pmc logo image
Logo of plosbiolPLoS BiologySubmit to PLoSGet E-mail AlertsContact UsPublic Library of Science (PLoS)View this Article
Journal List > PLoS Biol > v.6(1); Jan 2008

Formats:
PLoS Biol. 2008 January; 6(1): e2.
Published online 2008 January 8. doi: 10.1371/journal.pbio.0060002.
PMCID: PMC2174969
Copyright : © 2008 Papanayotou et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
A Mechanism Regulating the Onset of Sox2 Expression in the Embryonic Neural Plate
Costis Papanayotou,1 Anne Mey,2,3 Anne-Marie Birot,2,3 Yasushi Saka,4 Sharon Boast,1 Jim C Smith,4 Jacques Samarut,2,3 and Claudio D Stern1*
1 Department of Anatomy & Developmental Biology, University College London, London, United Kingdom
2 Institut de Génomique Fonctionnelle de Lyon, Université de Lyon, Lyon, France
3 Ecole Normale Supérieure de Lyon, CNRS/INRA, Lyon, France
4 Wellcome/Cancer Research UK Gurdon Institute for Cancer and Developmental Biology, Cambridge, United Kingdom
Marianne Bronner-Fraser, Academic Editor
California Institute of Technology, United States of America
* To whom correspondence should be addressed. E-mail: c.stern/at/ucl.ac.uk
Received May 8, 2007; Accepted November 26, 2007.
Small right arrow pointing to: This article has been cited by other articles in PMC.
Abstract
In vertebrate embryos, the earliest definitive marker for the neural plate, which will give rise to the entire central nervous system, is the transcription factor Sox2. Although some of the extracellular signals that regulate neural plate fate have been identified, we know very little about the mechanisms controlling Sox2 expression and thus neural plate identity. Here, we use electroporation for gain- and loss-of-function in the chick embryo, in combination with bimolecular fluorescence complementation, two-hybrid screens, chromatin immunoprecipitation, and reporter assays to study protein interactions that regulate expression of N2, the earliest enhancer of Sox2 to be activated and which directs expression to the largest part of the neural plate. We show that interactions between three coiled-coil domain proteins (ERNI, Geminin, and BERT), the heterochromatin proteins HP1α and HP1γ acting as repressors, and the chromatin-remodeling enzyme Brm acting as activator control the N2 enhancer. We propose that this mechanism regulates the timing of Sox2 expression as part of the process of establishing neural plate identity.
Author Summary
During early development, when the embryo has three layers of cells (ectoderm, mesoderm, and endoderm), a region of the ectoderm called the neural plate becomes specified to generate the entire nervous system. One of the earliest molecular markers for the neural plate is the transcription factor Sox2, which is critical for cells to acquire their neural fates and also defines neural progenitor character. We know very little about the intracellular mechanisms by which the neural plate cells acquire these fates. Here, we show that recruitment of transcriptional repressors to chromatin-remodeling complexes regulate the onset of Sox2 expression. Competitive interactions between three proteins, ERNI, BERT, and Geminin, modulate the choice of repressors and regulate Sox2 expression. During gastrulation, when the three embryonic cell layers form, ERNI recruits the repressor HP1γ to prevent Geminin from activating Sox2 prematurely. By the end of gastrulation, this repression is counteracted by competitive binding of BERT to ERNI and Geminin, causing activation of Sox2. We propose that this mechanism regulates the timing of Sox2 activation in the very early neural plate and thus helps to define the domain that will give rise to the nervous system.
Sox2 is a transcription factor that plays multiple critical roles during embryonic development in vertebrates. In embryonic stem (ES) cells, as well as in adult central nervous system (CNS) stem cells, Sox2 expression is required for the maintenance of multipotency and for the ability of cells to self-renew [1]. Sox2 is also expressed in cells that retain their ability to proliferate and/or acquire glial fates, whereas it is down-regulated in cells that become postmitotic and differentiate into neurons [2–4]. In addition, it is also transiently expressed outside the CNS in cranial sensory organs derived from the placodes and in subsets of peripheral nervous system (PNS) cells [5,6].
In all vertebrates studied to date, Sox2 is also a general marker for the very early developing neural plate. In the chick, for example, Sox2 expression starts at the late primitive streak stage (stages 4–4+ [7]) in the future neural territory [8,9]. A morphologically recognizable neural plate only becomes visible after the beginning of Sox2 expression [8]. Importantly, Sox2 function is required for development of the neural plate [10]. Time-course experiments have shown that induction of Sox2 requires the same period of exposure to organizer-derived signals (the tissue responsible for inducing the neural plate in the normal embryo [11–13]) as is required to induce a mature neural plate [14–17]. For these reasons, Sox2 is considered to be the earliest definitive marker for the neural plate [18,19].
The complex expression profile of Sox2 is controlled by multiple regulatory elements, each responsible for directing expression to a specific subset of expression sites. A very compelling analysis of the noncoding regions of Sox2 in the chick embryo [20] revealed as many as 25 distinct conserved enhancers, of which two account for the expression of this gene in the early neural plate at stages 4+–5. One of these enhancers, named N2, is responsible for the initial expression (stage 4–4+) and is activated in a large domain corresponding to the entire forebrain/midbrain and most of the hindbrain. The other, N1, drives expression in the future caudal hindbrain and spinal cord and is activated a little later (around stage 5) [20,21]. To understand the processes that define the neural plate, it is essential to understand how the activity of these two elements, and especially N2, is regulated in the embryo.
Analysis of the N2 enhancer reveals multiple putative binding sites for known transcription factors [20,21]. However, the spatial and temporal expression patterns of these factors do not provide an obvious explanation for the time of onset of Sox2 expression in normal development (unpublished data). Furthermore, to date, no single secreted factor or any combination thereof has been found to induce either Sox2 expression or a neural plate in competent cells not normally fated to form part of the neural plate [13,19]. We therefore directed our attention to nuclear factors that might regulate this enhancer. Here, we provide evidence that a group of coiled-coil proteins interact with each other and with chromatin-remodeling factors and heterochromatin proteins to regulate the activity of the N2 enhancer. We propose that this is part of a mechanism that regulates the time of onset of expression of Sox2 in the nascent neural plate.
HP1α Inhibits Sox2 Expression through a Brm-Dependent Mechanism
A recent study [22] using the P19 cell line demonstrated that the chromatin-remodeling enzyme Brahma (Brm) can activate Sox2 by binding directly to the N2 enhancer. Is Brahma also involved in regulating Sox2 expression in the normal embryo? To test this, we introduced a mutated version of Brahma (BrmK755R, which does not bind ATP and is therefore unable to remodel chromatin [23]) by electroporation into the prospective neural plate of embryos at stage 3–3+. This resulted in strong inhibition of Sox2 expression in the electroporated domain (Figure 1Figure 1A and and1B;1Figure 1B; 5/6), unlike controls electroporated with green fluorescent protein (GFP) (Figure 1Figure 1C and and1D;1Figure 1D; 0/5 expressing).
