species for which a whole genome sequence is available. We found that the opossum CD1 is located in a genomic region with a high degree of conserved synteny to the chromosomal regions containing human and mouse CD1. A phylogenetic analysis of mammalian CD1 revealed that marsupial CD1 is not orthologous to the eutherian CD1 isoforms, consistent with the latter having emerged by duplication after the separation of marsupials and eutherians 170–180 million years ago. The I. macrourus CD1 gene is actively transcribed and appears to encode a functional protein. In contrast, transcription of the M. domestica CD1 was not detected in any tissue and the predicted CD1 gene sequence contains a number of deletions that appear to render the locus a pseudogene.

Keywords: CD1, evolution, marsupial, pseudogene

Introduction

CD1 is a member of the major histocompatibility complex (MHC) class I family of glycoproteins that are responsible for the presentation of lipid antigens to T cells and natural killer (NK) T cells.1 CD1 homologues have been characterized in several eutherian (placental) mammals and in chickens and, hence, are an ancient MHC non-classical class I lineage. In eutherians there are five CD1 isoforms (CD1a to CD1e) and species can vary in which isoforms they have or use. Humans express all five isoforms, whereas cattle express only CD1a, CD1b and CD1e, and rodents only express CD1d (reviewed in ref. 2). In some cases there are multiple functional gene copies for each isoform. For example, mice have two CD1D genes and cattle have at least five CD1B loci.3,4 The chicken CD1 genes are not orthologous to any of the eutherian CD1 isoforms, hence the duplications that gave rise to CD1a to CD1e in eutherians occurred after the separation of birds and mammals, 310 million years ago.5 In chickens the CD1 genes are located with the MHC, consistent with their divergence from classical MHC class I genes while still being linked to the MHC.68 The eutherian CD1 genes, however, are located in one of the MHC paralogous regions, separate from the MHC proper.911

The eutherian CD1 isoforms are classified into three groups based on evolutionary relatedness and similar function.2 Group 1 contains CD1a, CD1b and CD1c, which are expressed primarily by antigen-presenting cells, including dendritic cells and B cells. CD1a, CD1b and CD1c present lipid antigens to T cells and are important components of the host defence against mycobacterial infections.1214 Group 2 includes CD1d as a single member and is the most divergent of the five eutherian isoforms; it has a broader distribution on lymphoid and myeloid lineage cells and on additional subsets of mouse thymocytes and T cells. CD1d presents lipid antigens to NK T cells and has been implicated in tumour surveillance, early host defence and autoimmunity.12 A number of ligands can be presented by CD1d to NK T cells, including bacterial glycolipids, tumour-derived phospholipids and glycolipids, and α-galactosylceramide, a glycolipid originally isolated from marine sponges because of its antitumour properties.15,16 CD1e is described as being an evolutionarily ‘intermediate’ form, more closely related to Group 1 than Group 2; it functions intracellularly, assisting lipid antigen loading into other CD1 molecules.17

Here we describe the characterization of CD1 genes in marsupials, a mammalian lineage that last shared a common ancestor with eutherians approximately 170–180 million years ago.1820 Earlier evidence for CD1 in marsupials includes a report that anti-human CD1a antibodies bind thymocytes from the bandicoot Isoodon macrourus.21 Here we describe an expressed sequence tag isolated from I. macrourus thymus encoding a CD1 homologue. Together these results are consistent with this species having at least one expressed CD1 form. We previously used the bandicoot sequence to identify a CD1 orthologue in the opossum Monodelphis domestica and showed that, as in eutherians, it maps outside the MHC.22,23 More detailed analyses of the marsupial CD1 genes and their expression are presented here. Both species have only a single CD1 and they are not orthologous to the eutherian CD1 isoforms. Hence the duplications that gave rise to CD1a through CD1e occurred after the eutherian–marsupial divergence. Furthermore, unlike in I. macrourus, the M. domestica CD1 locus appears to be a pseudogene, apparently leaving this species without a functional CD1.

Materials and methods

M. domesticawhole genome sequence

The whole genome of the South American opossum, M. domestica, has been sequenced by the Broad Institute of Harvard and MIT (Cambridge, MA). The current version, MonDom4·0 is available at GenBank (accession number AAFR03000000) and Ensembl (http://www.ensembl.org/Monodelphis_domestica/index.html). Using the blast algorithm24 the bandicoot CD1 cDNA sequence was used to identify genomic sequence corresponding to exons 2, 3 and 4 of the opossum CD1 gene. These sequences correspond to co-ordinates 2:168363605–168357278 in the MonDom4·0 assembly. GenScan was used to confirm the predicted coding segments of the opossum CD1 sequence.25 To confirm the presence of a non-canonical splice site at the predicted start of exon 3 of CD1 in the whole genome sequence, a 1184-base-pair (bp) polymerase chain reaction (PCR) product spanning exon 2, intron 3 and exon 3 was amplified from M. domestica genomic DNA using primers corresponding to exon 2 (5′-CCCATACCAACAGACCTCGACTTTC-3′) and exon 3 (5′-GGACTGCCCTTGCAACTCAGTGTCT-3′) using High Fidelity Taq (BD Biosciences Clontech, Palo Alto, CA) following the manufacturer's recommended PCR conditions.

cDNA libraries and RT-PCR

The cDNA libraries and I. macrourus expressed sequence tag project are described elsewhere.26 For reverse transcription (RT)-PCR, total RNA was extracted by Trizol extraction (Invitrogen, Carlsbad, CA) following the manufacturer's recommended protocols. RNA was treated with TURBO DNA-free (Ambion, Austin, TX) to remove contaminating DNA. Reverse transcription was performed on total RNA from thymus and spleen using the GeneAmp RNA PCR Core Kit (Applied Biosystems, Foster City, CA). The primers used for the I. macrourus CD1 mRNA were an exon 2 forward primer (5′-TGCAAGACTTTGCTAAGGTC-3′) and an exon 3 reverse primer (5′-CCTTTGTCTAGAAGTCCATC-3′). The primers used for the M. domestica CD1 mRNA were an exon 2 forward primer (5′-CCCATACCAACAGACCTCGACTTTC-3′) paired with an exon 3 reverse primer (5′-CCTTTGTCTAGAAGTCCATC-3′). The exon 2 forward primer and an exon 3 forward primer (CTATGCCCCAGCATCCCCTCGAGAC) were also each paired with an exon 4 reverse primer (GCTACCAAGACTACTGTGTT). Actin primers (GGTTCAGGTGTCCAGAGGCC forward primer and CCAGGGCTGTGATTTCTTTTTG reverse primer) were used as a positive control for all RT-PCR. All reactions were carried out using High Fidelity Taq (BD Biosciences Clontech) following the manufacturer's recommended PCR conditions. Sequencing reactions were analysed on either a Perkin-Elmer ABI Prism 377 or a 3100 automated DNA sequencer. Chromatograms were analysed using Sequencher 4·6 (Gene Codes, Ann Arbor, MI).

Southern blots

Oligonucleotides were designed based on exon 4 of I. macrourus CD1 (5′-TAGGCCAGATATCTGGTTGT-F and 5′-TGGCCCAGTATCGAATAAGG-R) and used to amplify a fragment of the I. macrourus CD1 cDNA clone (T004A10) using 2 mm MgCl2, at an annealing temperature of 55° using Taq polymerase (Perkin Elmer, Foster City, CA) following the manufacturer's recommended protocol. The 180-bp PCR product was excised from an agarose gel, gel-purified (QIAQuick Gel Extraction Kit, Qiagen, Valencia, CA) and used to probe the I. macrourus Southern blot. The probe was labelled with [32P]dCTP by the random-prime-It RmT labelling kit (Stratagene, La Jolla, CA). Southern blots were made using I. macrourus and M. domestica genomic DNA cut with the restriction endonucleases shown in Fig. 2 following the manufacturer's recommended conditions. Digested DNA was electrophoresed through a 1·0% agarose gel and transferred to reinforced nitrocellulose (Micron Separations, Westborough, PA). The Southern blot was hybridized at 42° in 50% formamide, 5 × Denhardt's solution, 5 × sodium saline citrate, 50 mm NaPO4 (pH 6·5), 0·1% sodium dodecyl sulphate, 5 mm ethylenediaminetetraacetic acid and 250mg/ml sheared salmon sperm DNA. Final washes were performed at 65° in 0·2 × sodium saline citrate and filters were autoradiographed at −80° for 1–4 days.

Figure 2
Determination of the number of CD1 loci in I. macrourus by Southern blot analysis. Genomic DNA was digested with the indicated restriction enzymes and probed with fragments corresponding to exon 4 of the I. macrourus CD1.

