![]() | ![]() |
Formats:
|
|||||||||||||||||||||||||||||||||||
Treponema pallidum Major Sheath Protein Homologue Tpr K Is a Target of Opsonic Antibody and the Protective Immune Response From the Department of Medicine, University of Washington, Seattle, Washington 98195Address correspondence to Arturo Centurion-Lara, Department of Medicine, Box 359779, Harborview Medical Center, 325 9th Ave., Seattle, WA 98104. Phone: 206-731-4932; Fax: 206-731-8752; E-mail: acentur/at/u.washington.edu Received July 6, 1998; Revised November 17, 1998. This article has been corrected. See J Exp Med. 1999 June 7; 189(11): 1853. This article has been cited by other articles in PMC.Abstract We have identified a family of genes that code for targets for opsonic antibody and protective immunity in T. pallidum subspecies pallidum using two different approaches, subtraction hybridization and differential immunologic screening of a T. pallidum genomic library. Both approaches led to the identification of a polymorphic multicopy gene family with predicted amino acid homology to the major sheath protein of Treponema denticola. One of the members of this gene family, tpr K, codes for a protein that is predicted to have a cleavable signal peptide and be located in the outer membrane of the bacterium. Reverse transcription polymerase chain reaction analysis of T. pallidum reveals that Tpr K is preferentially transcribed in the Nichols strain of T. pallidum. Antibodies directed to purified recombinant variable domain of Tpr K can opsonize T. pallidum, Nichols strain, for phagocytosis, supporting the hypothesis that this portion of the protein is exposed at the surface of the treponeme. Immunization of rabbits with the purified recombinant variable domain of Tpr K provides significant protection against infection with the Nichols strain of T. pallidum. This gene family is hypothesized to be central to pathogenesis and immunity during syphilis infection. Keywords: syphilis, vaccine, subpopulation, surface antigens, antigenic variation Outer surface molecules of bacterial organisms play a central role in pathogenesis and immunity because they are involved in adherence to host cells and serve as targets of bactericidal or opsonic antibody. Although Treponema pallidum adheres to host cells and is susceptible to bactericidal and opsonic antibody, the bacterial molecules involved in those functions have not been defined. Unlike the outer membranes of gram-negative bacteria, the outer membrane of T. pallidum is very fragile and easily damaged by physical manipulation (1), which has resulted in the misidentification of several highly immunogenic periplasmic lipoproteins as outer membrane antigens (2). Studies conducted independently in two laboratories (3, 4) have shown by freeze fracture electron microscopy that the surface of T. pallidum is relatively devoid of outer membrane proteins compared with other bacteria, and it is hypothesized that this paucity of surface-exposed antigens is responsible for the chronicity of syphilis infection (3). Attempts to identify the rare outer membrane proteins of T. pallidum have yielded controversial results (5). Two surface-exposed molecules have been proposed to date, Tromp 1 (6) and Tromp 2 (7). Tromp 1 is reported to have porin activity (6) and appears to be part of an ABC transport operon (8), but its location in the outer membrane is not universally accepted (8, 9), and antiserum directed against recombinant Tromp 1 is not opsonic (9). Independent confirmation of the surface location of Tromp 2 has not been reported. Other searches for outer membrane proteins have been inconclusive (10–14). Surface-exposed antigens in T. pallidum are likely to be important virulence factors, as well as being the molecules that interact with the protective immune response. Several studies have shown that T. pallidum infection induces antibodies that inhibit cell attachment (15, 16) and promote macrophage-mediated phagocytosis (17, 18) and complement-mediated neutralization (19–21). Macrophage-mediated phagocytosis of opsonized T. pallidum is the major mechanism for clearance of treponemes from primary and secondary syphilis lesions (22–24), and opsonic antibody is required for killing of the treponemes by the macrophages (18). In this report we describe the identification of a multicopy polymorphic gene family of T. pallidum, termed T. pallidum repeat (tpr),1 that is related to the major surface protein (msp) genes of Treponema denticola. The T. denticola msps are surface exposed, mediate binding to host cells and extracellular matrix, and function as porins. We show that one member of the paralogous T. pallidum gene family, tpr K, is preferentially transcribed in the Nichols strain of T. pallidum, serves as a target of opsonic antibody, and induces a protective immune response. These results strongly support the exposure of this protein on the surface of the Nichols strain of T. pallidum. Materials and Methods Treponemal Strains and DNA Extraction. T. pallidum subspecies pallidum, Nichols strain, originally sent to the University of Washington by Dr. James N. Miller (University of California, Los Angeles, CA) in 1979, was propagated in New Zealand white rabbits as previously described (25). Treponema paraluiscuniculi Cuniculi A strain was isolated from an infected rabbit, provided by Dr. Paul Hardy (Johns Hopkins University, Baltimore, MD), and propagated as above. Treponemes were extracted from infected rabbit testes and DNA isolated as previously described (26). Subtraction Libraries. Subtraction hybridization using PCR technology (representational difference analysis) was performed to enrich for DNA sequences likely to be found in T. pallidum subspecies pallidum, Nichols strain, but