Figure 1
Figure 1
Figure 1
HP1α Inhibits Sox2
However, Brm is expressed ubiquitously in the embryo [24]; what mechanisms prevent premature expression of Sox2? A good candidate is the transcriptional repressor HP1α, which binds directly to Brahma-related proteins at a highly conserved site [25] and which is also ubiquitously expressed in early embryos (Figure 2Figure 2). Consistent with this, overexpression of HP1α in the neural plate represses Sox2 (Figure 1Figure 1E and and1F;1Figure 1F; 3/3). Could HP1α be an endogenous inhibitor of Sox2 expression? To address this, we took advantage of the fact that both the chromoshadow domain and the chromodomain are necessary for the function of HP1 proteins [26,27]: targeting to chromatin requires interaction of the chromoshadow domain with a chromatin-tethered partner, as well as binding of the chromodomain to a methylated Lys9 of histone H3 [28]. We therefore made a dominant-negative form of HP1α (ΔHP1α) consisting of its isolated chromoshadow domain (which can bind to Brahma-related proteins but lacks repressor activity [25]). When ΔHP1α is misexpressed as a line extending from the neural plate into the peripheral, nonneural ectoderm (see Materials and Methods, “Design of assays”), Sox2 is induced (Figure 1Figure 1G and and1H;1Figure 1H; 6/7), whereas similar electroporation of GFP has no effect (Figure 1Figure 1I and and1J;1Figure 1J; 0/8). This suggests that HP1α activity is required to prevent expression of Sox2 in the nonneural ectoderm.
Figure 2
Figure 2
Figure 2
Expression of HP1α during Normal Development
In embryos in which ΔHP1α was expressed as a line, we observed that Sox2 was up-regulated, not only in the embryonic nonneural ectoderm (prospective epidermis), but also in the more peripheral area opaca epiblast (extraembryonic ectoderm) (Figure 1Figure 1G). We were surprised by this observation because until now, various factors (such as bone morphogenetic protein [BMP] antagonists [16,17,19]) have been described that can expand the neural plate domain, but never as far as the extraembryonic epiblast, and none can induce a separate domain of Sox2 expression in this region. The only treatment described to date that can induce neural markers in the area opaca is a graft of the organizer, Hensen's node, which is able to generate a complete, patterned nervous system in this region [13,29–32]. These observations define the area opaca as a particularly rigorous location in which to test for the neural inducing ability of factors (see Materials and Methods, “Design of assays”). Electroporation of ΔHP1α in this region dramatically induces Sox2, showing that HP1α normally represses Sox2 expression (Figure 1Figure 1K and and1L;1Figure 1L; 8/8). In contrast, electroporation of GFP in the same region has no effect (Figure 1Figure 1M and and1N;1Figure 1N; 0/10). As an additional control, since HP1α may have more general activity as a transcriptional repressor, we also tested whether ΔHP1α can also induce other early embryonic genes using Brachyury, a marker for mesoderm expressed at this stage of development. It did not (Figure 1Figure 1O and and1P;1Figure 1P; 0/3). This result also confirms that the induction of Sox2 is direct, rather than a consequence of prior induction of mesoderm by ΔHP1α. Likewise, electroporation of BrmK755R or Brm had no effect on neural or mesoderm markers (0/5 for each; unpublished data). To test whether the inducing activity of ΔHP1α requires Brahma, we introduced ΔHP1α together with BrmK755R. This combination fails to induce Sox2 (Figure 1Figure 1Q and and1R;1Figure 1R; 0/12), suggesting that HP1α normally inhibits Sox2 expression through a Brm-dependent mechanism (Figure 1Figure 1S).
Geminin Induces Sox2 by a Brm-Dependent Mechanism
In Xenopus, the gene encoding the coiled-coil protein Geminin is expressed in the early prospective neural plate, and its misexpression induces neural markers [33]. More recently, it has been shown that Geminin interacts genetically with Drosophila Brahma, that it binds directly to its vertebrate homologs Brg1 and Brm (at the same site as does HP1α), and that Geminin knock-down abolishes Sox2 expression [25,34]. Could Geminin be responsible for releasing the repression of Brm activity by HP1α? To test this, we cloned the chick homolog of Geminin. Before and during early gastrulation, Geminin is expressed in a large domain, which then (from stages 4–4+) becomes restricted to the neural plate (Figure 3Figure 3). The early expression of chick Geminin resembles that of “pre-neural” genes (such as Sox3, ERNI, and Churchill), which precede the initiation of Sox2 expression and which are induced by fibroblast growth factor 8 (FGF8) [8,9,35,36]. We therefore tested whether FGF can also induce Geminin. Indeed, Geminin can be induced by FGF8-soaked beads (9/10; Figure 3Figure 3H, arrow), but not by control beads (0/10; Figure 3Figure 3H, arrowhead).
Figure 3
Figure 3
Figure 3
Expression of Chick Geminin during Normal Development and Its Regulation by FGF
When misexpressed as a line extending laterally from the neural plate, Geminin strongly induces ectopic Sox2 (Figure 4Figure 4A and and4B;4Figure 4B; 8/8). Geminin can also strongly induce Sox2 expression when introduced into the extraembryonic epiblast (Figure 4Figure 4C and and4D;4Figure 4D; 20/20). To test whether this induction requires the chromatin-remodeling activity of Brm, we cointroduced Geminin and BrmK755R: the mutated chromatin remodeler abolishes the induction of Sox2 by Geminin (Figure 4Figure 4E and and4F;4Figure 4F; 0/15), suggesting that Brm activity is required for Sox2 induction by Geminin. Together, these results suggest that early in development Sox2 expression is constitutively repressed by the presence of HP1α bound to Brm at the N2 enhancer of Sox2, and that later in development, FGF may release this inhibition through induction of Geminin, which competes HP1α away from the protein complex (Figure 4Figure 4G).
Figure 4
Figure 4
Figure 4
Geminin Induces Sox2
ERNI Inhibits Sox2 Induction by Geminin
Geminin is already expressed at the beginning of gastrulation (Figure 3Figure 3), long before Sox2 (which appears at stage 4 [8,9]), suggesting that an additional mechanism must exist to prevent premature Sox2 activation. A good candidate for this repression is ERNI, which is broadly expressed in the epiblast at early stages but is rapidly down-regulated from the prospective neural plate at stage 4+ [36], around the time when Sox2 starts to be expressed. To test whether ERNI can inhibit the induction of Sox2 by Geminin, we cointroduced them into the area opaca: ERNI does indeed inhibit the induction of Sox2 by Geminin (6/14 with very weak induction, 8/14 with no induction; Figure 5Figure 5A–5Figure 5C).
Figure 5
Figure 5
Figure 5
ERNI Blocks Induction of Sox2 by Geminin
Mechanism of Repression by ERNI
ERNI and Geminin bind through their coiled-coil domains.