Phylogenetic analysis

Sequences were aligned using either the Clustal X program27 with minor manual adjustments or the Clustal W function bundled within BioEdit.28 Phylogenetic tree reconstructions based on nucleotide alignments were carried out using the neighbour-joining, maximum parsimony and minimum evolution methods using the Mega 3·1 program.29 Nucleotide alignments were gapped by first aligning the amino acid translations to establish codon position, then converting the sequence back to nucleotides. To confirm branching order, 1000 bootstrap replicates were performed in all analyses. Accession numbers are as follows: CD1: Bandicoot: CD1, DQ924533; Chicken: CD1-1, AAX49405; CD1-2, AAX49406; Human: CD1A, AAH31645; CD1B, AAI04217; CD1C, NP_001756; CD1D, NP_001757; CD1E, CAI10863; Guinea pig: CD1B1, AAF12738; CD1C1, AAF12742; CD1E, AAF12745; Rhesus monkey: CD1E, AAM21923; Mouse: CD1-D1, NP_031665; CD1-D2, NP_031666; Sheep: CD1B, CAA85360; CD1D, CAA07200; Pig: CD1A, NP_998996; Rabbit: CD1A1, AAG39377; CD1B AAG39379; CD1E, AAG39380; Rat: CD1D, NP_058775; MHC class I: Human: HLA-A, AAA03603; HLA-B, AAA92563; HLA-Cw, AAA92994; HLA-G, CAI18721; Mouse: MumuKb, P01901; Rat: RatRT1, CAE93928; Opossum: Modo-UA1, AF125540; Modo-UG, DQ138606; Brushtail possum: Trvu-UB, AF359509; Red-necked wallaby: Maru-UB01, L04952; Bandicoot, DQ927302; FcRN: Brushtail possum FcRN, AF191647; Human FcRN, AF220542.

Determination of hydrophobicity values

The marsupial, eutherian and chicken CD1 genes, as well as class I genes from M. domestica and other eutherian mammals, were aligned using Clustal X.27 The residues in the α1 and α2 helices that contribute to the antigen-binding pocket of CD1 and MHC class I molecules were identified based on human and mouse CD1 sequences.30 The hydropathy index for all amino acids in the A, F and C pockets and the tunnel region T and for the A and F pockets treated separately were summed to determine the hydropathy index for each molecule.31

Results

A CD1 homologue was identified among a set of thymus expressed sequence tag sequences from the Northern brown bandicoot, I. macrourus (clone T004A10). This bandicoot CD1 clone was 1868 bp long and contained an open reading frame corresponding to a partial leader peptide through to the end of the cytoplasmic domain (Fig. 1) and included a 3′ untranslated region and a poly(A) tail (not shown). A Southern blot of bandicoot genomic DNA probed with a subfragment corresponding to exon 4 yielded a single hybridizing band (Fig. 2), consistent with CD1 being a single copy gene in this species.

Figure 1
Alignment of the deduced amino acid sequence from the bandicoot and opossum CD1 sequences with human CD1 isoforms. The boundaries between the domains are indicated. Dashes indicate identity and gaps are indicated by dots. Conserved cysteines in the α2 ...

Currently, M. domestica is the only marsupial for which a whole genome sequence is available and for which the assemblies have been assigned to chromosomes. To investigate CD1 in marsupials further, the bandicoot sequence was used to search the M. domestica genome sequence assembly to identify a homologous gene or genes. A single gene sequence was identified (Fig. 1) that corresponded to exons 2, 3 and 4 of a CD1 homologue. Further searches of the opossum genome using bandicoot, human, mouse and chicken CD1 sequences revealed no other loci with similarity to CD1. Consistent with CD1 being single copy in the M. domestica genome assembly, a Southern blot of M. domestica genomic DNA probed with a fragment corresponding to exon 4 revealed only a single hybridizing band (not shown). To confirm that the gene identified is probably a CD1 homologue, a 5-megabase (Mb) region of the opossum genome flanking the CD1 locus was analysed for its gene content. The region containing the M. domestica CD1 gene was on chromosome 2 and shared a high degree of conserved synteny with the corresponding regions where CD1 was located on human chromosome 1 and mouse chromosome 3 (Fig. 3).32

Figure 3
Comparative gene maps of the region surrounding the CD1 loci on mouse chromosomes 1 and 3, human chromosome 1, and opossum chromosome 2. The mouse and human gene maps were adapted from the Ensembl annotation.