not in Treponema paraluiscuniculi. The protocol was followed as described in the manufacturer's instructions (PCR-Select Subtraction Kit; Clontech) except that genomic DNA was substituted for cDNA. All DNA samples were treated with RNAse A before the subtraction experiments. T. pallidum subspecies pallidum DNA was the “tester” DNA; that is, the DNA containing specific sequences that are left behind after subtraction. A mixture of T. paraluiscuniculi DNA plus rabbit genomic DNA was used as the “driver” DNA; that is, the excess DNA used to subtract away the common sequences. Rabbit genomic DNA was included in the driver because treponemes are propagated in rabbits and therefore rabbit DNA contaminates all treponemal samples. After performing the procedure, the resultant PCR products were cloned into the PCR 3.1 T/A cloning vector (Invitrogen). DNA Sequencing of Clones. Double-stranded plasmid DNA was extracted from clones containing inserts using the Qiagen Plasmid Kit (Qiagen). Full automated sequencing of the inserts was performed by the dye terminator method (Perkin Elmer) according to the manufacturer's instructions, except molecular grade dimethylsulfoxide (Sigma Chemical Co.) was added to give a final concentration of 5% vol/vol. The 5′ and 3′ ends of the plasmid inserts were sequenced with the T7 primer (5′ taatacgactcactataggg) and the PCR3.1 reverse primer (5′ tagaaggcacagtcgag). When necessary, sequencing was completed in both directions by making primers complementary to internal sequence as it became available. Two clones, designated 3 and 33, were found to have predicted amino acid homology with the msp of T. denticola (27) and were further evaluated as described below. Comparison with the subsequently released T. pallidum genome (28) indicated that they represent tpr F and tpr G, respectively. Hybridization Analysis. 3 μg of genomic DNA from T. pallidum subspecies pallidum, Nichols strain, and T. paraluiscuniculi, Cuniculi A strain, were digested with the restriction enzymes EcoRI, PstI, and BamHI (New England Biolabs), separated in 1% TBE agarose gels, denatured with 0.5 M NaOH, transferred to Hybond N membrane (Amersham Labs.) and probed separately with inserts from clones 3 and 33 inserts labeled with 32P using the Random Priming Labeling Kit (Boehringer Mannheim) according to the manufacturer's protocol. Hybridization and washing were carried out using high stringency conditions, and specific hybridization was detected by autoradiography. Expression Library Screening. A T. pallidum genomic expression library was constructed and differentially screened as previously reported (29). In brief, the library was prepared using the Lambda ZAP® II cloning kit (Stratagene) according to the manufacturer's instructions. Approximately 200,000 plaques (12,500 PFU/plate) were plated and duplicate lifts prepared and screened using established methods (30). Filters were differentially screened with a T. pallidum–specific immune rabbit serum depleted of activity against the major known treponemal antigens but still retaining its opsonic capacity (termed opsonic rabbit serum; ORS), and a nonopsonic antiserum prepared using heat-killed T. pallidum (termed nonopsonic rabbit serum; non-ORS). The ORS was prepared by sequential adsorption of pooled syphilitic rabbit serum with T. phagedenis, biotype Reiter, recombinant T. pallidum 47-, 37-, 34.5-, 33-, 30-, 17-, and 15-kD molecules (as designated in Table III in reference 2) and recombinant Tromp 1 (6). In unpublished studies from our laboratory, antisera raised against electroeluted or recombinant forms of these antigens failed to demonstrate opsonic function. The antiserum was further adsorbed with VDRL antigen, a lipid complex that has been shown to be the target of a minor portion of opsonic antibodies (31). These adsorption steps were performed to reduce the number of irrelevant positive clones identified by this antiserum in the expression library screening. Immunoreactive plaques were detected with 1 μCi of 125I-labeled protein A on nitrocellulose filters using established methods (30). Clones showing reactivity with the opsonic antiserum but no reactivity with the nonopsonic antiserum were converted to pBluescript SK phagemids and sequenced.
Tpr Sequences and Alignments. Once the genome sequence of the Nichols strain of T. pallidum was released (reference 28 and http://utmmg.med.uth.tmc.edu/treponema/tpall.html), the sequences of the entire open reading frames (ORFs) of the tpr genes were located, and the probable coding regions determined based upon ATG and alternative bacterial start codons, putative ribosomal binding sites, and promoters. These may differ slightly from the ORFs identified in the website. The sequences of the variable domains of the 12 tpr family members were compared. Transmembrane topology analysis of the predicted amino acid sequence of Tpr K was performed using the TMpred program (http://www.isrec.isb-sib.ch/software/BOX_form.html); prediction of signal sequences and their cleavage was performed using the PSORT program (http://psort.nibb.ac.jp:8800)/); and the alignments of the nucleotide and predicted amino acid sequences were performed using the Clustal W program (32). Transcriptional Analysis of the tpr Genes by Reverse Transcription PCR. Reverse transcription (RT)-PCR systems were developed for semiquantitative and qualitative detection of mRNA for the 12 tpr genes of T. pallidum subspecies pallidum. The DNA sequences of all members were aligned and used to design primers specific for each gene. These primers (Table I) are located in the central variable regions of tpr genes from subfamilies I and II (defined in Results), and in the large hydrophilic regions of genes from subfamily III.