By what mechanism does ERNI exert its inhibition? ERNI contains two putative functional domains: a coiled-coil domain in its N-terminal half (amino acids [aa] 79–137) and a likely phosphorylation site (aa 222–228) [36]. Since coiled-coil domains are often involved in protein–protein interactions, and since both ERNI and Geminin contain such a domain, we tested the possibility that ERNI can bind to Geminin and/or to itself. As no antibodies to ERNI or chick Geminin are available, precluding coimmunoprecipitation assays, we used bimolecular fluorescence complementation (BiFCo), a powerful technique allowing protein interactions to be visualized within living cells [37,38]. All possible combinations of ERNI and Geminin fusions to the N- and C-termini of the yellow fluorescent protein (YFP) variant Venus [39] were transfected pairwise into COS cells so that whenever an interaction occurs, fluorescence is seen. This revealed that ERNI and Geminin can associate as homo- or heterodimers, unlike several controls, including other coiled-coil proteins (Table 1). The same results were obtained in vivo when the constructs are electroporated into early chick embryos (unpublished data). To test whether this interaction occurs through the coiled-coil domain, we repeated this experiment using the isolated coiled-coil domains of ERNI and Geminin. This revealed that the isolated coiled-coil domains of ERNI and Geminin are sufficient for their homo- and heterodimerization (Table 1).
Table 1
Table 1
Protein–Protein Interactions Confirmed by BiFCo
The C-terminus of ERNI is important for its function.
Since ERNI lacks any recognizable repression motif, it is possible that it antagonizes the activity of Geminin by recruiting other proteins that interact with regions outside the coiled-coil domain (which is involved in binding to Geminin) (Figure 5Figure 5C). If so, constructs lacking regions outside the coiled-coil domain should still bind to Geminin but fail to recruit the repressor(s), therefore acting as dominant-negative forms. To test this, we misexpressed the isolated coiled-coil (ERNIcc) by electroporation in late primitive streak stage chick embryos. This induces strong expression of Sox2 (Figure 6Figure 6A and and6B;6Figure 6B; 12/12), unlike full-length ERNI (Figure 6Figure 6C and and6D;6Figure 6D; 0/8) or GFP alone (Figure 6Figure 6E and and6F;6Figure 6F; 0/8). ERNIcc did not induce expression of other markers (Brachyury (0/6), Chordin (0/4), or BMP4 (0/5); unpublished data), confirming that the induction of Sox2 by ERNIcc is direct and specific. Misexpression of ERNI containing a point mutation in the putative phosphorylation site (ERNIY228F) has the same effect as misexpression of the isolated coiled-coil domain (Figure 6Figure 6G and and6H;6Figure 6H; 9/9), suggesting that ERNI phosphorylation is important for its function.
Figure 6
Figure 6
Figure 6
Mutated Forms of ERNI Induce Sox2
HP1γ binds to the C-terminus of ERNI and is required for repression of Sox2.
The above results predict that ERNI might inhibit Sox2 by recruiting one or more inhibitory proteins to the complex (Figure 5Figure 5C). To identify such an inhibitor, expressed at very early stages of development, we took advantage of the fact that ERNI is also strongly expressed in undifferentiated chicken embryonic stem (cES) cells (where it was identified as ENS-1 [40]). We therefore undertook a two-hybrid screen using ENS-1 as bait and a cDNA library from undifferentiated cES cells. This identified, among several candidates, CHCB2, the chick homolog of HP1γ, a chromatin modifier with repressor activity [41] (Figure 7Figure 7A). HP1γ is related to HP1α but does not bind directly to Brahma-related proteins [25]. Further two-hybrid assays using an ERNI/ENS-1 clone confirmed (see above and Table 1) that ERNI can form homodimers and that this interaction requires the coiled-coil domain. In contrast, interaction with HP1γ is mediated by a short sequence (HP1-box, PxVxL [28]) close to the C-terminus of ERNI (Figure 7Figure 7A and and7B).7Figure 7B). The related protein HP1β does not bind significantly to ERNI in the same assay (unpublished data). HP1γ interacts with ERNI through the chromoshadow domain [42,43] of the former (unpublished data). To confirm these interactions by an independent method, we used BiFCo in cES cells, which showed that HP1γ can bind to full-length ERNI, but not to ERNI with a mutated HP1-box (Table 1). We also used this method to test whether ERNI can bind to HP1α: no significant binding was seen (unpublished data). These findings suggest that ERNI inhibits Sox2 expression by binding to Geminin through their respective coiled-coil domains and by specific recruitment of the HP1γ repressor through a C-terminal HP1-box.
Figure 7
Figure 7
Figure 7
ERNI Inhibits Sox2 through HP1γ
These findings predict that a dominant-negative form of HP1γ (comprising the chromoshadow domain but lacking the chromodomain, which is required for repression [26–28]) should be able to relieve the inhibition by ERNI of Sox2 induction by Geminin (see above and Figure 5Figure 5A–5Figure 5C). To test this, we coelectroporated Geminin and ERNI together with the isolated chromoshadow domain of HP1γ (ΔHP1γ) into the area opaca. This combination of factors induces Sox2 (Figure 7Figure 7C and and7D;7Figure 7D; 7/8), suggesting that HP1γ is indeed required for the inhibitory activity of ERNI (Figure 7Figure 7E).
Is HP1γ expressed at the right time and place to play a role in regulating the onset of Sox2 expression? In situ hybridization reveals low-level, ubiquitous expression from early primitive streak stages, increasing in the prospective neural epiblast from stage 3+–4 (Figure 8Figure 8).
Figure 8
Figure 8
Figure 8
Expression of HP1γ during Normal Development
BERT, an Endogenous ERNI Antagonist
The above findings are consistent with the idea that ERNI normally functions to repress Sox2 expression at very early stages of development. However, it is unlikely that down-regulation of ERNI transcription is sufficient to relieve this inhibition because Sox2 expression begins at stages 4–4+ [7], when some ERNI transcripts can still be detected within the prospective neural plate [36]. Therefore, an endogenous inhibitor is likely to exist whose expression should begin at around this time (stage 4–4+). To identify such an inhibitor, a two-hybrid screen was performed using ERNI as bait and a library of cDNAs from stage 3–6 chick embryos (Figure 9Figure 9A). Only one partner was found, encoding a small coiled-coil domain protein which we named BERT (Figure 9Figure 9B). An equivalent human protein (SCOCO, corresponding to the fragment shown in bold in Figure 9Figure 9B) was previously isolated as a partner of human ARL1, a component of the Golgi apparatus [44], and a nematode homolog (unc69) was found to be essential for neural development [45]. BERT is expressed ubiquitously at low levels at all stages, but is up-regulated specifically in the prospective neural plate from stage 4–4+ (Figure 10Figure 10), just prior to when Sox2 expression appears [8,9]. When misexpressed as a line across the nonneural epiblast, BERT acts like the dominant-negative ERNI constructs: it induces strong expression of Sox2 (Figure 9Figure 9C and and9D;9Figure 9D; 15/15), which also acquires a neural plate-like morphology (Figure 9Figure 9D′: note that the thickened ectoderm characteristic of the neural plate has greatly expanded on the electroporated side; see arrowhead on right). Mesodermal markers (Brachyury, Chordin, and BMP4; 0/5, 0/4, 0/4, respectively; unpublished data) are not induced, showing that this expansion of the neural plate is a direct effect. These findings indicate that BERT has an activity compatible with it being an endogenous antagonist of ERNI, regulating not only Sox2 expression, but also the onset of neural plate development. To confirm this, we examined the effects of coexpressing BERT with Geminin+ERNI (which does not induce Sox2; see above and Figure 5Figure 5A and and5B)5Figure 5B) in the area opaca. Indeed, when all three constructs are cointroduced, induction of Sox2 is seen (12/12; Figure 9Figure 9E and and99Figure 9F).