The bandicoot and opossum CD1 sequences shared 71% nucleotide identity with each other and 50–69% and 46–61% nucleotide identity with CD1 genes from eutherians and chicken, respectively. A phylogenetic analysis revealed that the marsupial CD1 was in a separate clade from the eutherian CD1 isoforms (Fig. 4). The location of marsupial sequences in the tree was as would be expected for CD1 homologues: they were part of the clade that included mammalian and avian CD1 and were the sister group to the eutherian genes.

Figure 4
Phylogenetic analysis based on nucleotide alignments of exons 2, 3 and 4 of marsupial CD1 sequences with CD1 and MHC class I sequences from representative vertebrate species. Branch support is indicated as the percentage out of 1000 bootstrap replicates ...

The I. macrourus CD1 was first identified as a thymus expressed sequence tag and was therefore from a transcribed locus. RT-PCR using both thymus and spleen mRNA also detected CD1 transcripts in both tissues in I. macrourus(Fig. 5). To test for transcription of M. domestica CD1, RT-PCR was also performed using thymus and spleen mRNA with combinations of primers for exons 2, 3 and 4 designed from a sequence identified in the genome assembly. Figure 5 shows the results obtained by using a primer pair from exon 2 to exon 3. The exon 2–4 and exon 3–4 combinations are not shown. In all cases the RT-PCR results were negative (Fig. 5 and data not shown). Given the absence of transcripts, we investigated the genomic sequence of the opossum CD1 more closely for possible explanations for the lack of transcripts and a number of unusual features were found. First, neither an exon encoding the leader peptide (exon 1), nor the exons encoding the transmembrane and cytoplasmic domains could be identified based on homology to the bandicoot CD1 sequence. The gene prediction software GenScan was also unable to predict these exons in the opossum genome sequence. Second, there was a non-canonical TC dinucleotide mRNA splice site at the start of the predicted exon 3 (not shown). This non-canonical splice site was confirmed by direct sequencing of opossum genomic DNA and therefore was not an error in the opossum genome assembly. Third, the opossum CD1 gene contained a 45-bp deletion in exon 4 that removed the coding sequence for 15 residues in the α3 domain, including a cysteine that was conserved in the bandicoot, eutherian and avian sequences (Fig. 1). There was also a 15-bp deletion in exon 2 of the opossum sequence that was not found in the bandicoot. Neither of the predicted marsupial sequences had the conserved cysteines normally found in the α2 domain because of a marsupial-specific deletion of the upstream codon and a point mutation of the downstream site. Both predicted marsupial sequences lacked a conserved glycosylation site found in the α1 domain of both eutherian and avian CD1 (Fig. 1).8 There are predicted glycosylation sites in the α2 and α3 domains of both marsupial sequences; however, these are not conserved in eutherians and chickens. The I. macrourus sequence encoded a YEGI motif in its cytoplasmic domain that was the conserved tyrosine-based YXXZ (where Y is a tyrosine, X can be any amino acid and Z is a hydrophobic amino acid) found in other CD1 and class I molecules and involved in endosomal localization.33

Figure 5
Expression of the CD1 gene in bandicoot and opossum thymus and spleen tissues. RT-PCR was performed on mRNA from bandicoot thymus (T, lane 2) and spleen (S, lane 3) and opossum thymus (T, lane 6) and spleen (S, lane 7). Actin was used as a positive control ...

From the RT-PCR results and analysis of the genomic sequence it appeared that opossum CD1 was a pseudogene. We next investigated the possibility that there was another class I gene in this species that had the characteristics expected for a gene that presents lipid antigens and therefore that might have evolved to compensate for a loss of CD1. Thirteen MHC class I genes have been identified so far in the opossum genome, excluding the MIC and FcRN homologues.22 Two of them, ModoUB and ModoUC, are located outside the MHC, and the remainder are within the MHC. Their predicted translation sequences were aligned with eutherian and chicken CD1 and other class I molecules and the residues in the α1 and α2 domains that correspond to those sites identified as being important in lipid binding in human CD1 were identified.31 The hydrophobicity indices for these residues were summed for combined A, C and F pockets and the tunnel region T, and both the marsupial CD1 were comparable to eutherian and chicken CD1(Table 1). All other M. domestica class I loci however, were consistently lower and comparable to classical class I genes. Similar results were obtained when just the A and F pockets were summed, although the opossum CD1 had a hydrophobicity value lower than other CD1.

Table 1
Hydropathy index of residues in the A, F and C pockets and the tunnel T of the peptide binding domains of CD1 and MHC class I molecules

Discussion

Two lines of evidence support the possibility that the I. macrourus and M. domestica genes described here are CD1 homologues. The first is their relatedness to eutherian CD1 sequences, both phylogenetically and by sequence similarity. Second, in the case of the M. domestica, where a complete genome sequence is known, the gene maps to a region with conserved synteny to the CD1 regions in the human and mouse genomes. In mice this region has been translocated to two chromosomes with CD1 on chromosome 3 and the olfactory receptor (OR) genes and SPNA1 on chromosome 1; however, the general gene order remains the same. In both marsupial species CD1 was a single copy gene. This was shown by Southern blot analysis, in which only a single band was hybridized with an exon 4 probe. Exon 4 is the most conserved exon in class I genes and would be expected to cross-hybridize among related genes. The human CD1A to CD1E genes, for example, share more than 90% nucleotide identity in exon 4 and would cross-hybridize under the conditions used for the Southern blot hybridizations. While it is possible that there are other divergent, non-hybridizing CD1-related genes in I. macrourus, none were identified in a scan of the whole M. domestica genome sequence.

The previous discovery of CD1 in chickens demonstrates that this non-classical lineage evolved before the divergence of birds and mammals, estimated to be approximately 310 million years ago. In chickens, CD1 is linked to the MHC, which is consistent with CD1 genes having diverged from other MHC genes while remaining linked to the classical class I.68 We previously showed that the opossum CD1 locus was not located in the MHC proper on chromosome 1, but was located in an MHC paralogous region on chromosome 2, demonstrating that its relocation outside the MHC occurred before the separation of marsupials and eutherians 175–180 million years ago.19,20,22 This was probably a single common event in therian mammals (marsupials and eutherians) given the conserved synteny between the opossum and human chromosomes in the region containing CD1.

All indications are that the I. macrourus CD1 is a functional gene, supporting an earlier report that anti-human CD1a antibodies recognize a surface epitope on thymocytes from this species.21 The cDNA isolated encodes a predicted protein that has a number of conserved sequence motifs found in the CD1 molecules of other species. One is the tyrosine-based motif (YXXZ) in the cytoplasmic tail that is also found in human CD1b, CD1c and CD1d and in chicken CD1.1. This motif mediates endosomal localization of CD1 and its absence, as in the case of CD1a, results in localization to the cell surface.34 The I. macrourus CD1 also has a hydrophobic antigen-binding groove. The net hydrophobicity in the bandicoot CD1 antigen-binding region was comparable to that in human, mouse and chicken CD1 molecules, consistent with its likely function of binding and presenting lipid antigens.

In contrast to I. macrourus, M. domestica appears to have lost a functional CD1. We were unable to detect CD1 transcripts in either M. domestica thymus or spleen and the CD1 gene sequence does not appear to be sufficiently complete to encode a full-length protein. The presence of a non-canonical splice site in the M. domestica CD1 gene is not sufficient to indicate that it is a pseudogene. Such non-canonical sites have been identified in other species, including a non-classical MHC class I gene in mice that use a non-canonical splice site to produce an alternative splice variant.35,36 However, in this case it may contribute to the failure of the M. domestica CD1 locus to produce a correctly spliced mRNA. It is not unusual for some eutherian species to have completely deleted CD1 genes or for some CD1 gene copies to be pseudogenes. Rats and mice have only the CD1D gene lineage in their genomes and have deleted CD1A, CD1B, CD1C, and CD1E. The CD1C lineage in cattle is deleted and the CD1D genes of cattle are transcribed pseudogenes.4 However, M. domestica, to our knowledge, is the first mammal to lack completely a functional CD1 homologue. This loss would have occurred after the divergence of the American and Australasian marsupials, estimated to be 65–70 million years ago.37,38

To determine if another class I gene in M. domestica may have evolved to compensate for the loss of CD1, we analysed the residues in the antigen-binding region of the other 13 known opossum MHC class I genes. This analysis included the 11 class I genes in the opossum MHC, of which only seven are known to be expressed.22 One of these, ModoUA1, is the only class I gene in the opossum known to have the characteristics of a classical class I gene.39,40 Also included were two class I genes that map outside the MHC and are the result of recent duplications in the opossum genome and whose functions are not known.22,41 The results confirm that none of the other class I genes encode a sufficiently hydrophobic antigen-binding region to perform an analogous role in lipid antigen presentation as CD1. We would therefore conclude that the opossum has an impaired ability to present lipid antigens. What implications this has for the opossum immune system is not known but the prediction would be an increased susceptibility to certain diseases. One of the roles of CD1d in eutherians is to present lipids to NKT cells. Cattle and guinea pigs, for example, lack CD1d and are unable to stimulate NK T-cell responses.4 NK T cells are known to be important in antitumour responses and NK T-cell-dependent rejection of a broad range of experimental tumour lines, including melanoma, thymoma, carcinoma and sarcoma, has been demonstrated in mice.42 It is intriguing to note that the opossum M. domestica is highly susceptible to melanoma development in response to UV light exposure.43,44 Furthermore, in humans, CD1d is required for protective NK T-cell activation during Trypanosoma cruzi infection, the causative agent of Chagas disease.45 Didelphid marsupials, such as M. domestica, are significant wildlife reservoirs of T. cruzi; however, their response to the parasite is different and generally does not result in pathology.46 Whether susceptibility to melanoma or to differences in response to T. cruzi is related to CD1 and/or NK T-cell deficiency in M. domestica remains to be determined.

An increased susceptibility to mycobacterial infection would be predicted for species with CD1 deficiency. Whether M. domestica is more susceptible to mycobacterial infection or not remains to be determined. However, Mycobacterium bovis susceptibility has been studied in two marsupial species, the Australasian brushtail possum Trichosurus vulpecula and the North American opossum Didelphis virginiana. T. vulpecula is highly susceptible to M. bovis infection and forms an important wildlife reservoir for the pathogen.47Didelphis virginiana, which is a closer relative to M. domestica, on the other hand, can be infected with M. bovis but is much less susceptible than other wildlife species.48

The CD1 lineage appears to be ancient in the amniotes (birds, reptiles and mammals)68 and in all cases appears to be maintaining its role in lipid antigen presentation. The complexity of CD1 genes, however, appears to be evolving differently in the separate lineages. In eutherian mammals, CD1 has undergone duplication and divergence, which have resulted in the evolution of CD1 genes encoding molecules with some degree of specialization among the different isoforms. From the comparison to marsupial CD1 homologues, it now appears that this diversification is unique to the eutherians because marsupials have maintained only a single CD1 form. Although the analyses presented here only included two marsupial species, these two species are distant relatives on the marsupial family tree, separated by 60–70 million years of evolution,37,38 so it is likely that most if not all marsupials have single or limited numbers of CD1 homologues. How marsupials compensate for this low CD1 complexity or, conversely, why eutherians require a greater CD1 complexity than marsupials is not obvious from differences in their life history traits. Indeed, M. domestica survives without a functional CD1. The hallmark difference between marsupials and eutherians is their degree of development at birth, where marsupials undergo a shorter gestation period and are born less developmentally mature.49 It is possible that, historically, eutherians were exposed to more mycobacterial infections or other pathogens that selected for anti-lipid antigen responses; however, this would be speculative and seems unlikely given that both mammals and birds have mycobacterial pathogens.

Acknowledgments

This publication was made possible by support from a National Institutes of Health grant no. IP20RR18754 from the Institutional Development Award (IDeA) programme of the National Center for Research Resources and a National Science Foundation award (MCB-0234930).

References

1. Jayawardena-Wolf J, Bendelac A. CD1 and lipid antigens: intracellular pathways for antigen presentation. Curr Opin Immunol. 2001;13:109–13. [PubMed]
2. Dascher CC, Brenner MB. Evolutionary constraints on CD1 structure: insights from comparative genomic analysis. Trends Immunol. 2003;24:412–18. [PubMed]
3. Bradbury A, Belt K, Neri TM, Milstein C, Calabi F. Mouse CD1 is distinct from and co-exists with TL in the same thymus. EMBO J. 1988;7:3081–6. [PMC free article] [PubMed]
4. Van Rhijn I, Koets AP, Im JS, et al. The bovine CD1 family contains group 1 CD1 proteins, but no functional CD1d1. J Immunol. 2006;176:4888–93. [PubMed]
5. Kumar S, Hedges SB. A molecular timescale for vertebrate evolution. Nature. 1998;392:917–20. [PubMed]
6. Salomonsen J, Rathmann Sorenson M, Marston DA, et al. Two CD1 genes map to the chicken MHC, indicating that CD1 genes are ancient and likely to have been present in the primordial MHC. Proc Natl Acad Sci USA. 2005;102:8668–73. [PMC free article] [PubMed]
7. Maruoka T, Tanabe H, Chiba M, Kasahara M. Chicken CD1 genes are located in the MHC. CD1 and endothelial protein C receptor genes constitute a distinct subfamily of class I like genes that predates the emergence of mammals. Immunogenetics. 2005;57:590–600. [PubMed]
8. Miller MM, Wang C, Parisini E, et al. Characterisation of two avian MHC-like genes reveals an ancient origin of the CD1 family. Proc Natl Acad Sci USA. 2005;102:8674–9. [PMC free article] [PubMed]
9. Calabi F, Milstein C. A novel family of human major histocompatibility complex related genes not mapping to chromosome 6. Nature. 1986;323:540–3. [PubMed]
10. Matsuura A, Kinebuchi M, Katabami S, et al. Correction and confirmation of the assignment of CD1d the evolutionarily conserved CD1D class gene to rate chromosome 2q34 and its relationship to human and mouse loci. Cytogenet Cell Genet. 1999;86:323–4. [PubMed]
11. Moseley WS, Wang C, Parisini E, et al. CD1 defines conserved linkage group border between human chromosome 1 and mouse chromosomes 1 and 3. Immunogenetics. 1989;30:378–82. [PubMed]
12. Brigl M, Brenner MB. Cd1. Antigen presentation and T cell function. Annu Rev Immunol. 2004;22:817–90. [PubMed]
13. Moody DB, Ulrichs T, Muhlecker W, et al. CD1c mediated T cell recognition of isoprenoid glycolipids in Mycobacterium tuberculosis infection. Nature. 2000;404:884–8. [PubMed]
14. Moody DB, Young DC, Cheng TY, et al. T cell activation by lipopeptide antigens. Science. 2004;303:527–31. [PubMed]
15. Brutkiewicz RR. CD1d ligands: the good, the bad and the ugly. J Immunol. 2006;177:769–75. [PubMed]
16. Kawano T, Cui J, Koezuka Y, et al. CD1d-restricted and TCR-mediated activation of Valpha14 NKT cells by glycosylceramides. Nature. 1997;78:1626–9. [PubMed]
17. de la Salle H, Mariotti S, Angenieux C, et al. Assistance of microbial glycolipid antigen processing by CD1e. Science. 2005;310:1321–4. [PubMed]
18. Baker ML, Harrison GA, Wares JP, Miller RD. The relationship of the marsupial families and the mammalian subclasses based on recombination activating gene-1. J Mam Evol. 2004;11:1–16.
19. Belov K, Harrison GA, Miller RD, Cooper DW. Molecular cloning of four lambda light chain cDNAs from the Australian brushtail possum (Trichosurus vulpecula) Eur J Immunogenet. 2002;29:95–9. [PubMed]
20. Janke A, Xu X, Arnason U. The complete mitochondrial genome of the wallaroo (Macropus robustus) and the phylogenetic relationship among Monotremata, Marsupialia, and Eutheria. Proc Natl Acad Sci USA. 1997;94:1276–81. [PMC free article] [PubMed]
21. Cisternas PA, Armati PJ. Immune system cell markers in the northern brown bandicoot, Isoodon macrourus. Dev Comp Immunol. 2000;24:771–82. [PubMed]
22. Belov K, Deakin JE, Papenfuss AT, et al. Reconstructing an ancestral mammalian immune supercomplex from a marsupial MHC. Plos Biol. 2006;4:e46. [PMC free article] [PubMed]
23. Gouin N, Deakin JE, Miska KB, Miller RD, Kammerer CM, Graves JA, Vandeberg JL, Samollow PB. Linkage mapping and physical localization of the major histocompatibility complex region of the marsupial Monodelphis domestica. Cytogenet Genome Res. 2006;112:277–85. [PubMed]
24. Altschul SF, Gish W, Miller W, Myers EM, Lipman DJ. Basic local alignment search tool. J Mol Evol. 1990;215:403–10. [PubMed]
25. Burge C, Karlin S. Prediction of complete gene structures in human genomic DNA. J Mol Biol. 1997;268:78–94. [PubMed]
26. Baker ML, Osterman AK, Brumburgh S. Divergent T cell receptor delta chains from marsupials. Immunogenetics. 2005;57:665–73. [PubMed]
27. Thompson JD, Higgins DG, Gibson TJ. Clustal W: improving the sensitivity of the progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nuc Acids Res. 1994;22:4676–80. [PMC free article] [PubMed]
28. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nuc Acids Sym Series. 1999;41:95–8.
29. Kumar S, Tamura K, Nei M. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings Bioinformatics. 2004;5:150–63. [PubMed]
30. Gadola SD, Zaccai NR, Harlos K, et al. Structure of human CD1b with bound ligands at 2.3A, a maze for alkyl chains. Nat Immunol. 2002;3:721–6. [PubMed]
31. Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol. 1982;157:105–32. [PubMed]
32. Shiina T, Ando A, Suto Y, et al. Genomic anatomy of a premier major histocompatibility complex paralogous region on chromosome 1q21-q22. Genome Res. 2001;11:789–802. [PMC free article] [PubMed]
33. Jackman RM, Stengers S, Lee A, et al. The tyrosine containing cytoplasmic tail of CD1b is essential for its efficient presentation of bacterial lipid antigens. Immunity. 1988;8:341–51. [PubMed]
34. Matsuda JL, Kronenberg M. Presentation of self and microbial lipids by CD1 molecules. Curr Opin Immunol. 2001;13:19–25. [PubMed]
35. Burset M, Seledtosv IA, Solovyev VV. Analysis of canonical and non-canonical splice sites in mammalian genomes. Nuc Acids Res. 2000;8:4364–75. [PMC free article] [PubMed]
36. Guidry PA, Stroynowski I. The murine family of gut restricted class Ib MHC includes alternatively spliced isoforms of the proposed HLA-G homolog, ‘Blastocyst MHC’ J Immunol. 2005;175:5248–59. [PubMed]
37. Kirsch JAW, Lapointe F, Springer MS. DNA-hybridisation studies of marsupials and their implications for metatherian classification. Aust J Zool. 1997;45:211–80.
38. Nilsson MA, Arnason U, Spencer PBS, Janke A. Marsupial relationships and a timeline for marsupial radiation in South Gondwana. Gene. 2004;340:189–96. [PubMed]
39. Miska KB, Miller RD. Marsupial MHC class I classical sequences from the opossum, Monodelphis domestica. Immunogenetics. 1999;50:89–93. [PubMed]
40. Gouin N, Wright AM, Miska KB, Parra ZE, Samollow PB, Baker ML, Miller RD. Modo-UG, a marsupial nonclassical MHC class I locus. Immunogenetics. 2006;58:396–406. [PubMed]
41. Miska KB, Wright AM, Lundgren R, Sasaka-Mcclees R, Osterman A, Gale JM, Miller RD. Analysis of a marsupial MHC region containing two recently duplicated class I loci. Mamm Genome. 2004;15:851–64. [PubMed]
42. Godfrey DI, Kronenberg M. Going both ways: immune regulation via CD1d-dependent NKT cells. J Clin Invest. 2004;114:1379–88. [PMC free article] [PubMed]
43. Ley RD, Applegate LA, Padilla RS, Stuart TD. Ultraviolet radiation-induced malignant melanoma in Monodelphis domestica. Photochem Photobiolol. 1989;50:1–5. [PubMed]
44. Kusewitt DF, Applegate LA, Ley RD. Ultraviolet radiation-induced skin tumors in a South American opossum (Monodelphis domestica) Vet Pathol. 1991;28:55–65. [PubMed]
45. Duthie MS, Kahn M, White M, Kapur RP, Kahn SJ. Both CD1d antigen presentation and interleukin-12 are required to activate natural killer T cells during Trypanosoma cruzi infection. Infect Immun. 2004;73:1890–4. [PMC free article] [PubMed]
46. Yeo M, Acosta N, Llewellyn M, et al. Origins of Chagas disease: Didelphis species are natural hosts of Trypanosoma cruzi I and armadillos hosts of Trypanosoma cruzi II, including hybrids. Int J Parasitol. 2005;35:225–33. [PubMed]
47. Buddle BM, Young LJ. Immunobiology of mycobacterial infections in marsupials. Dev Comp Immunol. 2000;24:517–29. [PubMed]
48. Diegel KL, Fitzgerald SD, Berry DE, Church SV, Reed WM, Sikarskie JG, Kaneene JB. Experimental inoculation of North American opossums (Didelphis virginiana) with Mycobacterium bovis. J Wild Dis. 2002;38:275–81. [PubMed]
49. Tyndale-Biscoe CH, Renfree MB. Reproductive Physiology of Marsupials. Cambridge: Cambridge University Press; 1987.

Articles from Immunology are provided here courtesy of British Society for Immunology
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...