Total RNA was extracted from a known number of freshly harvested treponemes followed by treatment of the RNA sample with RNAse free DNAse A (GIBCO BRL). First-strand cDNA was made using Superscript II and random primers (GIBCO BRL), and PCR amplification was performed using primers specific for each tpr. The PCR reactions were standardized using the same number of treponeme equivalents of cDNA for each primer set. This RT-PCR technique has been optimized so that semiquantitative mRNA results can be obtained when amplification is performed for 35 cycles with 500–1,000 treponeme equivalents of cDNA. In careful experiments using limiting dilutions of Nichols strain DNA, we showed that the efficiency of the primer sets was the following: msp 6, 10 > 2, 3, 12 > 1, 4/5, 7, 9, 11 > 8. This control experiment eliminated the possibility that our results showing differential transcription of tpr K in the Nichols strain was due simply to differences in primer efficiency. Multiple independent RT-PCR reactions were performed to rule out experiment-to-experiment variation. PCR was performed using a 100 μl reaction containing 200 μM dNTPs, 50 mM Tris-HCl (pH 9.0 at 20°C), 200 mM NH4SO4, 1 μM of each primer, and 2.5 U of Taq polymerase (Promega Corp.). 2 μl of cDNA containing 500–1,000 treponeme equivalents were used as template. MgCl2 beads (Invitrogen) were added immediately before amplification, giving a final MgCl2 concentration of 1.5 mM. The cycling conditions were as follows: denaturation at 94°C for 3 min, then 94°C for 1 min, 64°C for 2 min, and 72°C for 1 min for 35 cycles. The PCR products were then separated in 3% NuSieve (FMC Bioproducts) agarose gels. Recombinant Expression of the Tpr K Variable Domain. The variable domain of Tpr K was expressed as a recombinant peptide in Escherichia coli. The region of interest (amino acids 37–351) was amplified from Nichols strain DNA using the following primers: sense (5′-atattgaaggctatgcggagctg); antisense (5′-cctcaaggaaagaagtatcagg). The amplicon was cloned directly into the pCR3.1 T/A cloning vector (Invitrogen), sequenced to verify identity and lack of mutations, and subcloned using restriction endonucleases into the pRSET vector (Invitrogen; reference 33). Recombinant expression was induced by 0.4 mM isopropylthiogalactopyranoside during log phase growth at 30°C. Inclusion bodies containing the recombinant protein were isolated and solubilized in 6 M urea, and the recombinant 6-histidine–containing protein was purified by nickel chromatography (33). Immunization of Rabbits for Antisera and Protection Studies. Five adult male New Zealand white rabbits were immunized with the purified Tpr K recombinant variable domain using a total of 150 μg of recombinant peptide per rabbit in Ribi Adjuvant (MPL + TDM + CWS; Sigma Chemical Co.), divided among intradermal, subcutaneous, intramuscular, and intraperitoneal injections according to the manufacturer's instructions. Two additional booster immunizations were given at 3-wk intervals, and antisera were collected 1 wk after the final immunization. Opsonization Experiments. The opsonic activity of the antisera raised against the recombinant Tpr K variable domain were tested as previously described (34). In brief, 2 × 106 proteose peptone– induced rabbit peritoneal macrophages were incubated for 4 h on coverslips with 107 freshly extracted T. pallidum, Nichols strain, and 10% (final concentration) normal rabbit serum (NRS); additionally, 1% (final concentration) anti-Tpr K variable domain or control antisera was added to separate cultures. Control sera included NRS and pooled immune rabbit serum from rabbits infected with T. pallidum, Nichols strain. Macrophages were washed, fixed with ethanol, stained by indirect immunofluorescence for T. pallidum, and examined by a blinded observer by fluorescence microscopy for the presence of fluorescein-labeled treponemal antigen within typical vacuoles within macrophages. Triplicate specimens were prepared for each condition, and 100 macrophages were counted for each coverslip. The results presented represent four separate experiments, each using a different macrophage donor. Mean values (± SEM) for the percentage of macrophages ingesting T. pallidum were calculated and compared for different antisera by Student's t test. Protection Experiments. 