Figure 9
Figure 9
Figure 9
BERT Releases Geminin from the Inhibition of ERNI
Figure 10
Figure 10
Figure 10
Expression of BERT during Normal Development
Is BERT required to control the onset of Sox2 expression in the neural plate? To address this, we designed a fluorescein-labeled Morpholino oligonucleotide (MO) to the 5′ end of the coding sequence (see Materials and Methods) and introduced this (together with GFP) by electroporation into the prospective neural plate at stage 3–3+ and examined Sox2 expression at stages 4+–5. BERT-MO caused down-regulation of Sox2 expression in this domain (Figure 9Figure 9G and and9H;9Figure 9H; 5/6), unlike control MO (Figure 9Figure 9I and and9J;9Figure 9J; 0/5). Staining of BERT-MO–electroporated embryos with an antibody against BERT/SCOCO (see Materials and Methods) confirmed that the MO does indeed inhibit translation of BERT protein (Figure 9Figure 9K) in the electroporated domain (Figure 9Figure 9L). Together, these findings implicate BERT as an endogenous antagonist of ERNI, required to regulate the onset of Sox2 expression in the neural plate.
From the results presented above, the evidence that BERT binds to ERNI directly is based entirely on the two-hybrid screen used to isolate BERT. To confirm that the two proteins can interact physically, we used BiFCo assays, which further revealed that BERT, Geminin, and ERNI all bind to each other through their coiled-coil domains (Figure 11Figure 11 and Table 1). This finding raises the possibility that BERT disrupts Geminin-ERNI dimers by binding to both proteins, thus removing ERNI-HP1γ from the complex to activate Sox2 (Figure 9Figure 9M). To test this further, we used BiFCo competition assays (Figure 12Figure 12). When BERT is added to Geminin-Venus(N)+ERNI-Venus(C), fluorescence is lost (Figure 12Figure 12A and and12B).12Figure 12B). When Dlx5 is used as a control instead of BERT in this assay, there is no effect (Figure 12Figure 12C). Conversely, when BERT-Venus(C) is added to Geminin-Venus(N)+ERNI, fluorescence is generated (Figure 12Figure 12D and and12E),12Figure 12E), and this is not mimicked by addition of Dlx5-Venus(C) (Figure 12Figure 12F). Likewise, when BERT-Venus(C) is added to Geminin+ERNI-Venus(N), fluorescence is produced (Figure 12Figure 12G and and12H),12Figure 12H), which is not mimicked by the use of Dlx5-Venus(C) instead of BERT-Venus(C) (Figure 12Figure 12I). Together, these findings support the idea that BERT can disrupt Geminin-ERNI heterodimers by binding to both proteins.
Figure 11
Figure 11
Figure 11
Direct Interactions between the Coiled-Coil Proteins
Figure 12
Figure 12
Figure 12
BiFCo Competition Assays
The Protein Complex Regulates the Activity of the N2 Enhancer of Sox2
The experiments described above tested the protein–protein interactions and their effects on Sox2 expression, but their physical association with the N2 enhancer was extrapolated from published results in a cultured cell line, unrelated to the early neural plate [22]. To test whether these interactions can regulate Sox2 expression directly at the N2 enhancer, we coelectroporated a reporter construct consisting of the N2 enhancer and a minimal TK promoter [20] driving expression of LacZ together with either Geminin alone, with Geminin+ERNI, or with Geminin+ERNI+BERT, into the extraembryonic epiblast. No expression of the reporter was seen when it was coelectroporated with the control construct pCAβ-GFP (Figure 13Figure 13A and and13B;13Figure 13B; 0/16) or with Geminin+ERNI (unpublished data; 0/6). However, expression was induced by both Geminin (unpublished data; 6/6) and by Geminin+ERNI+BERT (Figure 13Figure 13C and and13D;13Figure 13D; 5/5). This shows that ERNI can block the activity of the N2 enhancer of Sox2 and that BERT inhibits this.
Figure 13
Figure 13
Figure 13
Interaction of Geminin, ERNI, and BERT on the N2 Enhancer
Finally, to confirm that these proteins do indeed interact physically with the N2 enhancer, we conducted chromatin immunoprecipitation (ChIP) assays using chromatin extracted from embryonic day (E)7.5 mouse embryos and an antibody against mouse Geminin. The antibody specifically precipitates the N2 enhancer of Sox2 (Figure 13Figure 13E, lane 3), unlike control experiments performed either without chromatin (Figure 13Figure 13E, lane 1) or without anti-Geminin antibody (Figure 13Figure 13E, lane 2). These findings demonstrate that Geminin does indeed associate physically with the N2 enhancer of Sox2 in vivo at an appropriate stage in development.
Sox2 is an important gene that plays multiple roles in development especially in controlling cell fate and proliferation. Its expression pattern is complex and regulated by multiple noncoding elements [20,21]. In the normal embryo, one of the earliest conserved sites of expression is the nascent neural plate, where Sox2 constitutes the earliest definitive marker for this tissue. It is therefore of particular interest to understand the mechanisms that regulate the location and timing of expression of this gene in the neural plate, as this process is critical for normal nervous system development. Here, we propose that interactions between several coiled-coil proteins, heterochromatin proteins, and chromatin-remodeling molecules regulate the time of onset of Sox2 expression in the chick neural plate.
