• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of mbcLink to Publisher's site
Mol Biol Cell. Nov 2007; 18(11): 4292–4303.
PMCID: PMC2043567

WNT10B Functional Dualism: β-Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in CancerAn external file that holds a picture, illustration, etc.
Object name is dbox.jpg

John Cleveland, Monitoring Editor

Abstract

We found aberrant DNA methylation of the WNT10B promoter region in 46% of primary hepatocellular carcinoma (HCC) and 15% of colon cancer samples. Three of 10 HCC and one of two colon cancer cell lines demonstrated low or no expression, and 5-aza-2′deoxycytidine reactivated WNT10B expression with the induction of demethylation, indicating that WNT10B is silenced by DNA methylation in some cancers, whereas WNT10B expression is up-regulated in seven of the 10 HCC cell lines and a colon cancer cell line. These results indicate that WNT10B can be deregulated by either overexpression or silencing in cancer. We found that WNT10B up-regulated β-catenin/Tcf activity. However, WNT10B-overexpressing cells demonstrated a reduced growth rate and anchorage-independent growth that is independent of the β-catenin/Tcf activation, because mutant β-catenin–transduced cells did not suppress growth, and dominant-negative hTcf-4 failed to alleviate the growth suppression by WNT10B. Although WNT10B expression alone inhibits cell growth, it acts synergistically with the fibroblast growth factor (FGF) to stimulate cell growth. WNT10B is bifunctional, one function of which is involved in β-catenin/Tcf activation, and the other function is related to the down-regulation of cell growth through a different mechanism. We suggest that FGF switches WNT10B from a negative to a positive cell growth regulator.

INTRODUCTION

The WNT10B gene is a member of the Wnt family (Lee et al., 1995 blue right-pointing triangle), which are conserved among diverse species and play crucial roles in normal development and neoplastic transformation (Nusse and Varmus, 1992 blue right-pointing triangle; Moon et al., 1997 blue right-pointing triangle). Ectopic expression of Wnt1 induces embryonic axis duplication in Xenopus (McMahon and Moon, 1989 blue right-pointing triangle), and it increases the number of mitogenic cells in the mouse spinal cord (Dickinson and McMahon, 1992 blue right-pointing triangle). Wnt1 knockout mice show severe abnormalities in brain development (McMahon and Bradley, 1990 blue right-pointing triangle; Thomas and Capecchi, 1990 blue right-pointing triangle), whereas Wnt3a, Wnt4, and Wnt7a genes are required for somite and tailbud formation (Takada et al., 1994 blue right-pointing triangle), renal development (Stark et al., 1994 blue right-pointing triangle), and limb development (Parr and McMahon, 1995 blue right-pointing triangle), respectively. Originally, Wnt1 was identified in mice as a proto-oncogene (Nusse and Varmus, 1982 blue right-pointing triangle). Similarly, Wnt3 and Wnt10b are found in the mouse mammary tumor virus (MMTV) insertion sites where these genes are activated and cause mammary tumors (Roelink et al., 1990 blue right-pointing triangle; Lee et al., 1995 blue right-pointing triangle). The oncogenic activity of Wnt family genes also has been demonstrated in cultured cells. Wnt1, Wnt2, Wnt3, Wnt3a, Wnt5b, Wnt6, Wnt7a, and Wnt7b induce morphological transformation in mammary epithelial, fibroblast, and pheochromocytoma cell lines (Rijsewijk et al., 1987 blue right-pointing triangle; Bradley et al., 1993 blue right-pointing triangle; Ramakrishna and Brown, 1993 blue right-pointing triangle; Shackleford et al., 1993 blue right-pointing triangle; Bradbury et al., 1994 blue right-pointing triangle; Shimizu et al., 1997 blue right-pointing triangle). These reports indicate that unscheduled expression of Wnt family genes is a significant event in oncogenesis. The expression of Wnt family genes is tightly regulated during normal mouse development (Buhler et al., 1993 blue right-pointing triangle; Weber-Hall et al., 1994 blue right-pointing triangle; Veltmaat et al., 2004 blue right-pointing triangle). In mammary glands, Wnt family genes are expressed in the embryonic stage, but they are not expressed in lactating mice (Gavin and McMahon, 1992 blue right-pointing triangle). Wnt1 expression is found only in the testes of adult mice (Shackleford and Varmus, 1987 blue right-pointing triangle). The abnormal expression of Wnt family genes has been reported in various types of cancer. Elevated expression levels of human WNT2, WNT5A, WNT7B, and WNT10B genes have been detected in proliferative lesions of human breast tissues (Huguet et al., 1994 blue right-pointing triangle; Lejeune et al., 1995 blue right-pointing triangle; Bui et al., 1997 blue right-pointing triangle). The WNT2 gene is overexpressed in human colorectal carcinoma (Vider et al., 1996 blue right-pointing triangle). WNT5A is up-regulated in lung, colon, and prostate cancers, as well as melanomas (Iozzo et al., 1995 blue right-pointing triangle).

The prevalence of Wnt family activation in cancer has warranted functional analysis for a better understanding of the molecular interactions. Wnt family proteins are secreted glycoproteins that bind to the cell surface and extracellular matrix (Papkoff et al., 1987 blue right-pointing triangle; Bradley and Brown, 1990 blue right-pointing triangle; Papkoff and Schryver, 1990 blue right-pointing triangle), and they are thought to activate the Frizzled family of membrane receptors (Bhanot et al., 1996 blue right-pointing triangle). The activation suppresses the activity of the glycogen synthetase kinase 3 (GSK3) homologue, zw3 (Cook et al., 1996 blue right-pointing triangle). In turn, the catenin homologue, armadillo, is hypophosphorylated and accumulates in the cell (Peifer et al., 1994 blue right-pointing triangle). Stabilized β-catenin binds to the Tcf family of transcription factors to increase the expression of multiple genes (van de Wetering et al., 1997 blue right-pointing triangle). The protein level of β-catenin is regulated by several proteins. In mammals, β-catenin forms complexes with GSK3, adenomatosis polyposis coli (APC), Axin, and Tcf (Willert and Nusse, 1998 blue right-pointing triangle; Polakis, 2000 blue right-pointing triangle). GSK3, a Ser/Thr protein kinase, phosphorylates the amino terminus of β-catenin, and it induces the degradation of β-catenin by the ubiquitin-proteasome pathway (Aberle et al., 1997 blue right-pointing triangle). APC is a major gene that is responsible for hereditary and sporadic colorectal carcinoma (Kinzler and Vogelstein, 1996 blue right-pointing triangle), and APC inactivation leads to β-catenin stabilization (Korinek et al., 1997 blue right-pointing triangle; Morin et al., 1997 blue right-pointing triangle). β-Catenin mutations in GSK3 phosphorylation sites are found not only in colorectal carcinoma without APC mutations (Korinek et al., 1997 blue right-pointing triangle; Morin et al., 1997 blue right-pointing triangle), but also in melanoma (Rubinfeld et al., 1997 blue right-pointing triangle), medulloblastoma (Zurawel et al., 1998 blue right-pointing triangle), ovarian carcinoma (Palacios and Gamallo, 1998 blue right-pointing triangle), endometrial carcinoma (Fukuchi et al., 1998 blue right-pointing triangle), hepatocellular carcinoma (HCC) (de La Coste et al., 1998 blue right-pointing triangle; Miyoshi et al., 1998 blue right-pointing triangle), hepatoblastoma (Koch et al., 1999 blue right-pointing triangle), prostatic carcinoma (Voeller et al., 1998 blue right-pointing triangle), and skin cancer (Chan et al., 1999 blue right-pointing triangle). Axin promotes GSK3-dependent phosphorylation of β-catenin through an interaction with the complex involving β-catenin, APC, and GSK3, resulting in the degradation of β-catenin (Hart et al., 1998 blue right-pointing triangle; Ikeda et al., 1998 blue right-pointing triangle). Axin mutations can be found in 9% of HCC (Satoh et al., 2000 blue right-pointing triangle). Activated β-catenin associates with hTcf-4, a member of Tcf transcription factor. Subsequently, the complex translocates into the nucleus (Behrens et al., 1996 blue right-pointing triangle; Korinek et al., 1997 blue right-pointing triangle) and transactivates target genes such as c-myc (He et al., 1998 blue right-pointing triangle), cyclin D1 (Tetsu and McCormick, 1999 blue right-pointing triangle), cyclooxygenase-2 (COX-2) (Araki et al., 2003 blue right-pointing triangle), and NOS2 (Du et al., 2006 blue right-pointing triangle). These reports indicate that the β-catenin/Tcf pathway, which is downstream of the Wnt family gene, plays a crucial role in oncogenesis. Several of the Wnt family genes are known to regulate β-catenin. Wnt1 overexpression increases the steady-state levels of β-catenin in mouse mammary epithelial and mouse pituitary cell lines (Papkoff et al., 1996 blue right-pointing triangle). Wnt1, Wnt2, Wnt3, and Wnt3a are able to transform a mouse mammary epithelial cell line, demonstrating the accumulation of cytosolic β-catenin (Shimizu et al., 1997 blue right-pointing triangle). In a reporter assay, Wnt1 activates transcription from a promoter containing Tcf-binding elements (Young et al., 1998 blue right-pointing triangle). Together, the overexpression of Wnt family members is common in diverse types of cancer, and the oncogenic function of the Wnt family depends on the activation of β-catenin.

Int-2 transgenic mice produce mammary tumors in a focal manner. When the int-2 transgenic mice are further infected with MMTV, multiple tumors develop in a mammary gland. Twenty-three percent (5 of 35) of the tumors have a MMTV-insertion at the Wnt1 locus, and 6% (2 of 35 tumors) have it at the Wnt10b locus (Lee et al., 1995 blue right-pointing triangle). Similarly, Wnt10b transgenic mice produced mammary tumors in a solitary manner (Lane and Leder, 1997 blue right-pointing triangle). These observations suggest that Wnt10b takes part in the development of mouse mammary tumors and that it requires other collaborating genes to develop cancer. WNT10B is also overexpressed in human primary breast carcinomas, breast carcinoma cell lines, and neuroblastoma cell lines (Bui et al., 1997 blue right-pointing triangle; Yuza et al., 2003 blue right-pointing triangle). However, the precise roles of WNT10B in both development and oncogenesis are not well understood. Wnt10b is expressed in mouse embryonic yolk sac, fetal liver, and hematopoietic stem cells, suggesting that Wnt10b functions in hematopoiesis. Both mouse and human WNT10B induce the proliferation of hematopoietic stem cells as well as granulocyte macrophage progenitor cells (Austin et al., 1997 blue right-pointing triangle; Van Den Berg et al., 1998 blue right-pointing triangle), whereas WNT10B can suppress the proliferation of human erythroid progenitor cells (Van Den Berg et al., 1998 blue right-pointing triangle). This growth-suppressive effect is functionally dominant in that WNT10B overrides the growth stimulation by WNT2B and WNT5A (Van Den Berg et al., 1998 blue right-pointing triangle). WNT10B is also involved in adipogenesis by maintaining the preadipocyte in an undifferentiated state (Bennett et al., 2003 blue right-pointing triangle; Ross et al., 2000 blue right-pointing triangle). These imply that WNT10B has multiple functions, which are dependent on the cellular and microenvironmental context.

Recently, we have identified a candidate tumor suppressor, SOCS-1, in the structural and functional analyses of a gene identified by restriction landmark genomic scanning analysis (RLGS) (Yoshikawa et al., 2001 blue right-pointing triangle). Another aberrant NotI restriction DNA fragment that reduced the intensity in HCC samples compared with the normal counterparts has been found in the RLGS analysis (Nagai et al., 1994 blue right-pointing triangle). This DNA contained a part of the human WNT10B gene, and it was mapped to chromosome 12q13 (Yoshikawa et al., 1997 blue right-pointing triangle), where WNT10B is localized (Bui et al., 1997 blue right-pointing triangle). Because WNT10B has been minimally studied in human cancer, we analyzed promoter DNA methylation, expression, and functions with respect to tumor development.

MATERIALS AND METHODS

Cell Culture and Tissues

Cancer cell lines, SNU-182, SNU-387, SNU-398, SNU-423, SNU-449, SNU-475, PLC/PRF/5, H460, H209, H1155, SW480, RKO, and Raji were obtained from the American Type Culture Collection (Manassas, VA). HuH-1, HuH-4, and HuH-7 were from the Japanese Culture Collection (RIKEN BioResource Center, Saitama, Japan). These were grown in either DMEM or RPMI 1640 medium, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described previously (Yoshikawa et al., 2001 blue right-pointing triangle; Ye et al., 2003 blue right-pointing triangle). Colon cancer samples were a kind gift from Dr. Bert Vogelstein (Johns Hopkins University).

Methylation-specific Polymerase Chain Reaction (MSP) Analysis

Genomic DNA was extracted using a standard method, and bisulfite modification of genomic DNA was performed as described previously (Herman et al., 1996 blue right-pointing triangle). The bisulfite-treated DNA was amplified either with a methylation-specific or unmethylation-specific primer set at 35 cycles at 95°C for 40 s, 58°C for 40 s, and 72°C for 40 s. The methylation-specific primer sequences for WNT10B were forward, AAAGTTAGAGTTTTTAGTTTTTTGTTCGTC and reverse, CTTCCCCAACGCCGCCG. These primers were designed from nucleotide (nt) 69 through nt 98 for the forward primer and from nt 174 through nt 158 for the reverse primer in U81787. The unmethylation-specific primer sequences for WNT10B were forward, GAGTAAAGTTAGAGTTTTTAGTTTTTTGTTTGTT, and reverse, TCACCACTTCCCCAACACCACCA. These primers were from nt 65 through nt 98 for the forward primer and from nt 180 through nt 158 for the reverse primer in U81787.

Bisulfite Sequencing Analysis

WNT10B noncoding exon1 was amplified from the bisulfite-treated DNA by using a primer set (GGTAGGGTGGGGAAGCCCCAGG and TGCTTTCCCAGGTCTAATTACCTCCAG). The polymerase chain reaction (PCR) products were cloned, and 10 randomly selected clones for each sample were sequenced.

RNA Isolation and Reverse Transcription (RT)-PCR

Total cellular RNA, which was prepared using RNeasy Mini kit (QIAGEN, Valencia, CA), was treated with RNase-free DNase (RQ1; Promega, Madison, WI) to eliminate contaminated DNA. cDNA was synthesized using a Superscript preamplification system (Invitrogen, Carlsbad, CA) from 3 μg of total RNA. Semiquantitative PCR for WNT10B was performed using 2 μl of cDNA, 2 μM of each primer (TGGAAGAATGCGGCTCTGA and CTCTCCAAAGTCCATGTCATGG), 1.5 mM MgCl2, 800 μM dNTP mix, and 2.5 U of AmpliTaq DNA polymerase (Roche Molecular Systems, Branchburg, NJ) in a buffer supplied by the company. The condition was 35 cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 2 min. An exponential amplification had been confirmed up to 38 cycles of the amplification (data not shown). A primer set for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA) was purchased from BD Biosciences. Semiquantitative PCR was performed as described in WNT10B amplification except that 1 μl of cDNA was used, and 30 cycles. An exponential amplification had been confirmed up to 34 cycles of the amplification (data not shown). For a reactivation study, the cells were treated with 5-aza-2′deoxycytidine (5Aza-dC) and trichostatin A (TSA) as described previously (Cameron et al., 1999 blue right-pointing triangle). Then, RT-PCR was performed as described above. Real-time PCR was performed with Taqman gene expression assay for FGF-2 and GAPDH (Applied Biosystems, Foster City, CA) and an ABI PRISM 7000 sequence detection system (Applied Biosystems), by using the relative standard curve method. Values were normalized to the relative amounts of GAPDH.

Plasmids

Mutant K-ras plasmid (pCGN K-ras 12V) was a kind gift from Dr. Channing Der (University of North Carolina). β-Catenin/Tcf luciferase reporter plasmids (pGL3/OT and pGL3/OF), S 33 Y mutant β-Catenin construct (pCI-NEO-CATENINXL), and the dominant-negative hTcf-4 plasmid (pcDNA/Myc-hTcf-4) were from Dr. Bert Vogelstein. To construct the hygromycin-resistant vector carrying the dominant-negative hTcf-4 gene, we transferred the N-terminal–deleted Tcf-4 gene from pcDNA/Myc-hTcf-4 into pcDNA3.1/Hygro (Invitrogen). Full-length WNT10B cDNA was amplified from human placenta RNA by using a primer set (TGGAAGAATGCGGCTCTGAC and AGAGTGACCTTGGAAGGAAATC). The PCR product was cloned into the pT7blueT vector (Novagen, Darmstadt, Germany). The recombinant DNA was propagated in Epicurian coli SCS110 (Stratagene, La Jolla, CA) to avoid Dam methylation. The full-length WNT10B was cut out from the recombinant with XbaI and ClaI, and it was blunted with Klenow enzyme and then ligated into EcoRV-digested pcDNA3.1/HisC (Invitrogen). A clone, pcDNA-WNT10B, showed an in-frame ligation, sense orientation, and correct sequence to human WNT10B gene sequences of U81787 or X97057 (GenBank). The WNT10B insert in pT7blueT was also cloned into a pCR3.1 vector (Invitrogen) by double digestion with EcoRI plus XbaI to generate another expression vector, pCR-WNT10B.

β-Catenin/Tcf Reporter Analysis

The β-catenin/Tcf luciferase reporter plasmid pGL3/OT contains a multiple β-catenin/Tcf motif, but pGL3/OF contains a multiple-mutated motif. To measure the activation of the β-catenin/Tcf reporter by exogenously expressed genes, cells (30 × 104) were plated and grown overnight in each well of six-well plates. Each 1 μg of the reporter plasmid and an expression plasmid were transfected into the cells by using a Lipofectamine plus reagent (Invitrogen) according to the company's protocol. At 48 h after transfection, luciferase activity was measured using a reporter assay system (Promega). The luminescence was normalized to the relative protein concentration. To measure the steady-state level of reporter activities, cells (30 × 104) were plated and grown overnight in each well of six-well plates. One microgram of pGL3/OT with 1 ng of the reference plasmid, pRL-CMV (Promega), was transfected into these cells, and at 48 h posttransfection, luciferase activities were measured using the Dual-Luciferase Reporter Assay system (Promega). The values of the β-catenin/Tcf reporter were normalized to those of the reference reporter.

RNA Interference

The target sequences used for WNT10B silencing were AAGGGUGGGAAGGGAUAAU (small interfering [si]RNA1), AAGCGCGGUUUCCGUGUUU (siRNA2), and GAAUGCGAAUCCACAACAA (siRNA3). Cells (20 × 104 in 60-mm dish) were transfected with WNT10B-specific siRNA or control siRNA (QIAGEN) at a concentration of 250 nM by using oligofectamine (Invitrogen). At 48 h posttransfection, cells were lysed, harvested, or incubated with 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)- 2H-tetrazolium, inner salt (MTS) reagent.

Establishment of Stably Transfected HuH-7 Clones

HuH-7 cells (30 × 104) were transfected with either the WNT10B expression or the backbone vector by using Lipofectamine Plus reagent (Invitrogen), and they were selected with 500 μg/ml Geneticin (G-418; Invitrogen) for 4 wk. Because the pcDNA3-WNT10B generated WNT10B protein more efficiently than the pCR-WNT10B in an in vitro transcription-coupled translation experiment (data not shown), we established WNT10B-overexpressing clones with the pcDNA-WNT10B. Drug-resistant colonies were isolated, and expanded. A mutant β-catenin–overexpressing HuH-7 clone also was generated using the S33Y mutant β-Catenin expression vector.

Western Blot Analysis

At ~70% confluence, cells were lysed on ice in lysis buffer composed of 20 mM Tris, pH 8.0, 1% Nonidet P-40, 0.1% SDS, 150 mM NaCl, 50 mM NaF, 1 mM Na3VO4, 10 μg/ml leupeptin, 10 μg/ml aprotinin, 1 μg/ml pepstatin, and 1 mM phenylmethylsulfonyl fluoride. After 10-min incubation on ice, the cells were scraped into microfuge tubes and centrifuged at 15,000 × g for 30 min. Supernatants (30 μg) were boiled for 5 min in SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer, resolved by SDS-PAGE, and then electroblotted onto a nitrocellulose membrane. The blot was blocked with 5% skim milk in phosphate-buffered saline (PBS) for 1 h at room temperature (RT), and then it was incubated with an antibody for 1 h at RT. Anti-Wnt10B antibody (Santa Cruz Biotechnology, Santa Cruz, CA) was used at a 1:1000 dilution, anti-actin antibody (Roche Diagnostics, Indianapolis, IN) was used at a 1:400 dilution, anti-cyclin D1 antibody (Upstate Biotechnology, Lake Placid, NY) was used at a 1:500 dilution, and anti-c-Myc antibody and anti-caspase-3 antibody (Santa Cruz Biotechnology) were used at a 1:250 dilution. After several washes, a 1:5000 dilution of the appropriate horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology) was added for 1 h at RT. After several washes, the blot was incubated with an enhanced chemiluminescent substrate and exposed to Hyperfilm (GE Healthcare, Arlington Heights, IL). To detect COX-2 protein, cells were transfected with mutant K-ras vector, and the lysate was analyzed as described previously (Araki et al., 2003 blue right-pointing triangle).

Flow Cytometry

Transfected cells were pelleted and washed with PBS. Ice-cold 80% ethanol was then added dropwise over the pellets with periodic vortexing to mix cells. After fixation, propidium iodide was added to 50 μg/ml in PBS. The samples were then analyzed by flow cytometry.

Cell Proliferation Assay

Stably transfected HuH-7 cells (1 × 103) were plated in 96-well plates. At 24 and 48 h postplating, Cell Titer 96 Aqueous One Solution Reagent (Promega) was added into each well. After 4-h incubation, absorbance at 490 nm was recorded. The confluence was <70% under phase-contrast microscopy at 48 h postplating. For siRNA-treated cells, 100 μl of the reagent was added to the medium (2 ml) at 48 h posttransfection. To examine the effects of fibroblast growth factor (FGF)-2 and FGF-7 on WNT10B-overexpressing clones, stably transfected HuH-7 clones (1 × 103 cells) were seeded in six-well plates. Cells were incubated with or without 5 ng/ml FGF-2 or FGF-7 (Chemicon International, Temecula, CA) for 2 wk. The medium was replaced every 4 d. Colony numbers were counted at 14 d postincubation.

Soft Agar Colony Formation Assay

Stably transfected HuH-7 cells (1 × 104) were suspended in RPMI 1640 medium containing 0.35% agar and 10% fetal bovine serum, and they were layered on 0.5% agar-containing RPMI 1640 medium and 10% fetal bovine serum in 100-mm tissue culture dishes. An additional 0.35% agar culture medium was overlayered every 5 d. The culture media were supplemented with 500 μg/ml G-418. Colony formation was assessed at 21 d postincubation. To inactivate the β-Catenin/Tcf complex, WNT10B-overexpressing cells (10 × 104) were transfected either with 1 μg of dominant-negative hTcf4 plasmid or the backbone pcDNA3.1/Hygro plasmid (Invitrogen) with Lipofectamine Plus reagent (Invitrogen). Cells were selected with 50 μg/ml hygromycin (Invitrogen) for 3 wk in the 0.35% agarose containing RPMI 1640 medium and 10% fetal bovine serum.

Tumorigenicity in Athymic Nude Mice

Cells (1.25 × 106) of stably transfected HuH-7 clones were injected subcutaneously into each of the 10 athymic nu/nu female mice. Tumors were monitored weekly after 2 mo postinoculation, and they were examined pathologically, when the mice died.

RESULTS

Methylation and Expression Analysis of the WNT10B Gene in Cancer

We analyzed the DNA methylation status of the WNT10B gene by using MSP in primary human HCC and colon cancer samples, because we identified WNT10B by the RLGS analysis, in which the related NotI site was found aberrant in primary cancer compared with nontumorous samples. We designed MSP primers in noncoding exon1 where CpG density is relatively high and the NotI site is located (Figure 1A). Eleven of 24 (46%) HCC samples (Figure 1B) and seven of 46 (15%) colon cancer samples were methylated (Figure 1C). In contrast, no methylation was found in normal samples (Figure 1D). We further examined DNA methylation of WNT10B in cancer cell lines, including lung cancer, colon cancer, leukemia, and HCC. RKO and Raji cells were methylated (Figure 1E), whereas 10 HCC cell lines did not show any methylation in the region that we analyzed by MSP (data not shown). Bisulfite sequencing analysis demonstrated that RKO was densely methylated and 40% of Raji DNA was methylated in the noncoding exon1 (Figure 1F). We next examined WNT10B steady-state levels in 10 HCC, one leukemia and two colon cancer cell lines by RT-PCR. Seven of the 10 HCC and one of the two colon cancer cell lines expressed abundant WNT10B RNA; however, HuH-7, SNU-182, SNU-387, Raji, and RKO showed no detectable or minimal expression (Figure 1G). The WNT10B expression seemed a specific event to cancer, because normal liver and colon samples did not show detectable expression of WNT10B. Despite the up-regulation of WNT10B expression in SW480 and the seven HCC cell lines, we observed aberrant DNA methylation in RKO and Raji cell lines as well as primary HCC and primary colon cancer samples. This finding lead us to determine whether DNA methylation of WNT10B was associated with its faint or lack of expression, which was observed in HuH-7, SNU-182, SNU-387, Raji, and RKO. We treated HuH-7 and RKO cells with a demethylating agent, 5Aza-dC, and we found the up-regulation of WNT10B expression. The combination treatment with 5Aza-dC and a histone deacethylase inhibitor, TSA, resulted in a more robust effect, as was shown in methylation-silenced genes (Figure 1H). We further examined 5Aza-dC–treated cells to confirm WNT10B reactivation by demethylation. MSP analysis revealed that unmethylated WNT10B DNA appeared in 5Aza-dC-treated cells, whereas that was not detectable in untreated cells (Figure 1I). This result was consistent with the reactivation of WNT10B expression in 5Aza-dC–treated cells. Interestingly, the addition of 1 mM TSA did not increase demethylated WNT10B compared with 5Aza-dC treatment alone. We next examined DNA methylation and expression of WNT10B in primary HCC samples. We analyzed 10 primary HCC by using matched (DNA/RNA) samples. Three HCC samples (3, 4, and 6) were methylated in which WNT10B expression was not detectable, whereas four (1, 7, 9, and 10) of seven unmethylated samples expressed WNT10B. Three nontumorous liver samples (11, 12, and 13) showed neither methylation nor expression (Figure 1J). These results support WNT10B can be silenced by DNA methylation.

Figure 1.
Aberrant methylation and expression of WNT10B in HCC. (A) Schematic representation of WNT10B promoter region. Arrowheads and arrows indicate positions of MSP and bisulfite sequencing primers, respectively. ATG represents the translation start site. CpG ...

Regulation of the β-Catenin/Tcf Complex by WNT10B in HCC

Wnt1 regulated the β-catenin/Tcf complex (Papkoff et al., 1996 blue right-pointing triangle; Shimizu et al., 1997 blue right-pointing triangle), and activated β-Catenin mutations were reported in HCC and hepatoblastoma (de La Coste et al., 1998 blue right-pointing triangle; Miyoshi et al., 1998 blue right-pointing triangle). Therefore, we studied exon3 of β-Catenin where mutations were exclusively reported in diverse types of cancer (Korinek et al., 1997 blue right-pointing triangle; Morin et al., 1997 blue right-pointing triangle; Rubinfeld et al., 1997 blue right-pointing triangle; de La Coste et al., 1998 blue right-pointing triangle; Fukuchi et al., 1998 blue right-pointing triangle; Miyoshi et al., 1998 blue right-pointing triangle; Palacios and Gamallo, 1998 blue right-pointing triangle; Voeller et al., 1998 blue right-pointing triangle; Zurawel et al., 1998 blue right-pointing triangle; Chan et al., 1999 blue right-pointing triangle; Koch et al., 1999 blue right-pointing triangle). We found no β-Catenin mutations in any of the 10 HCC cell lines examined (data not shown). The up-regulation of WNT10B expression without β-Catenin mutations suggested that WNT10B was able to activate the β-catenin/Tcf pathway in HCC. As was observed in normal colonic epithelium (Korinek et al., 1997 blue right-pointing triangle), hTcf-4 was also expressed in normal liver (data not shown). Thus, we examined the β-catenin/Tcf reporter activity in WNT10B high-and low-producing cell lines (HuH-4 and HuH-7, respectively). HuH-4 cells demonstrated higher activity than that of HuH-7 cells (Figure 2A). Mutations in AXIN1, which was a negative regulator of β-catenin, were reported in 9% HCC (Satoh et al., 2000 blue right-pointing triangle); however, AXIN1 was wild type in HuH-7 cells as well as β-Catenin, indicating that these downstream proteins in WNT signaling were not defective in this cell line. To test the regulation of the β-catenin/Tcf complex by WNT10B, we cotransfected WNT10B expression and a reporter plasmid into the WNT10B low-producer cells (HuH-7). We observed elevated reporter activity by WNT10B (Figure 2B). The up-regulation was detected only in the reporter containing true β-catenin/Tcf binding motifs, but not in the mutated motifs. Therefore, WNT10B specifically stimulated the promoter for the β-catenin/Tcf complex. These findings suggested that the up-regulated WNT10B induced the activation of the β-catenin/Tcf pathway. Next, we established two WNT10B and a mutant β-Catenin stably transfected clones. The R8 clone demonstrated an intermediate level, and the R9 clone showed a higher level of WNT10B protein (Figure 2C). The β-catenin/Tcf reporter activity was up-regulated in these WNT10B-overexpressing clones compared with the vector control. The WNT10B high-producer clone, R9, activated the reporter more than the intermediate-producer, R8. Similarly, the mutant β-catenin–overexpressing clone showed enhanced activity, which was higher than those of the WNT10B-overexpressing clones (Figure 2D). Then, we examined whether WNT10B transactivates β-catenin-responding genes (Cyclin D1, c-MYC, and COX-2). These genes contain the β-catenin/Tcf binding elements in their promoter regions, and they are reported to be transactivated by β-catenin (He et al., 1998 blue right-pointing triangle; Tetsu and McCormick, 1999 blue right-pointing triangle; Araki et al., 2003 blue right-pointing triangle). We found that all three of these proteins were up-regulated in the WNT10B or mutant β-catenin–overexpressing clones. The R9 activated these target genes more than the R8, and the transactivations of COX-2,Cyclin D1, and c-MYC genes in the mutant β-catenin–overexpressing clone were higher than those in the WNT10B-overexpressing clones (Figure 2E). These results demonstrated that the enhancement of β-catenin/Tcf activity by WNT10B was in line with the transduction by mutant β-catenin, although the up-regulation of WNT10B was less than that of mutant β-catenin.

Figure 2.
β-Catenin/Tcf reporter activity in HuH-4 and HuH-7 cell lines. (A) The β-catenin/Tcf reporter activity was measured by transient transfections with a β-catenin/Tcf reporter plasmid, pGL3/OT, and a reference plasmid, pRL-CMV, into ...

WNT10B Inhibits Cell Growth through a β-Catenin–independent Mechanism

Next, we examined the effects of WNT10B expression on cell growth. WNT10B-overexpressing clones showed a reduced growth rate compared with the vector control and the mutant β-catenin–overexpressing clones (Figure 3A). Surprisingly, WNT10B acted differently from mutant β-catenin in this growth assay, despite the fact that these two proteins were in the same pathway (Figure 2, D and E). Therefore, we further investigated the mechanism of the growth-suppressive effects in these WNT10B clones. In a soft agar cloning experiment, WNT10B-overexpressing clones drastically reduced the formation of colonies compared with the control and the mutant β-catenin–overexpressing clones. The growth suppression efficiency between WNT10B-overexpressing clones was directly correlated with the amount of WNT10B expression (Figure 3B). The colon cancer cell line RKO in which WNT10B is inactivated with associated DNA methylation also demonstrated reduced colony formation, when WNT10B was transfected (data not shown). Although WNT10B-overexpressing clones showed the notable growth suppression in a soft agar culture, c-MYC was elevated in these cells, which might potentiate the growth suppression in some conditions (Evan et al., 1992 blue right-pointing triangle; Pelengaris et al., 2000 blue right-pointing triangle). Therefore, we overexpressed dominant-negative hTcf-4 in the WNT10B high-producer clone, R9, to eliminate the activity of β-catenin (Morin et al., 1997 blue right-pointing triangle). Dominant-negative hTcf-4 did not recover the growth of the WNT10B-overexpressing clone in soft agar (Figure 3B), indicating the growth suppression by WNT10B is not associated with the activity of the β-catenin/Tcf transcription complex. WNT10B overexpression suppressed the growth of HuH-7 cells, despite that WNT10B up-regulated cyclin D1 and c-MYC. We, therefore, tested if transient WNT10B overexpression induces apoptosis. WNT10B-transfected cells showed cleavage of caspase-3 by immunoblotting and increases of subG1 population by FACS analysis (Figure 3C), indicating that WNT10B was able to induce apoptosis when transiently overexpressed. We further studied the tumorigenicity of WNT10B-overexpressing clones in xenotransplanted athymic nude mice (Table 1). The mutant β-catenin-overexpressing clone showed an increased occurrence of tumors with similar latency and similar doubling time when compared with the vector control, whereas R9 showed a reduced occurrence of tumors, delayed latency, and extended doubling time compared with the vector control and the mutant β-catenin–overexpressing clone. R8 also had a decreased tumor occurrence compared with the mutant β-catenin–overexpressing clone. Interestingly, R8 had an increased tumor occurrence and maintained the latency and doubling time compared with the vector control. WNT family proteins are able to induce morphological changes (Young et al., 1998 blue right-pointing triangle). We observed WNT10B stably expressing clones under phase-contrast microscopy. WNT10B-overexpressing clones showed more of an ordered pattern compared with the control and β-catenin–overexpressing clones (Figure 3D).

Figure 3.
Induction of growth suppression by WNT10B. (A) MTS assay. Growth rates were calculated by the increase of absorbance between 24 and 48 h after plating. Vector control is a stable transfectant with an empty vector. The WNT10B clones R9 and R8 produce high ...
Table 1.
Tumorigenicity of WNT10B-overexpressing HuH-7 clones in nude mice

Effects of WNT10B Inhibition by siRNA

Given the WNT10B-mediated activation of β-catenin and β-catenin–independent growth suppression by WNT10B overexpression, we next examined the effects of WNT10B inhibition. Two of three WNT10B-specific siRNAs effectively inhibited WNT10B RNA expression in HuH-4 cells. We used siRNA3 in further experiments. Inhibition of WNT10B was confirmed by immunoblotting using siRNA3-transfected HuH-4 and SW480 cells (Figure 4A). In WNT10B-knockdown cells, cyclin D1 and c-MYC were down-regulated, as well as β-catenin (Figure 4B). We also evaluated the growth of WNT10B-inhibited cells. These cells showed reduced growth compared with the control siRNA-transfected cells (Figure 4C).

Figure 4.
Effects of WNT10B inhibition by siRNA. (A) Knocking WNT10B down by the specific siRNA. WNT10B-expressing cells were transfected with WNT10B-specific siRNAs. WNT10B expression was analyzed by RT-PCR (top) and immunoblotting (bottom). (B) Down-regulation ...

Synergy of WNT10B and FGF Family Proteins in Tumor Cells

Despite the up-regulation of β-catenin/Tcf reporter activity and the transactivation of target genes by WNT10B, WNT10B-overexpressing clones showed a reduction in growth rate and soft agar cloning efficiency. Tumorigenicity in athymic nude mice was also reduced in R9. Based on these results, we speculated that WNT10B requires some factors for reversing its growth suppression effect. FGF family proteins were supposed to be candidates, because Wnt10b transgenic mice produced mammary tumors only in a solitary manner (Lane and Leder, 1997 blue right-pointing triangle), and a member of FGF family, int-2, collaborated with Wnt10b to develop multiple mammary tumors (Lee et al., 1995 blue right-pointing triangle). We incubated stable HuH-7 clones with either FGF-2 or FGF-7. FGF-2 or FGF-7 enhanced the growth of WNT10B-overexpressing clones more than the vector control clone (Figure 5A), suggesting that WNT10B cooperated with FGF family proteins. R9 was more sensitive to FGF family proteins than R8. Significantly, FGF-2 or FGF-7 failed to enhance the growth of the mutant β-catenin clone. FGF-2 and FGF-7 did not affect the expression of WNT10B in R8 and R9 clones (Figure 5A). This finding again demonstrated that R8 and R9 clones were differently involved in cell growth from the mutant β-catenin clone. We further analyzed the expression of WNT10B and FGF-2 to examine expression patterns and tumor metastasis in surgically resected HCC samples. WNT10B expression was found in eight of the 22 samples (Figure 5B). Among the 22 samples, 14 samples are metastatic, and the remaining eight samples were not (Ye et al., 2003 blue right-pointing triangle). We quantitatively examined FGF-2 expression by using real-time PCR, because FGF-2 was expressed in normal liver. Ten of the 22 samples had increased FGF-2 expression (see Supplemental Material). Double up-regulation of WNT10B and FGF-2 expressions were found in five samples. Interestingly, four of the five WNT10B/FGF-2 double up-regulated samples were metastatic cases (Table 2).

Figure 5.
Synergy of WNT10B and FGF. (A) Effects of FGF family proteins on the WNT10B-overexpressing clones. Stably transfected HuH-7 clones were incubated with or without 5 ng/ml FGF-2 or FGF-7 for 2 wk, and then the colony numbers were counted. Black and white ...
Table 2.
WNT10B and FGF-2 expressions in metastatic and nonmetastatic samples

DISCUSSION

The Wnt family is involved in both development and oncogenesis, and a well-studied family member, Wnt1, was able to transduce the β-catenin/Tcf-signaling pathway (Papkoff et al., 1996 blue right-pointing triangle; Young et al., 1998 blue right-pointing triangle). WNT10B is another family member that was isolated more than a decade later, and it has been poorly characterized. To better understand the structure and functions of WNT10B in cancer, we studied DNA methylation and the expression of WNT10B in HCC and colon cancer. Primary HCC and colon cancer showed aberrant DNA methylation in 46 and 15% of the samples, respectively. The DNA methylation is specific to the tumors because of the absence in normal samples. MSP analysis in cell lines showed full methylation in a colon cancer cell line, RKO, but no methylation was observed in 10 HCC cell lines. Bisulfite sequencing analysis revealed that the WNT10B CpG-rich region in noncoding exon1 where we designed MSP primers was densely methylated in RKO cells. RT-PCR analysis demonstrated that methylated RKO cells did not express WNT10B in contrast with the abundant expression in unmethylated SW480 cells. In addition, WNT10B expression was not detectable in the methylated leukemia cell line (Raji). In primary HCC, methylated samples did not express WNT10B, whereas four of seven unmethylated samples did express WNT10B. Based on the aberrant DNA methylation and reduced expression observed, we suggest that DNA methylation is associated with reduced expression of WNT10B in cancer cells. We used a demethylating agent, 5Aza-dC, and a histone deacethylase inhibitor, TSA, to test methylation-associated silencing of WNT10B in HuH-7 and RKO cells. 5Aza-dC markedly up-regulated WNT10B expression in both cell lines. The combination treatment of 5Aza-dC and TSA demonstrated a more robust effect. Furthermore, 5Aza-dC treatment induced the demethylation of WNT10B in RKO cells. These results indicate that silenced expression of WNT10B is associated with DNA methylation. RKO is aberrantly methylated in the WNT10B promoter region, whereas HuH-7 did not show the methylation by the MSP analysis. This can be explained by the possible methylation in another DNA region such as enhancer. The expression analysis also revealed that WNT10B was up-regulated in seven of 10 HCC cell lines, one of two colon cancer cell lines, and four of 10 primary HCC samples. Together, the data indicate that WNT10B is up-regulated in some cancers, but observed DNA methylation and the reactivation of the expression by 5Aza-dC indicated that WNT10B is transcriptionally silenced in other cancers.

The seemingly paradoxical finding of the WNT10B activation and inactivation in cancer lead us to further investigate its biological activity. Activating mutations of β-Catenin were reported in various cancers, including HCC. However, we did not find any β-Catenin or Axin mutations in the 10 HCC cell lines examined. Therefore, we determined whether WNT10B transduced the β-catenin/Tcf pathway in those HCC cell lines. We compared the β-catenin/Tcf reporter activity by using endogenous β-catenin and hTcf-4 between WNT10B high-producer and low-producer cell lines. The higher activity in the WNT10B high-producer suggested that WNT10B transduced the β-catenin/Tcf pathway. In addition, the reporter activity was enhanced by exogenously expressed WNT10B. Thus, we constructed stably transfected HuH-7 cells to investigate the function of WNT10B in more detail. We detected the elevation of the β-catenin/Tcf reporter activity in WNT10B stably overexpressing clones as in the mutant β-catenin clone. Furthermore, β-catenin/Tcf target genes, cyclin D1, c-MYC, and COX-2 (He et al., 1998 blue right-pointing triangle; Tetsu and McCormick, 1999 blue right-pointing triangle; Araki et al., 2003 blue right-pointing triangle), were transactivated by WNT10B. Significantly, the WNT10B expression level was correlated with the level of β-catenin/Tcf activity. Consistent with WNT10B overexpression, inhibition of WNT10B by siRNA down-regulated cyclin D1 and c-MYC. Based on these results, we concluded that WNT10B is able to regulate the oncogenic β-catenin/Tcf pathway.

Wnt family members can promote the growth of rodent cells. Wnt1-, Wnt6-, or Wnt7b-transduced cells grew in a higher density (Bradbury et al., 1994 blue right-pointing triangle). Wnt1 induced serum-independent cellular proliferation (Young et al., 1998 blue right-pointing triangle) and enhanced tumorigenicity in nude mice (Rijsewijk et al., 1987 blue right-pointing triangle) and soft agar cloning efficiency by stimulating the β-catenin/Tcf pathway (Bafico et al., 1998 blue right-pointing triangle). Furthermore, as the downstream key factor of Wnt1, β-catenin also induced cellular transformation and enhanced the soft agar cloning efficiency (Orford et al., 1999 blue right-pointing triangle). These reports raise a possibility that WNT10B is an oncogenic protein involved in the β-catenin/Tcf pathway. Therefore, we studied whether WNT10B up-regulated cell growth in vitro and in vivo by using WNT10B-overexpressing HuH-7 clones. Surprisingly, WNT10B-overexpressing clones suppressed cell growth, including the growth rate in a monolayer culture, soft agar cloning efficiency, and tumorigenicity in nude mice, except that the WNT10B intermediate clone increased the incidence of tumors in nude mice. In addition, growth suppression in the soft agar cloning efficiency was directly correlated with the amount of WNT10B expression. A same tendency was observed in the growth rate in a monolayer culture, although it was not statistically significant. A reported growth suppression by WNT10B in erythroid progenitor cells is consistent with our findings (Van Den Berg et al., 1998 blue right-pointing triangle). The up-regulation of c-MYC–induced apoptosis under certain conditions (Prendergast, 1999 blue right-pointing triangle) lead us to investigate whether growth suppression by WNT10B is caused by increased c-MYC. However, the mutant β-catenin clone, which activated c-MYC greater than the WNT10B clones, maintained the growth rate and soft agar cloning efficiency, and it increased tumorigenicity in nude mice. Dominant-negative hTcf-4, which can abrogate the transcriptional activity of the β-catenin/Tcf complex, failed to recover growth of the WNT10B-overexpressing clone. Therefore, c-MYC activation is not likely the cause of growth suppression by WNT10B. These findings indicate that WNT10B is involved in a growth suppression pathway independently of β-catenin/Tcf. Apoptosis may be one of the factors that induces WNT10B-mediated growth suppression, because we found the activation of caspase-3 in WNT10B transiently overexpressed cells. It seems that the balance between the up-regulating and down-regulating functions of WNT10B decide the outcome of cancer cell growth. This hypothesis might explain why the WNT10B intermediate producer showed a reduced growth rate and anchorage-independent growth, but increased tumorigenicity in nude mice. Given the growth suppression activity of WNT10B, we speculate that transcriptional silencing of WNT10B takes place to inhibit its growth suppression effect. Alternatively, the up-regulation of WNT10B is more favorable when its growth suppression activity is specifically alleviated. Wnt10b transgenic mice produce mammary solitary tumors (Lane and Leder, 1997 blue right-pointing triangle), and transgenic mice with a member of the FGF family, int-2, produce multiple carcinomas only when MMTV activated Wnt1 or Wnt10b (Lee et al., 1995 blue right-pointing triangle). These reports suggest that WNT10B activation is insufficient for malignant transformation. We postulated that WNT10B may cooperate with other growth factors in oncogenesis. Therefore, we incubated stable HuH-7 clones with two members of the FGF family proteins, and we found that FGF-2 or FGF-7 stimulated growth synergistically with WNT10B, but not with mutant β-catenin. In addition, the inhibition of WNT10B reduced the growth of HuH-4 or SW480 cells in which FGF-2 (data not shown) or FGF-20 (Kirikoshi et al., 2000 blue right-pointing triangle) was up-regulated, respectively. This suggests that WNT10B collaborates with FGF family proteins to promote oncogenesis. Expression analysis of WNT10B and FGF-2 in primary HCC samples demonstrated interesting data. Four of five metastatic samples with up-regulated WNT10B showed increased FGF-2 expression. Four of five WNT10B/FGF-2 double up-regulated samples were metastatic cases, and metastasis-related osteopontin was not activated in one exceptional case (S49) (Ye et al., 2003 blue right-pointing triangle). The up-regulation of FGF family might promote the metastasis of tumor cells in WNT10B-expressing cancer cells. However, apparently WNT10B/FGF-2 double up-regulation is not sufficient for metastasis, because one double up-regulated case was nonmetastatic, and four cases with FGF-2 up-regulation alone were also nonmetastatic. Other metastasis-associated factors, including osteopontin, may also play a role in HCC (Ye et al., 2003 blue right-pointing triangle).

In general, WNT family proteins are thought to act as ligands to frizzled receptors. WNT10B seems to function in an autocrine or paracrine manner. We propose that WNT10B has dual functions, one function of which promotes oncogenesis through the β-catenin/Tcf pathway, and another function inhibits cell growth by a different mechanism. Our hypothesis is that autocrine or paracrine expression of FGF family proteins cooperates with WNT10B to switch its growth-suppressive effects to growth stimulatory. The release of growth regulatory factors, including FGF family members is an interesting mechanism in tumor growth and metastasis. Our current studies are identifying the mechanism of growth suppression by WNT10B.

Supplementary Material

[Supplemental Materials]

ACKNOWLEDGMENTS

We thank D. Dudek-Creaven for editorial assistance; A. Hancock, M. McMenamin, and E. Spillare for technical support; K. Nomura and T. Kitagawa for support and advice; and G. Trivers for help with the nude mice experiment. This work was supported by the Intramural Research Program of National Institutes of Health, National Cancer Institute, and Center for Cancer Research, NIH SPORE grant P50 CA58184 at The Johns Hopkins Oncology Center, and grant-in-aid for scientific research (S) from Japan Society for the Promotion of Science.

Abbreviations used:

5Aza-dC
5-aza-2′deoxycytidine
COX-2
cyclooxygenase-2
FGF
fibroblast growth factor
HCC
hepatocellular carcinoma
MMTV
mouse mammary tumor virus
MSP
methylation-specific polymerase chain reaction
TSA
trichostatin A.

Footnotes

This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-10-0889) on August 29, 2007.

An external file that holds a picture, illustration, etc.
Object name is dbox.jpg The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org).

REFERENCES

  • Aberle H., Bauer A., Stappert J., Kispert A., Kemler R. beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 1997;16:3797–3804. [PMC free article] [PubMed]
  • Araki Y., Okamura S., Hussain S. P., Nagashima M., He P., Shiseki M., Miura K., Harris C. C. Regulation of cyclooxygenase-2 expression by the Wnt and ras pathways. Cancer Res. 2003;63:728–734. [PubMed]
  • Austin T. W., Solar G. P., Ziegler F. C., Liem L., Matthews W. A role for the Wnt gene family in hematopoiesis: expansion of multilineage progenitor cells. Blood. 1997;89:3624–3635. [PubMed]
  • Bafico A., Gazit A., Wu-Morgan S. S., Yaniv A., Aaronson S. A. Characterization of Wnt-1 and Wnt-2 induced growth alterations and signaling pathways in NIH3T3 fibroblasts. Oncogene. 1998;16:2819–2825. [PubMed]
  • Behrens J., von Kries J. P., Kuhl M., Bruhn L., Wedlich D., Grosschedl R., Birchmeier W. Functional interaction of beta-catenin with the transcription factor LEF-1. Nature. 1996;382:638–642. [PubMed]
  • Bennett C. N., Hodge C. L., MacDougald O. A., Schwartz J. Role of Wnt10b and C/EBPalpha in spontaneous adipogenesis of 243 cells. Biochem. Biophys. Res. Commun. 2003;302:12–16. [PubMed]
  • Bhanot P., Brink M., Samos C. H., Hsieh J. C., Wang Y., Macke J. P., Andrew D., Nathans J., Nusse R. A new member of the frizzled family from Drosophila functions as a Wingless receptor. Nature. 1996;382:225–230. [PubMed]
  • Bradbury J. M., Niemeyer C. C., Dale T. C., Edwards P. A. Alterations of the growth characteristics of the fibroblast cell line C3H 10T1/2 by members of the Wnt gene family. Oncogene. 1994;9:2597–2603. [PubMed]
  • