Logo of jexpmedHomeThe Rockefeller University PressEditorsContactInstructions for AuthorsThis issue
J Exp Med. 1997 Nov 3; 186(9): 1615–1620.
PMCID: PMC2199104
Brief Definitive Reports

Wound Healing Is Accelerated by Agonists of Adenosine A2 (Gαs-linked) Receptors


The complete healing of wounds is the final step in a highly regulated response to injury. Although many of the molecular mediators and cellular events of healing are known, their manipulation for the enhancement and acceleration of wound closure has not proven practical as yet. We and others have established that adenosine is a potent regulator of the inflammatory response, which is a component of wound healing. We now report that ligation of the Gαs-linked adenosine receptors on the cells of an artificial wound dramatically alters the kinetics of wound closure. Excisional wound closure in normal, healthy mice was significantly accelerated by topical application of the specific A2A receptor agonist CGS-21680 (50% closure by day 2 in A2 receptor antagonists. In rats rendered diabetic (streptozotocin-induced diabetes mellitus) wound healing was impaired as compared to nondiabetic rats; CGS-21680 significantly increased the rate of wound healing in both nondiabetic and diabetic rats. Indeed, the rate of wound healing in the CGS-21680–treated diabetic rats was greater than or equal to that observed in untreated normal rats. These results appear to constitute the first evidence that a small molecule, such as an adenosine receptor agonist, accelerates wound healing in both normal animals and in animals with impaired wound healing.

Wound healing is a complex process characterized by three overlapping phases: inflammation, tissue formation, and tissue remodeling. During tissue formation, growth factors synthesized by local and migratory cells stimulate fibroblasts to migrate into the wound where they proliferate and construct an extracellular matrix. In response to many of the same growth factors, keratinocytes migrate from the edge of the wound over the surface of the injured area and proliferate until the wound is completely covered. Both matrix formation and epithelialization, in turn, depend upon angiogenesis, a process that occurs through the migration, proliferation, and organization of vascular endothelial cells. Earlier studies demonstrated that a variety of peptide growth factors may promote reepithelialization, migration of fibroblasts into a wound, and angiogenesis, but no small molecules of potentially greater use have yet been shown to enhance the rate at which wounds close in normal healthy animals (1).

Because of their potent effects on some of the cells involved in wound healing, we hypothesized that adenosine receptor agonists promote wound healing both in vitro and in vivo. Previous studies have demonstrated that adenosine, acting at A2 receptors, inhibits neutrophil accumulation and function (2) and promotes endothelial cell proliferation, migration, and secretion of growth factors (36). In contrast, adenosine receptor occupancy inhibits keratinocyte proliferation (7) and its effects on fibroblast proliferation are inconsistent (3, 8). Four adenosine receptors have been cloned and the deduced sequences reveal that all four are members of the large family of 7 transmembrane–spanning, G protein–coupled receptors. Three of the adenosine receptor subtypes, A1, A2A, and A2B, are highly conserved throughout evolution (80–95% sequence homology), whereas the A3 receptors differ significantly among species (for review see reference 9). Adenosine A1 and A2 receptors were first differentiated by their opposing effects on cAMP accumulation (10, 11), effects mirrored, in some cell types (e.g., neutrophils), by opposing functional effects (for review see reference 2).

Because results of preliminary in vitro studies indicated that adenosine A2 receptor agonists promoted fibroblast and endothelial cell migration into an artificial wound, we tested the effects of a specific adenosine A2A receptor agonist, CGS-21680 (4-[{N-ethyl-5′-carbamoyladenos-2-yl}aminoethyl] phenylpropionic acid), on wound healing in normal mice and rats and in rats rendered diabetic. We report here that adenosine, acting at specific A2A receptors, promotes healing both in normal, healthy, young animals and in diabetic animals with impaired wound healing.

Materials and Methods


CGS-21680, DMPX (3,7-dimethyl-1-propargylxanthine), and CSC (8-(3-chlorostyryl)caffeine) were obtained from Research Biochemicals, Inc. (Natick, MA). Tissue culture media and reagents were obtained from GIBCO BRL (Bethesda, MD).

Cell Lines.

Fibroblasts (CCD-25sk) were obtained from the American Type Culture Collection (Rockville, MD) and were originally derived from normal human dermal fibroblasts. These cells were grown to confluence in standard tissue culture medium consisting of MEM/10% fetal bovine serum (vol/vol). HUVEC were obtained by modifications of the method of Jaffe et al. (12). In brief, HUVEC were obtained by collagenase treatment of fresh human umbilical cords and grown to confluence in medium 199 with 20% fetal bovine serum, antibiotics, and endothelial growth supplement at 37°C in a 5% CO2 atmosphere (12, 13). The experiments in the study were performed on HUVEC in their third passage.

Reverse Transcriptase–PCR of Adenosine Receptor mRNA.

Total RNA from confluent monolayers of either HUVEC or CCD-25sk cells was isolated by the RNAzol™ B method (Tel-Test, Inc., Friendswood, TX) and first-strand cDNA was synthesized by GeneAmp™ RNA PCR Core Kit (Perkin-Elmer Corp., Branchburg, NJ) according to the directions. The amplification primers for the adenosine receptor messages have been previously described by Nilsen et al. (Nilsen, D., A. Talbot, C. Aston, R. Hirschhorn, B.N. Cronstein, and J. Reibman, manuscript submitted for publication) and Boyle et al. (14). Upstream primers for the A1, A2A and the A2B receptors were GGTGGAATTCTCCATCTCAGCTTTCCAGGC, GGTGGAATTCAACAACTGCGGTCAGCCAAA, and GGTGGAATTCGAACCACGAATGAAAGCTGC, respectively, and the downstream primers were GGTGAAGCTTTCGAACTCGCACTTGATCAC, GGTGAAGCTTCAGCTGCCTTGAAAGGTTCT, and GGTGAAGCTTTGACCATTCCCACTCTTGAC, respectively. The nested amplification primers for A3 receptors were AACGTGCTGGTCATCTGCGTGGTC (upstream), GTAGTCCATTCTCATGACGGAAAC (downstream), and CTGCAGACCACCACCTTCTATTTC (nested). Template first-strand cDNA (150 ng) was added to a reaction mixture which included dNTPs (0.2 mM each), Mg2+ (25 mM) and appropriate primers (1 mM), and Taq DNA polymerase (0.025 U/μl) in a final volume of 50 μl. The PCR was carried out in a thermocycler (GeneAmp 2400; Perkin-Elmer) programmed as follows: 94°C (2 min), and then 35 cycles of 94°C (1 min), 58°C (1 min), 72°C (3 min), followed by a 10-min terminal extension (72°C) for the A1 receptor. The A2A, A2B, and A3 receptors were amplified using the following program: 94°C (2 min), and then 35 cycles of 94°C (30 s), 58°C (30 s), and 72°C (45 s), followed by a 10-min terminal extension (72°C). PCR products were separated in a 1.8% agarose gel. Sequencing of the PCR products confirmed their identity with previously described portions of the appropriate adenosine receptors.

Excisional Wound Formation.

Two sterile, full-thickness excisional wounds (12 mm in diameter) were formed on the dorsum of anesthetized 6–8-wk-old male and female mice (BALB/c) using a template and scissors. Wounds were treated daily with topical application of 20 μl of either the adenosine agonist CGS-21680 (250 μg/ml) or vehicle (1.5%, wt/vol carboxymethylcellulose in PBS) in the presence or absence of either the adenosine receptor antagonist DMPX (2.5 mg/ml) or CSC (250 μg/ml). Mice were kept in individual cages to minimize licking of the wounds or applied agents. To determine the rate of closure, wounds were traced onto clear plastic sheets on a daily basis and the area of the wounds was quantitated by digitization of the wound tracings using a WACOM digitizing pad and Scan Analysis (Specom Research, Ferguson, MO) software. These experiments were approved by the Institutional Animal Care and Use Committee (New York University School of Medicine).

Excisional Wound Formation in Rats Rendered Diabetic.

Adult (330–400 g) female Sprague-Dawley rats were given a single intraperitoneal injection of streptozotocin (60 mg/kg). Animals were then rested for 8 d before excision of 2.0 cm wounds on the dorsum of the rats (15, 16). Wounds were treated daily with topical application of 20 μl of either the adenosine agonist CGS-21680 (250 μg/ml) or vehicle (1.5%, wt/vol carboxymethylcellulose in PBS). The animals were kept in individual cages to minimize the licking of the wounds or applied agents. The rate of wound closure was determined as described above. Mean serum glucose, tested on the final day of the experiment using the Easy Test® Strips for glucose with an Accu-Chek® Easy™ Monitor (Boehringer-Mannheim, Indianapolis, IN), was 156 ± 18.5 mg/dl in the nondiabetic rats as compared to 432 ± 25 mg/dl in the diabetic rats. Seven rats died after injection of streptozotocin but before excision of the wounds and seven other diabetic rats died during the course of these experiments (five control rats and two CGS-21680– treated rats).

Histologic Analysis.

Some animals were killed on the stated day by CO2 poisoning, and then wounds were excised and histologic slides were made using standard methods. Slides, stained with hematoxylin and eosin, were graded using a variation of the scoring described by Tsuboi and Rifkin (17). In brief, reepithelialization was measured on a score from 1 to 10 (1 = no closure; 10 = complete closure). Matrix density was scored from 1 to 4 (1 = edematous with little matrix; 2 = a small amount of coarse matrix; 3 = a moderate amount of matrix; and 4 = dense matrix). Fibroblast infiltrate was scored from 1 to 4 (1 = few fibroblasts; 2 = a moderate number of fibroblasts; 3 = many cells; and 4 = very many cells). Inflammatory cells were graded from 1 to 4 (1 = very many cells; 2 = many cells; 3 = a moderate number of cells; 4 = few cells). A maximum composite score of 22 can be obtained. All slides were graded in a blinded fashion.


Endothelial Cells and Fibroblasts Express Message for Multiple Adenosine Receptors.

To establish the profile of adenosine receptors expressed by fibroblasts and endothelial cells, we determined whether mRNA for adenosine A1, A2A, A2B, and A3 receptors was present in cultured dermal fibroblasts and HUVEC by use of reverse transcriptase–PCR. As shown in Fig. Fig.1,1, message for A2A, A2B, and A3 receptors was present in both fibroblasts and HUVEC. In contrast, message for A1 receptors was expressed in HUVEC but not in fibroblasts. Results of other in vitro studies with these cells indicated that occupancy of adenosine A2 receptors, both A2A and A2B receptors, promoted migration of both fibroblasts and HUVEC into an artificial in vitro wound by a cAMP-dependent mechanism (data not shown).

Figure 1
Endothelial cells (HUVEC) and a fibroblast cell line (CCD-25sk) express message for adenosine receptor subtypes. RNA was isolated from confluent monolayers of either HUVEC or CCD-25sk cells, as described. cDNA was generated from the isolated mRNA ...

Topical Application of an Adenosine A2A Receptor Agonist Promotes Wound Closure In Vivo.

The observation that both HUVEC and dermal fibroblasts express mRNA for both A2A and A2B receptors, the preliminary finding that adenosine A2 receptor occupancy increases the rate of fibroblast migration, and the previous demonstration that agents binding to adenosine A2 receptors may promote angiogenesis (36) all suggested that an adenosine A2 receptor agonist might accelerate wound healing in vivo. To test this hypothesis we studied the effect of the topical application of CGS-21680, the specific A2A agonist, on wound healing in healthy, young (6–8-wk-old) BALB/c mice. As shown in Fig. Fig.2,2, wound closure was significantly more rapid in the CGS-21680–treated mice than the mice treated with carrier alone (50% wound closure by day 2 versus by day 6; P <0.00001, n = 10 wounds per group). Topical application of the adenosine A2 receptor antagonist DMPX (2.5 mg/ml) did not affect wound healing itself, but completely reversed the effects of CGS-21680 on the rate of wound closure (Fig. (Fig.22 A). Similarly, the more selective A2A receptor antagonist CSC also completely reversed the effect of CGS-21680 on wound healing (Fig. (Fig.22 B). Upon histologic examination of the wounds, fibroblast infiltration, matrix density, and reepithelialization were markedly enhanced in the CGS-21680–treated animals as compared to controls (Fig. (Fig.3).3). Surprisingly, in contrast to the demonstrated antiinflammatory effects mediated by adenosine A2 receptor occupancy (2), CGS-21680 did not affect the inflammatory infiltrate in the wound until day 10 after wounding. The change in inflammatory infiltrate observed so late in the course of wound closure may have resulted from earlier wound closure rather than any direct effect of CGS-21680 on inflammatory infiltrate in the wound. Topical application of CGS-21680 to open wounds had no obvious toxic effect on the mice.

Figure 2
The effect of the adenosine A2A agonist CGS-21680 (250 μg/ml) on wound closure. (A) Wounds were excised on the dorsum of mice and treated with carrier (1.5% methylcellulose), CGS-21680, the adenosine A2 antagonist DMPX (2.5 mg/ml), or their ...
Figure 3Figure 3Figure 3Figure 3
Histologic analysis of wounds in control and CGS-21680–treated mice. Wounds were excised and mice were treated with topical application either of carrier or CGS-21680 in carrier. Analysis of fibroblast density (A), matrix density (B), epithelial ...

Topical Application of an Adenosine A2A Receptor Agonist Promotes Wound Closure in Diabetic Rats.

Patients with diabetes mellitus suffer from impaired wound healing, and poor wound healing is responsible for significant morbidity and mortality in these patients. To determine whether an adenosine A2A receptor agonist might be useful in the promotion of wound healing in patients with diabetes, we studied the effect of topical application of the adenosine receptor agonist CGS-21680 to full-thickness wounds in rats rendered diabetic by a single injection of streptozotocin. As expected, streptozotocin-treated rats had high serum glucose concentrations (432 ± 25 mg/dl in the diabetic rats versus 156 ± 18.5 mg/dl in the nondiabetic; P <0.00001) and the wounds of the diabetic animals healed more slowly than those of the control animals (50% closure by day 9 versus by day 7, respectively; P <0.0001; Fig. Fig.4).4). As with the normal young mice, topical application of CGS-21680 significantly promoted wound healing in the healthy nondiabetic rats (50% closure by day 4; P <0.0001, Fig. Fig.4).4). More importantly, application of CGS-21680 increased the rate at which the diabetic animals closed their wounds (50% closure by day 6, P <0.0001, versus control diabetic rats, Fig. Fig.4)4) but did not affect the serum glucose concentration (432 ± 31 mg/dl versus 407 ± 40 mg/dl in the control and CGS-21680–treated diabetic rats, respectively; P = NS). Indeed, the rate of wound healing in CGS-21680– treated diabetic animals was as good as or better than that in the untreated controls (Fig. (Fig.4).4).

Figure 4
The effect of the adenosine A2A agonist CGS-21680 on wound closure in normal and diabetic rats. Animals received a single injection of streptozotocin (60 mg/kg) followed 8 d later by excision of three wounds (2 cm in diameter) on the dorsum of each ...


The results reported here demonstrate that occupancy of adenosine A2A receptors increases the rate at which wounds heal in young, healthy mice and rats as well as in diabetic rats. To our knowledge, this is the first demonstration that a small nonpeptide agent, such as a purine nucleoside, promotes wound healing. Equally striking is the finding that this phenomenon occurs in normal, healthy animals, since only a few of the known peptide growth factors that accelerate wound healing in sick animals also accelerate wound closure in healthy animals (1).

Preliminary studies in our laboratory indicated that adenosine A2 receptor occupancy, both A2A and A2B, contributes to enhanced fibroblast and endothelial cell migration. Signal transduction at adenosine A2A and A2B receptors proceeds, at least in part, via activation of heterotrimeric G proteins leading to both cAMP-dependent and cAMP-independent signaling events (2, 9, 18). Our studies demonstrate that adenosine receptor occupancy promotes fibroblast and endothelial cell migration by a cAMP- and PKA-dependent pathway. In contrast, Sexl et al. have reported that adenosine A2A receptor occupancy modulates endothelial cell proliferation by a cAMP-independent mechanism (4, 19). These disparate findings suggest that stimulation of migration and proliferation in endothelial cells are mediated by different signal transduction pathways which diverge after occupancy of adenosine A2A receptors. However, there is no evidence that these divergent effects of adenosine receptor occupancy occur in other cell types. Regardless of the signal transduction pathway involved, our data clearly indicate that agents that occupy adenosine A2 receptors, receptors linked to GαS signal transduction proteins, promote wound healing.

It is unlikely that an adenosine receptor-mediated increase in fibroblast migration and angiogenesis is solely responsible for accelerating wound closure. Previous studies have demonstrated that adenosine and its analogues, acting at A2A receptors, increase secretion of vascular endothelial growth factor in addition to promoting endothelial cell proliferation and migration [3–6]. These observations suggest that one mechanism by which adenosine receptor occupancy increases the rate of wound closure is by promoting secretion of growth factors that act locally. Alternatively, by inhibiting the secretion of a variety of inflammatory cytokines (TNF-α, IL-6, IL-8) adenosine receptor occupancy might diminish the secretion of agents that inhibit wound healing (2024). Another explanation for the effects of adenosine receptor occupancy on wound healing is suggested by the work of Boyle et al. who reported that adenosine A2 receptor occupancy specifically inhibits synthesis and secretion of collagenase by synovial fibroblasts (14). Thus, diminished matrix degradation within the wound might also enhance wound closure. Therefore, it is likely that there are a number of adenosine-mediated effects that contribute to the accelerated rate of wound closure and that are mediated by ligation of adenosine receptors.

We conclude that adenosine A2 receptor agonists promote wound healing in normal and diabetic animals. This is the first example of a member of the 7 transmembrane– spanning, heterotrimeric G protein–associated family of receptors that, when occupied, promote wound healing by itself. Moreover, unlike some growth factors, occupation of adenosine A2A receptors promotes wound healing even in young, healthy animals (1). The observation that this same adenosine receptor agonist promotes wound healing in diabetic animals as well suggests an entirely novel approach for development of agents that promote wound healing in both normal individuals and individuals with impaired wound healing.


This study was supported by grants from the Systemic Lupus Erythematosus Foundation, Inc. (M.C. Montesinos), the Arthritis Foundation, NY Chapter (E. Ostad), the Public Health Service, National Institutes of Health, Bethesda, MD (HL-RO1-51631 to J. Reibman, AI-R37-10343 to R. Hirschhorn, and AI/AR-41911, AR-11949, and HL-19721 to B.N. Cronstein), and the General Clinical Research Center (MO1RR00096) and the Kaplan Cancer Center (CA16087; New York University Medical Center).


1. Pierce GF, Mustoe TA. Pharmacologic enhancement of wound healing. Ann Rev Med. 1995;46:467–481. [PubMed]
2. Cronstein BN. Adenosine, an endogenous anti-inflammatory agent. J Appl Physiol. 1994;76:5–13. [PubMed]
3. Ethier MF, Chander V, Dobson JG., Jr Adenosine stimulates proliferation of human endothelial cells in culture. Am J Physiol. 1993;265:H131–H138. [PubMed]
4. Sexl V, Mancusi G, Baumgartner-Parzer S, Schutz W, Freissmuth M. Stimulation of human umbilical vein endothelial cell proliferation by A2-adenosine and beta 2-adrenoceptors. Br J Pharmacol. 1995;114:1577–1586. [PMC free article] [PubMed]
5. Bull DA, Seftor EA, Hendrix MJ, Larson DF, Hunter GC, Putnam CW. Putative vascular endothelial cell chemotactic factors: comparison in a standardized migration assay. J Surg Res. 1993;55:473–479. [PubMed]
6. Meininger CJ, Schelling ME, Granger HJ. Adenosine and hypoxia stimulate proliferation and migration of endothelial cells. Am J Physiol. 1988;255:H554–H562. [PubMed]
7. Cook PW, Ashton NM, Pittelkow MR. Adenosine and adeinine nucleotides inhibit the autonomous and epidermal growth factor–mediated proliferation of cultured human keratinocytes. J Invest Dermatol. 1995;104:976–981. [PubMed]
8. Ahmed AH, Jacobson K A, Kim J, Heppel LA. Presence of both A1 and A2a adenosine receptors in human cells and their interaction. Biochem Biophys Res Commun. 1995;208:871–878. [PubMed]
9. Olah ME, Stiles GL. Adenosine receptor subtypes: characterization and therapeutic regulation. Annu Rev Pharmacol Toxicol. 1995;35:581–606. [PubMed]
10. van Calker D, Muller M, Hamprecht B. Adenosine regulates, via two different types of receptors, the accumulation of cyclic AMP in cultured brain cells. J Neurochem. 1979;33:999–1005. [PubMed]
11. Londos C, Cooper DMF, Wolff J. Subclasses of external adenosine receptors. Proc Natl Acad Sci USA. 1980;77:2551–2554. [PMC free article] [PubMed]
12. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins: identification by morphologic and immunologic criteria. J Clin Invest. 1973;52:2745–2756. [PMC free article] [PubMed]
13. Levin, R.I., D.A. Moscatelli, and P.A. Recht. 1993. Oxalate, a potential atherogenic toxin of uremia, inhibits endothelial proliferation induced by heparin-binding growth factors in vitro. Endothelium: Journal Endothelial Research 1:179–192.
14. Boyle DL, Sajjadi FG, Firestein GS. Inhibition of synoviocyte collagenase gene expression by adenosine receptor stimulation. Arthritis Rheum. 1996;39:923–930. [PubMed]
15. Covington DS, Xue H, Pizzini R, Lally KP, Andrassy RJ. Streptozotocin and alloxan are comparable agents in the diabetic model of impaired wound healing. Diabetes Res. 1993;23:47–53. [PubMed]
16. Greenwald DP, Shumway S, Zachary LS, LaBarbera M, Albear P, Temaner M, Gottlieb LJ. Endogenous versus toxin-induced diabetes in rats: a mechanical comparison of two skin wound-healing models. Plast Reconstr Surg. 1993;91:1087–1093. [PubMed]
17. Tsuboi R, Rifkin DB. Recombinant basic fibroblast growth factor stimulates wound healing in healing-impaired db/db mice. J Exp Med. 1990;172:245–251. [PMC free article] [PubMed]
18. Revan S, Montesinos MC, Naime D, Landau S, Cronstein BN. Adenosine A2receptor occupancy regulates stimulated neutrophil function via activation of a serine/threonine protein phosphatase. J Biol Chem. 1996;271:17114–17118. [PubMed]
19. Sexl V, Mancusi G, Holler C, Gloria-Maercker E, Schutz W, Freissmuth M. Stimulation of the mitogen-activated protein kinase via the A2A-adenosine receptor in primary human endothelial cells. J Biol Chem. 1997;272:5792–5799. [PubMed]
20. Parmely MJ, Zhou W-W, Edwards CK, III, Borcherding DR, Silverstein R, Morrison DC. Adenosine and a related carbocyclic nucleoside analogue selectively inhibit tumor necrosis factor–α production and protect mice against endotoxin challenge. J Immunol. 1993;151:389–396. [PubMed]
21. Bouma MG, Stad RK, van den Wildenberg FAJM, Buurman WA. Differential regulatory effects of adenosine on cytokine release by activated human monocytes. J Immunol. 1994;153:4159–4168. [PubMed]
22. Cronstein BN, Naime D, Firestein GS. The antiinflammatory effects of an adenosine kinase inhibitor are mediated by adenosine. Arthritis Rheum. 1995;38:1040–1045. [PubMed]
23. Sajjadi FG, Takabayashi K, Foster AC, Domingo RC, Firestein GS. Inhibiton of TNFα expression by adenosine: role of A3adenosine receptors. J Immunol. 1996;156:3435–3442. [PubMed]
24. Bouma MG, van den Wildenberg FAJM, Buurman WA. Adenosine inhibits cytokine release and expression of adhesion molecules by activated human endothelial cells. Am J Physiol. 1996;39:C522–C529. [PubMed]

Articles from The Journal of Experimental Medicine are provided here courtesy of The Rockefeller University Press
PubReader format: click here to try


Save items

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...


  • Compound
    PubChem chemical compound records that cite the current articles. These references are taken from those provided on submitted PubChem chemical substance records. Multiple substance records may contribute to the PubChem compound record.
  • MedGen
    Related information in MedGen
  • PubMed
    PubMed citations for these articles
  • Substance
    PubChem chemical substance records that cite the current articles. These references are taken from those provided on submitted PubChem chemical substance records.

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...