A Simple Model
The most parsimonious model to explain our findings in terms of how Sox2 expression is regulated in the early neural plate comprises the four steps shown in Figures 1Figure 1S, S,4G,4Figure 4G, G,7E,7Figure 7E, and and9M.9Figure 9M. Since Brm and HP1α are expressed ubiquitously ([24] and results from the present study), we propose that there is a basal state in which Brm is bound to the N2 enhancer of Sox2 [22], but the latter is not expressed because the repressor HP1α occupies the chromoshadow-binding domain of Brm (Figure 1Figure 1S). Early in development, FGF activity induces both ERNI [18,36] and Geminin (this study) in the epiblast. Geminin binds to the chromoshadow-binding domain of Brm, displacing HP1α (Figure 4Figure 4G). However, the interaction of ERNI with Geminin recruits the transcriptional repressor HP1γ, thus continuing to prevent premature expression of Sox2 in the epiblast (Figure 7Figure 7E). Later in development (stage 4–4+), BERT is up-regulated within the neural plate, where it binds to both ERNI and Geminin and displaces ERNI-HP1γ complexes away from Brm, freeing the latter to activate N2 and thus Sox2 expression (Figure 9Figure 9M). At around the same time, ERNI transcription starts to be down-regulated in the neural plate. This model accommodates all of our results and those in the literature; its significance is explored further in the following sections.
Molecular Interactions Regulating the Timing of Gene Expression
The N2 enhancer of Sox2 is about 550 bp long and is predicted to contain multiple binding sites for transcription factors [20], many of which are expressed in the epiblast prior to the stage at which Sox2 expression is initiated. In principle, binding of the appropriate activators to the N2 enhancer should turn on Sox2. However, the spatial and temporal patterns of expression of these factors do not account for the timing or spatial distribution of Sox2 transcription at this stage in development, as many of them are expressed ubiquitously (unpublished data). We therefore propose that, irrespective of the binding of putative activators to the N2 enhancer, the conformation of chromatin, maintained in a closed configuration by HP1 proteins, prevents activation at early stages. It is only when HP1 proteins are removed and the chromatin-remodeling activity of Brm is released that N2 is activated.
Chromatin-remodeling complexes may turn out to have a widespread role in the transcriptional activation of specific genes, as exemplified by Smad-activated genes whose transcriptional regulation also requires the activity of such complexes [46]. Likewise during skeletal muscle differentiation, chromatin-binding proteins “mark the spot” for activation of genes by other transcription factors together with chromatin remodeling by SWI/SNF proteins: MyoD binding to chromatin is regulated by the homeodomain protein Pbx1 in cooperation with the Brahma-related enzyme Brg1 [47–50]. To our knowledge, however, this is the first report suggesting that a SWI/SNF chromatin-remodeling complex can recruit HP1 proteins to a specific enhancer to repress transcription of a target gene.
Mechanisms Regulating the Timing of Neural Plate Formation
Our model proposes mutually inhibitory interactions between several proteins. Why does Sox2 need to be regulated by such a complex mechanism, rather than by merely recruiting a single or a few activators to a simple enhancer? We suggest that this is one in a series of steps that act to separate different functions for signals that are common to different developmental processes.
Previously, we showed that 3–5 h of exposure to signals from the organizer (Hensen's node) is sufficient to induce transient expression of the pre-neural marker Sox3, but not sufficient to induce later neural plate markers (such as Sox2), and that the BMP antagonist Chordin can stabilize the expression of Sox3 induced by such a graft (but again not induce Sox2) [16]. Based on these findings, we conducted a screen to identify genes induced within 5 h of exposure to the organizer [36]. We identified several genes induced within this time, among them ERNI, which is induced very rapidly, within 1–2 h. FGF8 is sufficient to mimic this effect, and during normal development, ERNI is expressed even before gastrulation, in a domain identical to that covered by the underlying hypoblast (which expresses FGF8).
FGF is required for both mesodermal [51–54] and neural induction [36,55,56]. How do cells that have received FGF signals decide between these two incompatible fates? A likely scenario is that cooperation with other factors, present at different times and in different locations, contributes to refine this choice. To allow this to happen, it may be necessary for cells to retain a “memory” that they have received FGF signals yet be prevented from being allocated prematurely to inappropriate fates. ERNI appears to fulfill such a role: while it is expressed, cells are multipotent, as its early domain of expression encompasses the prospective neural and mesendodermal domains as well as some nonneural ectoderm. At the end of gastrulation, ERNI transcription starts to be down-regulated from the future neural plate, remaining only at the border between neural and epidermal domains [36,57]. At the same time, BERT is up-regulated in the domain that is losing ERNI expression while Sox2 starts to be expressed in the same domain (stage 4–4+). This sequence of events could help to explain why it takes such a long time (about 9 h) following a graft of a node for Sox2 expression to begin and for a neural plate to be induced [14–17]. Consistent with the proposal that ERNI is part of a mechanism to prevent premature expression of Sox2, we have observed that transfection of BERT into the prospective neural plate region of stage 2–3 embryos can induce premature expression of Sox2 (unpublished data).
The present and previous studies [36] reveal that FGF signaling activates ERNI as well as Sox3 and Geminin expression in the epiblast. However, FGF does not induce BERT, whose expression is also not regulated by BMP antagonists or any combination of known factors implicated in neural induction to date (unpublished data). In future, it will be interesting to determine whether BERT is induced by some other combination of factors or whether its expression is regulated simply by a cell-autonomous timer in cells that are still in the epiblast at the end of gastrulation, but does not require input from other cells.
In all likelihood, the mechanisms responsible for regulating Sox2 expression and the acquisition of neural fate will turn out to be considerably more complex, and our model does not rule out additional mechanisms. It will be interesting in future to investigate whether other developmentally expressed genes are regulated by similar processes.
Conclusions
Our findings provide a mechanism for how Sox2 expression is initiated as part of the events that define the early neural plate. We propose that ERNI functions as an inhibitor of premature Sox2 expression during early gastrulation: cells expressing ERNI are multipotent and can generate any cell type. Cells that remain in the epiblast at the end of gastrulation and acquire expression of BERT to activate Sox2, which, most likely together with other genes involved in neural specification, assigns a neural plate fate.
Chick experiments.
Fertile hens' eggs (Brown Bovan Gold; Henry Stewart & Co.) were incubated at 38 °C to the desired stages. Electroporations were performed as described [35]. The coding region of full-length ERNI, ERNI coiled-coil domain (aa 1–164), chick BERT, chick Geminin, human BrmK755R (kind gift from Dr A Imbalzano), mouse HP1α, mouse HP1α chromoshadow domain (aa 106–180), and mouse HP1γ chromoshadow domain (aa 118–176) were cloned into pCAβ and electroporated at 0.2 μg/μl (except ERNI and BrmK755R and HP1α, which were used at 0.4 μg/μl) together with 1 μg/μl of pCAβ-GFP, which was used to mark the electroporated cells. The N2-TK-LacZ reporter plasmid was constructed from N2-TK-GFP, kindly provided by Dr H. Kondoh, and was electroporated at 1 μg/μl. FGF8b (Sigma) was delivered bound to heparin beads (prepared as described [19]) at 50 μg/ml. In situ hybridization and immunostaining for GFP were performed as described [35].
Design of assays.