3 wk after the last immunization, the five rabbits immunized with recombinant Tpr K variable domain were challenged intradermally at eight sites on the back with 105 T. pallidum, Nichols strain, per site. Five unimmunized syphilis-seronegative control rabbits were simultaneously challenged to determine the development and evolution of lesions in the absence of immunity. The rabbits were observed daily for the development and character of the lesions. Aspiration of the lesions for examination by darkfield microscopy was performed, and syphilis serologic tests were used to assess the presence of inapparent infection. Transfer of lymph nodes and testes tissue from challenged rabbits to naive recipients was also used to detect inapparent infection in some challenged rabbits (35). Results Identification of a New Gene Family in T. pallidum, Nichols strain, with Homology to the T. denticola msp. The tpr gene family was identified in our laboratories by two different approaches, a subtractive library approach and an immunoselective approach. Using the subtractive hybridization technique, we identified several clones of potential interest: two of these clones (clones 3 and 33) were chosen for further study because they had predicted amino acid homology to the msp of T. denticola (27). The translated ORFS of the inserts from clones 3 and 33 aligned with the T. denticola msp antigen near the NH2 and COOH termini, respectively. Southern blots of T. pallidum subspecies pallidum DNA using the clone 3 DNA fragment as a probe demonstrated that at least three different T. pallidum DNA fragments hybridized (data not shown), suggesting that the fragments are associated with a multigene family. The inserts from clones 3 and 33 were later identified as representing fragments of tpr F and tpr G, respectively. The immunologic screening method designed to identify opsonic antigens in a T. pallidum genomic library (29) also identified a gene encoding a Tpr protein. This clone was distinct from clones 3 and 33, leading us to believe that this was another member of a polymorphic msp-homologue gene family. The sequence of this gene was later shown to correspond to tpr K (28). T. pallidum Tpr Proteins Have Conserved and Variable Domains. The clones identified above are completely homologous with 3 of the 12 polymorphic genes identified in the newly released T. pallidum genome (http://utmmg. med.uth.tmc.edu/treponema/tpall.html/; sequence available from EMBL/Genbank/DDBJ under accession No. AE000520; reference 28). Stamm et al. (35a) also submitted the sequence of one of the msp-homologue genes (tpr J) to Genbank (sequence available under accession No. U488957). Three Tpr subfamilies can be identified by their predicted AA homology (Fig. (Fig.1),1
Transmembrane Topology Analysis. The predicted AA sequences of the 12 Tpr proteins were analyzed for potential membrane-spanning regions as well as potential hydrophilic regions that might be exposed to the extracellular environment. Subfamilies I and II have potential membrane-spanning regions in the terminal conserved domains, with hydrophilic regions in the central variable domain. For simplicity of terminology, the central hydrophilic regions will be termed “variable domains” even for subfamily III where the conservation of sequence at the termini is less apparent than for subfamilies I and II. The Tpr K sequence was predicted to have two likely hydrophobic transmembrane helices at amino acid positions 10–29 and 303–323, separated by a large hydrophilic domain (Fig. (Fig.2).2
tpr Genes Are Differentially Transcribed by T. pallidum, Nichols Strain. To examine transcription of the tpr genes in T. pallidum, a group of oligonucleotide primers specific for each of the tpr was prepared (Table I). Fig. Fig.33
Tpr K Variable Domain Is the Target of Opsonic Antibodies. The variable domain of Tpr K was examined as a potential target of opsonic antibodies for three reasons: RT-PCR analysis suggests that it is preferentially expressed in the Nichols strain; it is predicted to have a cleavable signal peptide and be localized to the outer membrane; and structural analysis supports the hypothesis that the hydrophilic regions are exposed on the external face of the outer membrane. In addition, the immunologic screening of the expression library identified Tpr K as being reactive with ORS and not with non-ORS. Antisera obtained from the animals immunized with the recombinant Tpr K variable domain were tested in four separate experiments for opsonic activity. As shown in Fig. Fig.4,4
Immunization with Recombinant Tpr K Variable Domain Is Partially Protective Against T. pallidum Challenge. Be cause Tpr K induces opsonic antibody and because phagocytosis of opsonized bacteria by macrophages is thought to be a major clearance mechanism in syphilis, we investigated the ability of Tpr K to induce protection from challenge with T. pallidum, Nichols strain. Five immunized rabbits and five unimmunized controls were challenged intradermally with 105 per site at eight injection sites per animal. The lesions that appeared in Tpr K-immunized rabbits were atypical, in that they were flat and nonulcerative, and 95% were devoid of T. pallidum by darkfield microscopic examination of aspirates, and healed rapidly compared with control animals (Table III, Fig. Fig.5).5
Discussion The identification of molecules important in syphilis pathogenesis and in protective immunity is critical for understanding the mechanisms by which T. pallidum is able to cause a multistage disease and to establish life-long infection. In this study, we demonstrate that T. pallidum has a polymorphic, multicopy gene family that codes for proteins homologous to the msp of T. denticola. The T. pallidum tpr gene family represents 2% of the organism's total DNA content, a striking proportion in an organism with an unusually small genome (1.1 Mb). The devotion of this proportion of DNA to a gene family, in an organism that has killed numerous metabolic genes during evolution, suggests that the Tpr proteins may play a critical role in T. pallidum survival and virulence. Several lines of evidence support the hypothesis that at least some of the T. pallidum Tpr proteins are located in the outer membrane with surface-exposed variable domains. First, the paralogous msp protein of T. denticola is surface exposed. Second, structural analysis of the predicted amino acid sequences of the Tpr proteins found in the T. pallidum genome shows central hydrophilic variable domains flanked by amphipathic transmembrane helices, suggesting that the variable domain may be surface-exposed. Further analysis of these molecules identified putative cleavable signal peptides in five of the Tpr molecules, and predicted a possible outer membrane location for Tpr F, I, and K. Finally, and most convincingly, antibodies directed against the variable domain of Tpr K have significant opsonic activity for living T. pallidum, thus demonstrating that these variable domains are accessible at the surface of the intact organism. The critical role that the Tpr family plays during infection is perhaps best illustrated by the immune protection experiments described in this study. Tpr K induced significant protection against homologous challenge with the Nichols strain. Although lesions developed at every site in every animal, the lesions that appeared in the immunized animals were quite atypical in that they were very flat and nonulcerative, lacked demonstrable treponemes by darkfield examination of aspirates, and healed rapidly compared with control animals. It is also noteworthy that it is the protective Tpr K that is predominantly transcribed in the Nichols strain used for challenge. It is important to emphasize that none of the immunized animals was completely protected from infection, as they all seroconverted after challenge or had T. pallidum in their lymph nodes and testes detected by microscopy or tissue transfer to another animals. Nonetheless, the degree of alteration of lesion development after immunization is remarkable. It should be noted that the challenge dose used in these studies (nearly 106 treponemes per rabbit) is many logs higher than the rabbit ID50 (51 organisms; reference 35). Experiments are currently underway to examine a challenge dose more analogous to those likely to be encountered in nature. We also provide evidence for the differential transcription (and probable differential expression) of tpr K in the Nichols strain of T. pallidum. Minor mRNA species were also detected in this strain, and higher levels of amplification reveal mRNA for all tpr genes. These results have several implications. First, there is a predominant Tpr antigen that is expressed in a given population of treponemes, rather than uniform expression of all 12 Tpr proteins. This can be predicted to result in a skewing of the immune response toward the predominant antigen. The “minor” tpr transcripts that are detected by RT-PCR in any strain may reflect less robust expression of those proteins in the same bacterial cells that are also expressing the predominant msp homologue, or they may represent a small subpopulation of organisms in which the minor Tpr is the predominantly expressed antigen (“subpopulation hypothesis”). To date, there are no direct data that favor either of these possibilities over the other. The subpopulation hypothesis could explain the natural history of syphilis and some intriguing experimental observations. For example, the majority population is responsible for the development of the primary stage of infection. As the immune response develops to the Tpr antigen expressed on the surface of the majority population, those organism are cleared. This provides a selective advantage for a subpopulation of treponemes that express an alternative surface-localized Tpr antigen and the secondary stage ensues. This cycle can continue again to cause recurrent secondary syphilis, and again in some patients to cause tertiary disease. An analogous situation had been demonstrated for Borrelia hermsii, the spirochete causing relapsing fever (36), and may also occur in the Lyme disease spirochete, Borrelia burgdorferi (37). The subpopulation hypothesis could also explain our earlier findings (38) that T. pallidum harvested from infected rabbit testes in which clearance of the majority of the treponemes has naturally occurred (17 d after infection) are resistant to phagocytosis, whereas treponemes harvested before in vivo clearance occurs are readily opsonized and ingested. The genetic mechanism responsible for regulation of the expression of tpr genes has not yet been defined. The T. pallidum tpr genes have a domain structure that resembles the vsp and vlp gene subfamilies of B. hermsii, with 5′ and 3′ terminal conserved domains flanking central variable domains (39). As happens in B. hermsii, the conserved domains could serve as sites for recombination for antigenic switch, allowing the expression of previously silent variable domains at transcriptionally active expression sites (40–42). Thus, by analogy to other spirochetes, we propose that the T. pallidum subspecies pallidum Tpr proteins may undergo antigenic variation (concerted switching of antigen expression within a strain) and that this mechanism is responsible for the multi-stage nature of syphilis. It is also possible that T. pallidum undergoes phase variation (switching gene expression on and off) of the tpr genes. This mechanism would provide an alternative explanation for the development and survival of a subpopulation of treponemes that can resist opsonization and phagocytosis (38) and survive to cause persistent infection. For example, if Tpr molecules are necessary for attachment to host cells, they may be expressed during establishment of infection, but may be unnecessary and turned off during the prolonged latent stage. Appearance of the secondary and tertiary manifestations may be due to renewed Tpr expression (of a different antigenic specificity than during the primary stage) in organisms from latent infection, or alternatively, due to outgrowth of a pre-existing Tpr-expressing subpopulation that has not yet been recognized by the immune system (antigenic variation). Furthermore, expression of specific Tpr molecules may confer tissue tropism on T. pallidum, analogous to the situation in Borrelia turicatae (43) in which a single vsp gene is expressed in neurotropic organisms. Yet another form of antigenic diversity results from antigenic drift (slower minor changes in epitope composition that occur during strain divergence in evolution and lead to strain-to-strain antigenic differences). This may occur by random mutational events or by recombination within the tpr gene family. There are already data to suggest that antigenic drift of tpr occurs. Restriction fragment length polymorphism analysis of a tpr gene has revealed different restriction patterns between strains of T. pallidum subspecies pallidum (44 and our unpublished results). Furthermore, sequence heterogeneity and the presence of multiple tpr K alleles in other strains has been demonstrated in our laboratory (unpublished results). In summary, we describe the identification of a polymorphic, multi-membered gene family in T. pallidum subspecies pallidum. Tpr K is preferentially transcribed in the Nichols strain, and its encoded protein serves as a target of opsonic antibody, induces significant protection against infectious challenge, and is likely to be surface exposed. This gene family appears to be central to the pathogenesis of syphilis and may contribute to antigenic diversity of T. pallidum. Acknowledgments We thank Sally Post for manuscript preparation. This study was supported by Public Health Service grants AI42143, AI18988, and AI34616 from the National Institutes of Health (S.A. Lukehart) and a Sexually Transmitted Diseases Cooperative Research Center New Investigator Award AI31448 from the National Institutes of Health (A. Centurion-Lara). Abbreviations used in this paper
References 1. Cox DL, Chang P, McDowall AW, Radolf JD. The outer membrane, not a coat of host proteins, limits antigenicity of virulent Treponema pallidum. . Infect Immun. 1992;60:1076–1083. [PubMed] 2. Norris SJ, Alderete JF, Axelsen NH, Bailey MJ, Baker-Zander SA, Baseman JB, Bassford PJ, Baughn RE, Cockayne A, Hanff PA, et al. Identity of Treponema pallidum subsp. pallidumpolypeptides: correlation of sodium dodecyl sulfate-polyacrylamide gel electrophoresis results from different laboratories. Electrophoresis. 1987;8:77–92. 3. Radolf JD, Norgard MV, Schultz WW. Outer membrane ultrastructure explains the limited antigenicity of virulent Treponema pallidum. . Proc Natl Acad Sci USA. 1989;86:2051–2055. [PubMed] 4. Walker EM, Zampighi GA, Blanco DR, Miller JN, Lovett MA. Demonstration of rare protein in the outer membrane of Treponema pallidum subsp. pallidumby freeze-fracture analysis. J Bacteriol. 1989;171:5005–5011. [PubMed] 5. Radolf JD. Treponema pallidumand the quest for outer membrane proteins. Mol Microbiol. 1995;16:1067–1073. [PubMed] 6. Blanco DR, Champion CI, Exner MM, Shang ES, Skare JT, Hancock RE, Miller JN, Lovett MA. Recombinant Treponema pallidum rare outer membrane protein 1 (Tromp1) expressed in Escherichia colihas porin activity and surface antigen exposure. J Bacteriol. 1996;178:6685–6692. [PubMed] 7. Champion CI, Blanco DR, Exner MM, Erdjument-Bromage H, Hancock REW, Tempst P, Miller JN, Lovett MA. Sequence analysis and recombinant expression of a 28-kilodalton Treponema pallidum subsp. pallidumrare outer membrane protein (Tromp2). J Bacteriol. 1997;179:1230–1238. [PubMed] 8. Hardham JM, Stamm LV, Porcella SF, Frye JG, Barnes NY, Howel JK, Muller SL, Radolf JD, Weinstock GM, Norris SJ. Identification and transcriptional analysis of a Treponema pallidumoperon encoding a putative ABC transport system, an iron-activated repressor protein homolog, and a glycolytic pathway enzyme homolog. Gene. 1997;197:47–64. [PubMed] 9. Akins DR, Robinson E, Shevchenko D, Elkins C, Cox DL, Radolf JD. Tromp1, a putative rare outer membrane protein, is anchored by an uncleaved signal sequence to the Treponema pallidumcytoplasmic membrane. J Bacteriol. 1997;179:5076–5086. [PubMed] 10. Shevchenko DV, Akins DR, Robinson EJ, Li M, Shevchenko OV, Radolf JD. Identification of homologs for thioredoxin, peptidyl prolyl cis-trans isomerase, and glycerophosphodieter phosphodiesterase in outer membrane fractions from Treponema pallidum, the syphilis spirochete. Infect Immun. 1997;65:4179–4189. [PubMed] 11. Radolf JD, Robinson EJ, Bourell KW, Akins DR, Porcella SF, Weigel LM, Jones JD, Norgard MV. Characterization of outer membranes isolated from Treponema pallidum, the syphilis spirochete. Infect Immun. 1995;63:4244–4252. [PubMed] 12. Radolf JD, Chamberlain NR, Clausell A, Norgard MV. Identification and localization of integral membrane proteins of virulent Treponema pallidum subsp. pallidumby phase partitioning with the nonionic detergent Triton X-114. Infect Immun. 1988;56:490–498. [PubMed] 13. Blanco DR, Reimann K, Skare J, Champion CI, Foley D, Exner MM, Hancock REW, Miller JM, Lovett MA. Isolation of the outer membranes from Treponema pallidum and Treponema vincentii. . J Bacteriol. 1994;176:6088–6099. [PubMed] 14. Blanco DR, Giladi M, Champion CI, Haake DA, Chikami GK, Miller JN, Lovett MA. Identification of Treponema pallidum subspecies pallidumgenes encoding signal peptides and membrane-spanning sequences using a novel alkaline phosphatase expression vector. Mol Microbiol. 1991;5:2405–2415. [PubMed] 15. Wong GH, Steiner B, Graves S. Effect of syphilitic rabbit sera taken at different periods after infection on treponemal motility, treponemal attachment to mammalian cells in vitro, and treponemal infection in rabbits. Br J Vener Dis. 1983;59:220–224. [PubMed] 16. Fitzgerald TJ, Replesh LA, Blanco DR, Miller JN. Attachment of Treponema pallidumto fibronectin, laminin, collagen IV, and collagen I, and blockage of attachment by immune rabbit IgG. Br J Vener Dis. 1984;60:357–363. [PubMed] 17. Lukehart SA, Miller JN. Demonstration of the in vitro phagocytosis of Treponema pallidumby rabbit peritoneal macrophages. J Immunol. 1978;121:2014–2024. [PubMed] 18. Baker-Zander SA, Lukehart SA. Macrophage-mediated killing of opsonized Treponema pallidum. . J Infect Dis. 1992;165:69–74. [PubMed] 19. Bishop NH, Miller JN. Humoral immunity in experimental syphilis. II. The relationship of neutralizing factors in immune serum to acquired resistance. J Immunol. 1976;117:197–207. [PubMed] 20. Blanco DR, Miller JN, Hanff PA. Humoral immunity in experimental syphilis: the demonstration of IgG as a treponemicidal factor in immune rabbit serum. J Immunol. 1984;133:2693–2697. [PubMed] 21. Blanco DR, Walker EM, Haake DA, Champion CI, Miller JN, Lovett MA. Complement activation limits the rate of in vitro treponemicidal activity and correlates with antibody-mediated aggregation of Treponema pallidumrare outer membrane protein. J Immunol. 1990;144:1914–1921. [PubMed] 22. Lukehart SA, Baker-Zander SA, Lloyd RMC, Sell S. Characterization of lymphocyte responsiveness in early experimental syphilis. II. Nature of cellular infiltrations and Treponema pallidumdistribution in testicular infection. J Immunol. 1980;124:461–467. [PubMed] 23. Lukehart, S.A. 1992. Immunology and pathogenesis of syphilis. In Advances in Host Defense Mechanisms, vol. 8: Sexually Transmitted Diseases. T.C. Quinn, J.I. Gallin, and A.S. Fauci, editors. Raven Press, New York. 141–163. 24. Van Voorhis WC, Barrett LK, Koelle DM, Nasio JM, Plummer FA, Lukehart SA. Primary and secondary syphilis lesions contain mRNA for Th1 cytokines. J Infect Dis. 1996;173:491–495. [PubMed] 25. Lukehart SA, Baker-Zander SA, Sell S. Characterization of lymphocyte responsiveness in early experimental syphilis. I. In vitro response to mitogens and Treponema pallidumantigens. J Immunol. 1980;124:454–460. [PubMed] 26. Centurion-Lara A, Castro C, Van Voorhis WC, Lukehart SA. Two 16S-23S ribosomal DNA intergenic regions in different Treponema pallidum subspecies contain tRNAgenes. FEMS Microbiol Lett. 1997;143:235–240. 27. Fenno, J.C., K.H. Muller, and B.C. McBride. Sequence analysis, expression, and binding activity of recombinant major outer sheath protein (Msp) of Treponema denticola. J. Bacteriol. 178:2489–2497. 28. Fraser CM, Norris SJ, Weinstock GM, White O, Sutto GG, Dodson R, Gwinn M, Hickey EK, Clayton R, Ketchum KA, et al. Complete genome sequence of Treponema pallidum, the syphilis spirochete. Science. 1998;281:375–388. [PubMed] 29. Stebeck CE, Shaffer JM, Arrol TW, Lukehart SA, Van Voorhis WC. Identification of the Treponema pallidum subsp. pallidumglycerophosphodiester phosphodiesterase homologue. FEMS Microbiol Lett. 1997;154:303–310. [PubMed] 30. Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 31. Baker-Zander SA, Shaffer JM, Lukehart SA. VDRL antibodies enhance phagocytosis of Treponema pallidumby macrophages. J Infect Dis. 1993;167:1100–1105. [PubMed] 32. Thompson JD, Higgins DG, Gibson TJ. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties, and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. [PubMed] 33. Kroll DJ, Abdel-Malek H, Abdel-Hafiz, Marcell T, Simpson S, Chen CY, Guiterrez-Hartmann A, Lustbader JW, Hoeffler JP. A multifunctional prokaryotic protein expression system: overproduction, affinity purification, and selective detection. DNA Cell Biol. 1993;12:441–453. [PubMed] 34. Shaffer JM, Baker-Zander SA, Lukehart SA. Opsonization of Treponema pallidumis mediated by IgG antibodies induced only by pathogenic treponemes. Infect Immun. 1993;61:781–784. [PubMed] 35. Turner TB, Hardy PH, Newman B. Infectivity tests in syphilis. Br J Vener Dis. 1969;45:183–196. [PubMed] 35a. Stamm LV, Greene SR, Bergen HL, Hardham JM, Barnes NY. Identification and sequence analysis of Treponema pallidum tprJ, a member of a polymorphic multigene family. FEMS Microbiol Lett. 1998;169:155–163. [PubMed] 36. Donelson JE. Mechanisms of antigenic variation in Borrelia hermsiiand African trypanosomes. J Biol Chem. 1995;270:7783–7786. [PubMed] 37. Zhang J-R, Hardham JM, Barbour AG, Norris SJ. Antigenic variation in Lyme disease Borreliae by promiscuous recombination of VMP-like sequence cassettes. Cell. 1997;89:275–285. [PubMed] 38. Lukehart SA, Shaffer JM, Baker-Zander SA. A subpopulation of Treponema pallidumis resistant to phagocytosis: possible mechanisms of persistence. J Infect Dis. 1992;166:1449–1453. [PubMed] 39. Hinnebusch BJ, Barbour AG, Restrepo BI, Schwan TG. Population structure of the relapsing fever spirochete Borrelia hermsiias indicated by polymorphism of two multigene families that encode immunogenic outer surface lipoproteins. Infect Immun. 1998;66:432–440. [PubMed] 40. Barbour AG, Burman N, Carter CJ, Kitten T, Bergstrom S. Variable antigen genes of the relapsing fever agent Borrelia hermsiiare activated by promoter addition. Mol Microbiol. 1991;5:489–493. [PubMed] 41. Meier JT, Simon MI, Barbour AG. Antigenic variation is associated with DNA rearrangements in a relapsing fever Borrelia. . Cell. 1985;41:403–409. [PubMed] 42. Plasterk RHA, Simon MI, Barbour AG. Transposition of structural genes to an expression sequence on a linear plasmid causes antigenic variation in the bacterium Borrelia hermsii. . Nature. 1985;318:257–263. [PubMed] 43. Cadavid D, Thomas DD, Crawley R, Barbour AG. Variability of a bacterial surface protein and disease expression in a possible mouse model of systemic Lyme Borreliosis. J Exp Med. 1994;179:631–642. [PubMed] 44. Pillay A, Liu H, Chen CY, Holloway B, Sturm AW, Steiner B, Morse SA. Molecular subtyping of T. pallidum subsp. pallidum. . Sex Transm Dis. 1997;25:408–414. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
||||||||||||||||||||||||||||||||||
Infect Immun. 1992 Mar; 60(3):1076-83.
[Infect Immun. 1992]Proc Natl Acad Sci U S A. 1989 Mar; 86(6):2051-5.
[Proc Natl Acad Sci U S A. 1989]J Bacteriol. 1989 Sep; 171(9):5005-11.
[J Bacteriol. 1989]Mol Microbiol. 1995 Jun; 16(6):1067-73.
[Mol Microbiol. 1995]J Bacteriol. 1996 Dec; 178(23):6685-92.
[J Bacteriol. 1996]Br J Vener Dis. 1983 Aug; 59(4):220-4.
[Br J Vener Dis. 1983]Br J Vener Dis. 1984 Dec; 60(6):357-63.
[Br J Vener Dis. 1984]J Immunol. 1978 Nov; 121(5):2014-24.
[J Immunol. 1978]J Infect Dis. 1992 Jan; 165(1):69-74.
[J Infect Dis. 1992]J Immunol. 1976 Jul; 117(1):197-207.
[J Immunol. 1976]J Immunol. 1980 Jan; 124(1):454-60.
[J Immunol. 1980]Science. 1998 Jul 17; 281(5375):375-88.
[Science. 1998]FEMS Microbiol Lett. 1997 Sep 15; 154(2):303-10.
[FEMS Microbiol Lett. 1997]J Bacteriol. 1996 Dec; 178(23):6685-92.
[J Bacteriol. 1996]J Infect Dis. 1993 May; 167(5):1100-5.
[J Infect Dis. 1993]Science. 1998 Jul 17; 281(5375):375-88.
[Science. 1998]Nucleic Acids Res. 1994 Nov 11; 22(22):4673-80.
[Nucleic Acids Res. 1994]DNA Cell Biol. 1993 Jun; 12(5):441-53.
[DNA Cell Biol. 1993]Infect Immun. 1993 Feb; 61(2):781-4.
[Infect Immun. 1993]Br J Vener Dis. 1969 Sep; 45(3):183-95.
[Br J Vener Dis. 1969]FEMS Microbiol Lett. 1997 Sep 15; 154(2):303-10.
[FEMS Microbiol Lett. 1997]Science. 1998 Jul 17; 281(5375):375-88.
[Science. 1998]Science. 1998 Jul 17; 281(5375):375-88.
[Science. 1998]FEMS Microbiol Lett. 1998 Dec 1; 169(1):155-63.
[FEMS Microbiol Lett. 1998]Br J Vener Dis. 1969 Sep; 45(3):183-95.
[Br J Vener Dis. 1969]J Biol Chem. 1995 Apr 7; 270(14):7783-6.
[J Biol Chem. 1995]Cell. 1997 Apr 18; 89(2):275-85.
[Cell. 1997]J Infect Dis. 1992 Dec; 166(6):1449-53.
[J Infect Dis. 1992]Infect Immun. 1998 Feb; 66(2):432-40.
[Infect Immun. 1998]Mol Microbiol. 1991 Feb; 5(2):489-93.
[Mol Microbiol. 1991]Nature. 1985 Nov 21-27; 318(6043):257-63.
[Nature. 1985]J Infect Dis. 1992 Dec; 166(6):1449-53.
[J Infect Dis. 1992]J Exp Med. 1994 Feb 1; 179(2):631-42.
[J Exp Med. 1994]Cell. 1985 Jun; 41(2):403-9.
[Cell. 1985]