To establish the role of different components in regulating the expression of Sox2, three different types of assays were used for gain- and loss-of-function experiments. First, to assess the effects on endogenous expression of Sox2 in the normal neural plate, constructs were introduced into the prospective neural plate at mid-primitive streak stage (stage 3–3+) and the embryos incubated about 6–9 h so that the embryo had reached stages 4+–7, just beyond the stages at which Sox2 expression begins (4+) and also because at these stages the neural plate is still open, allowing easier visualization of expanded expression. Please note that stages 4+–7 are particularly short, this entire period lasting only about 3 ± 1.5 h at 38 °C. To determine whether a construct can induce ectopic expression of Sox2, two different locations were chosen. In one set of assays, the construct is introduced as a continuous line between the prospective neural plate of the embryo and the inner aspect of the extraembryonic epiblast, covering most of the prospective epidermis. In the other assay, the construct is introduced as a discrete domain within the inner third of the extraembryonic (area opaca) epiblast and the embryos incubated 12–15 h (by which time they have reached stages 6–9).
The reasons for choosing both of the latter two assays for induction is that extensive embryological studies have revealed differences in their reactivity to neural inducing stimuli. For example, inhibition of BMP signaling is sufficient to expand the endogenous neural plate laterally (and BMP misexpression to narrow it), but only when the territory is continuous with the embryo's own neural plate [13,16,17], suggesting that induction of neural markers by certain stimuli in this region requires cellular continuity with the neural plate and/or its border. On the other hand, a graft of the organizer (Hensen's node) is able to induce a complete, patterned ectopic nervous system from the extraembryonic epiblast of the inner area opaca [13,29–32]. A period of 9–13-h contact is required to induce Sox2 after a graft of the organizer, which is why 12–15 h was chosen in this assay. To date, no single factor or any combination thereof has been found to mimic this activity of the organizer. It is therefore particularly important, to assess the full inducing properties of a treatment, to test its ability to induce Sox2 in the area opaca. We therefore used all three assays to compile a more comprehensive understanding of the inducing or inhibiting activities of each of the constructs in this study.
Morpholino experiments.
A translation-blocking MO against BERT with the sequence CAGCGTCCATGTCAGCGTTCATCAT, targeting the 5′ end of the ORF of the gene or a standard control MO (Gene Tools LLC), both labeled with fluorescein, were electroporated by injecting a small volume (about 0.1 μl) of a stock of the MO at 1 mM exactly as described for electroporation of constructs (see above). Antibody against human SCOCO was kindly provided by Dr. Richard Kahn. This was used in whole mounts by indirect immunoperoxidase with anti-rabbit-HRP using the same method as described for GFP (see above).
Two-hybrid screens.
For two-hybrid screens with embryonic cDNA, poly-A RNA was isolated from 600 chick embryos (stage 3–6) using the Ambion Poly(A)Pure Kit. The mRNA was used to synthesize a cDNA library which was cloned into the pMyr vector using the CytoTrap XR Library Construction Kit (Stratagene). The library was transformed into XL10-Gold Ultracompetent Cells (Stratagene). Full-length ERNI was cloned into the pSOS vector and used as bait in the CytoTrap two-hybrid screen, which was performed according to the manufacturer's instructions (Stratagene).
For two-hybrid screens on chick ES cells, poly-A RNA was isolated from ES cells [58]. cDNA was synthesized using Stratagene's cDNA synthesis kit and introduced into pGAD424 vector (Clontech), and this was transformed into XL1-blue MRF' bacteria by electroporation. All plasmids, yeast strains, and media used were purchased from Clontech. The bait ENS-1/ERNI coding sequence was cloned in NdeI/SalI sites of pGBKT7, introduced into AH109 yeast, and checked for lack of self-activation of the reporter. Screening was performed according to the Yeast Protocols Handbook (Clontech). pGAD424 recombinant plasmids from 18 candidates were purified, of which seven encoded the CHCB2 protein [41] and all included the chromoshadow domain. The smallest one, encoding the 87 carboxy-terminal amino acids, was used in further experiments. The full ENS-1/ERNI coding sequence was cloned into pGADT7 and various truncated forms (Figure 5Figure 5) subcloned into pGBKT7. Point mutations were introduced into pGBKT7:ENS-1 using the QuikChange site-directed mutagenesis kit from Stratagene and checked by sequencing. Yeast two-hybrid assays were performed by rapid cotransformation of strain AH109.
Cloning of chick Geminin.
The Xenopus Geminin amino acid sequence was used to BLAST the GenBank EST database. The full-length chick homolog sequence was recovered and cloned by PCR from the CytoTrap cDNA library described above.
BiFCo experiments.
The N- and C-terminal halves of Venus (aa 1–154 and 155–229) were PCR-amplified from pCS2 vectors and cloned into pcDNA3.1A. Geminin, ERNI, BERT, and human E2F3 were cloned in frame into the 5′ end of each of the two Venus halves, giving rise to six plasmids expressing each of the three genes fused to either of the two Venus halves. Dlx5 control vectors were a kind gift of Andrew Bailey. COS cells and cES cells were transfected as described [16], and the cells were observed the next day by epifluorescence in a compound microscope.
ChIP assay.
The method used closely followed one previously described [59]. Briefly, 20 E7.5 mouse embryos were fixed in 4% formaldehyde, homogenized in lysis buffer, and sonicated. Cell extracts were harvested by centrifugation, incubated overnight with an antibody against mouse Geminin (Santa Cruz Biotechnology FL-209, 5 μg), and then immunoprecipitated with Protein-A-Sepharose. Precipitates were heated to reverse the formaldehyde cross-linking. The DNA fragments in the precipitates were purified by phenol/chloroform extraction and EtOH precipitation and used as a template for a PCR, using the following mouse N2-specific primers: forward: AACTCTCATAGCCCTAACTGTC, reverse: CCCTCCTCTCCTAATCTCCTTATGG. After 20 cycles of amplification, one-tenth of the reaction product was used as a template for a second round of a further 20 cycles. The final PCR products were run on a 1% agarose gel.
Supporting Information
Accession Numbers
The GenBank (http://www.ncbi.nlm.nih.gov/Genbank) accession number for the chick homolog of Geminin is EU118174, and for BERT, it is EU118175.
Acknowledgments
We are indebted to Andrew Bailey, Antonio Imbalzano, Erika Christina Jorge, Richard Kahn, and Hisato Kondoh for generous gifts of plasmids and antibody, to Claudia Linker and Octavian Voiculescu for help with cloning the N2-reporter, to Kristen Kroll, Martin Raff, Andrea Streit, Steve Wilson, and Lewis Wolpert for constructive discussions or comments on the manuscript, to Amanda Fisher and Stephan Sauer for help and advice on ChIP assays, and to Sebastien Gounel for technical assistance.
Abbreviations
aaamino acid
BiFCobimolecular fluorescence complementation
BMPbone morphogenetic protein
cESchicken embryonic stem
ESembryonic stem
FGFfibroblast growth factor
GFPgreen fluorescent protein
MOMorpholino oligonucleotide

Footnotes
Author contributions. CP and CDS conceived and designed the project and most of the experiments. CP performed most of the experiments. AM and AMB performed the experiments on cES cells and two-hybrid screens from cES cell cDNAs (these were conceived and designed by JS), and CP and SB designed and performed the two-hybrid screen experiments using chicken embryo cDNAs. YS and JCS perfected the use of Venus for BiFCO experiments. AM, AMB, YS, JCS, and JS contributed reagents/materials/analysis tools. CP and CDS wrote the paper.
Funding. This study was funded by the Medical Research Council (CDS), the National Institute of Mental Health (NIMH, USA) (CDS), the Ligue Nationale Contre le Cancer (JS), and the European Union Network of Excellence consortium “Cells into Organs” (CDS and JCS). CP, YS, SB, JCS, and CDS are members of the EU Network of Excellence: “Cells into Organs.”
Competing interests. The authors have declared that no competing interests exist.
References
  • Avilion AA, Nicolis SK, Pevny LH, Perez L, Vivian N, et al. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 2003;17:126–140. [PubMed]
  • Bylund M, Andersson E, Novitch BG, Muhr J. Vertebrate neurogenesis is counteracted by Sox1–3 activity. Nat Neurosci. 2003;6:1162–1168. [PubMed]
  • Graham V, Khudyakov J, Ellis P, Pevny L. SOX2 functions to maintain neural progenitor identity. Neuron. 2003;39:749–765. [PubMed]
  • Ellis P, Fagan BM, Magness ST, Hutton S, Taranova O, et al. SOX2, a persistent marker for multipotential neural stem cells derived from embryonic stem cells, the embryo or the adult. Dev Neurosci. 2004;26:148–165. [PubMed]
  • Donner AL, Episkopou V, Maas RL. Sox2 and Pou2f1 interact to control lens and olfactory placode development. Dev Biol. 2007;303:784–799. [PubMed]
  • Schlosser G, Ahrens K. Molecular anatomy of placode development in Xenopus laevis. Dev Biol. 2004;271:439–466. [PubMed]
  • Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. J Morphol. 1951;88:49–92.
  • Rex M, Orme A, Uwanogho D, Tointon K, Wigmore PM, et al. Dynamic expression of chicken Sox2 and Sox3 genes in ectoderm induced to form neural tissue. Dev Dyn. 1997;209:323–332. [PubMed]
  • Uwanogho D, Rex M, Cartwright EJ, Pearl G, Healy C, et al. Embryonic expression of the chicken Sox2, Sox3 and Sox11 genes suggests an interactive role in neuronal development. Mech Dev. 1995;49:23–36. [PubMed]
  • Kishi M, Mizuseki K, Sasai N, Yamazaki H, Shiota K, et al. Requirement of Sox2-mediated signaling for differentiation of early Xenopus neuroectoderm. Development. 2000;127:791–800. [PubMed]
  • Bainter JJ, Boos A, Kroll KL. Neural induction takes a transcriptional twist. Dev Dyn. 2001;222:315–327. [PubMed]
  • De Robertis EM, Kuroda H. Dorsal-ventral patterning and neural induction in Xenopus embryos. Annu Rev Cell Dev Biol. 2004;20:285–308. [PubMed]
  • Stern CD. Neural induction: old problem, new findings, yet more questions. Development. 2005;132:2007–2021. [PubMed]
  • Gallera J, Ivanov I. La compétence neurogène du feuillet externe du blastoderme de poulet en fonction du facteur ‘temps.'. J Embryol Exp Morphol. 1964;12:693–711. [PubMed]
  • Gallera J. Le pouvoir inducteur de la jeune ligne primitive et les différences régionales dans les compétences de l'ectoblaste chez les oiseaux. Arch Biol (Liège). 1971;82:85–102.
  • Streit A, Lee KJ, Woo I, Roberts C, Jessell TM, et al. Chordin regulates primitive streak development and the stability of induced neural cells, but is not sufficient for neural induction in the chick embryo. Development. 1998;125:507–519. [PubMed]
  • Streit A, Stern CD. Establishment and maintenance of the border of the neural plate in the chick: involvement of FGF and BMP activity. Mech Dev. 1999;82:51–66. [PubMed]
  • Albazerchi A, Stern CD. A role for the hypoblast (AVE) in the initiation of neural induction, independent of its ability to position the primitive streak. Dev Biol. 2007;301:489–503. [PubMed]
  • Linker C, Stern CD. Neural induction requires BMP inhibition only as a late step, and involves signals other than FGF and Wnt antagonists. Development. 2004;131:5671–5681. [PubMed]
  • Uchikawa M, Ishida Y, Takemoto T, Kamachi Y, Kondoh H. Functional analysis of chicken Sox2 enhancers highlights an array of diverse regulatory elements that are conserved in mammals. Dev Cell. 2003;4:509–519. [PubMed]
  • Uchikawa M, Takemoto T, Kamachi Y, Kondoh H. Efficient identification of regulatory sequences in the chicken genome by a powerful combination of embryo electroporation and genome comparison. Mech Dev. 2004;121:1145–1158. [PubMed]
  • Kondo T, Raff M. Chromatin remodeling and histone modification in the conversion of oligodendrocyte precursors to neural stem cells. Genes Dev. 2004;18:2963–2972. [PubMed]
  • Elfring LK, Daniel C, Papoulas O, Deuring R, Sarte M, et al. Genetic analysis of brahma: the Drosophila homolog of the yeast chromatin remodeling factor SWI2/SNF2. Genetics. 1998;148:251–265. [PubMed]
  • Schofield J, Isaac A, Golovleva I, Crawley A, Goodwin G, et al. Expression of Drosophila trithorax-group homologues in chick embryos. Mech Dev. 1999;80:115–118. [PubMed]
  • Nielsen AL, Sanchez C, Ichinose H, Cervino M, Lerouge T, et al. Selective interaction between the chromatin-remodeling factor BRG1 and the heterochromatin-associated protein HP1alpha. Embo J. 2002;21:5797–5806. [PubMed]
  • Platero JS, Hartnett T, Eissenberg JC. Functional analysis of the chromo domain of HP1. EMBO J. 1995;14:3977–3986. [PubMed]
  • Wang G, Ma A, Chow CM, Horsley D, Brown NR, et al. Conservation of heterochromatin protein 1 function. Mol Cell Biol. 2000;20:6970–6983. [PubMed]
  • Thiru A, Nietlispach D, Mott HR, Okuwaki M, Lyon D, et al. Structural basis of HP1/PXVXL motif peptide interactions and HP1 localisation to heterochromatin. EMBO J. 2004;23:489–499. [PubMed]
  • Dias MS, Schoenwolf GC. Formation of ectopic neurepithelium in chick blastoderms: age-related capacities for induction and self-differentiation following transplantation of quail Hensen's nodes. Anat Rec. 1990;228:437–448. [PubMed]
  • Gallera J. Différence de la reactivité à l'inducteur neurogène entre l'ectoblaste de l'aire opaque et celui de l'aire pellucide chez le poulet. Experientia. 1970;26:1353–1354. [PubMed]
  • Storey KG, Crossley JM, De Robertis EM, Norris WE, Stern CD. Neural induction and regionalisation in the chick embryo. Development. 1992;114:729–741. [PubMed]
  • Streit A, Sockanathan S, Perez L, Rex M, Scotting PJ, et al. Preventing the loss of competence for neural induction: HGF/SF, L5 and Sox-2. Development. 1997;124:1191–1202. [PubMed]
  • Kroll KL, Salic AN, Evans LM, Kirschner MW. Geminin, a neuralizing molecule that demarcates the future neural plate at the onset of gastrulation. Development. 1998;125:3247–3258. [PubMed]
  • Seo S, Herr A, Lim JW, Richardson GA, Richardson H, et al. Geminin regulates neuronal differentiation by antagonizing Brg1 activity. Genes Dev. 2005;19:1723–1734. [PubMed]
  • Sheng G, dos Reis M, Stern CD. Churchill, a zinc finger transcriptional activator, regulates the transition between gastrulation and neurulation. Cell. 2003;115:603–613. [PubMed]
  • Streit A, Berliner AJ, Papanayotou C, Sirulnik A, Stern CD. Initiation of neural induction by FGF signalling before gastrulation. Nature. 2000;406:74–78. [PubMed]
  • Hu CD, Chinenov Y, Kerppola TK. Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Mol Cell. 2002;9:789–798. [PubMed]
  • Saka Y, Hagemann AI, Piepenburg O, Smith JC. Nuclear accumulation of Smad complexes occurs only after the midblastula transition in Xenopus. Development. 2007;134:4209–4218. [PubMed]
  • Nagai T, Ibata K, Park ES, Kubota M, Mikoshiba K, et al. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol. 2002;20:87–90. [PubMed]
  • Acloque H, Risson V, Birot AM, Kunita R, Pain B, et al. Identification of a new gene family specifically expressed in chicken embryonic stem cells and early embryo. Mech Dev. 2001;103:79–91. [PubMed]
  • Yamaguchi K, Hidema S, Mizuno S. Chicken chromobox proteins: cDNA cloning of CHCB1, −2, −3 and their relation to W-heterochromatin. Exp Cell Res. 1998;242:303–314. [PubMed]
  • Smothers JF, Henikoff S. The HP1 chromo shadow domain binds a consensus peptide pentamer. Curr Biol. 2000;10:27–30. [PubMed]
  • Smothers JF, Henikoff S. The hinge and chromo shadow domain impart distinct targeting of HP1-like proteins. Mol Cell Biol. 2001;21:2555–2569. [PubMed]
  • Van Valkenburgh H, Shern JF, Sharer JD, Zhu X, Kahn RA. ADP-ribosylation factors (ARFs) and ARF-like 1 (ARL1) have both specific and shared effectors: characterizing ARL1-binding proteins. J Biol Chem. 2001;276:22826–22837. [PubMed]
  • Su CW, Tharin S, Jin Y, Wightman B, Spector M, et al. The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic organization in Caenorhabditis elegans. J Biol. 2006;5:9. [PubMed]
  • Ross S, Cheung E, Petrakis TG, Howell M, Kraus WL, et al. Smads orchestrate specific histone modifications and chromatin remodeling to activate transcription. EMBO J. 2006;25:4490–4502. [PubMed]
  • Berkes CA, Bergstrom DA, Penn BH, Seaver KJ, Knoepfler PS, et al. Pbx marks genes for activation by MyoD indicating a role for a homeodomain protein in establishing myogenic potential. Mol Cell. 2004;14:465–477. [PubMed]
  • Ohkawa Y, Marfella CG, Imbalzano AN. Skeletal muscle specification by myogenin and Mef2D via the SWI/SNF ATPase Brg1. EMBO J. 2006;25:490–501. [PubMed]
  • Ohkawa Y, Yoshimura S, Higashi C, Marfella CG, Dacwag CS, et al. Myogenin and the SWI/SNF ATPase Brg1 maintain myogenic gene expression at different stages of skeletal myogenesis. J Biol Chem. 2007;282:6564–6570. [PubMed]
  • de la Serna IL, Ohkawa Y, Berkes CA, Bergstrom DA, Dacwag CS, et al. MyoD targets chromatin remodeling complexes to the myogenin locus prior to forming a stable DNA-bound complex. Mol Cell Biol. 2005;25:3997–4009. [PubMed]
  • Amaya E, Stein PA, Musci TJ, Kirschner MW. FGF signaling in the early specification of mesoderm in Xenopus. Development. 1993;118:477–487. [PubMed]
  • Kimelman D, Kirschner M. Synergistic induction of mesoderm by FGF and TGF-beta and the identification of an mRNA coding for FGF in the early Xenopus embryo. Cell. 1987;51:869–877. [PubMed]
  • Kimelman D, Bjornson C. Vertebrate mesoderm induction. In: Stern CD, editor. Gastrulation: from cells to embryo. Cold Spring Harbor (New York): Cold Spring Harbor Laboratory Press; 2004. pp. 363–372.
  • Sivak J, Amaya E. FGF signaling during gastrulation. In: Stern CD, editor. Gastrulation: from cells to embryo. Cold Spring Harbor (New York): Cold Spring Harbor Laboratory Press; 2004. pp. 463–473.
  • Wilson SI, Graziano E, Harland R, Jessell TM, Edlund T. An early requirement for FGF signalling in the acquisition of neural cell fate in the chick embryo. Curr Biol. 2000;10:421–429. [PubMed]
  • Delaune E, Lemaire P, Kodjabachian L. Neural induction in Xenopus requires early FGF signalling in addition to BMP inhibition. Development. 2005;132:299–310. [PubMed]
  • Streit A. Extensive cell movements accompany formation of the otic placode. Dev Biol. 2002;249:237–254. [PubMed]
  • Pain B, Clark ME, Shen M, Nakazawa H, Sakurai M, et al. Long-term in vitro culture and characterisation of avian embryonic stem cells with multiple morphogenetic potentialities. Development. 1996;122:2339–2348. [PubMed]
  • Baxter J, Sauer S, Peters A, John R, Williams R, et al. Histone hypomethylation is an indicator of epigenetic plasticity in quiescent lymphocytes. EMBO J. 2004;23:4462–4472. [PubMed]
  • Eyal-Giladi H, Kochav S. From cleavage to primitive streak formation: a complementary normal table and a new look at the first stages of the development of the chick. I. General morphology. Dev Biol. 1976;49:321–337. [PubMed]
Articles from PLoS Biology are provided here courtesy of
Public Library of Science

PubMed articles by these authors
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph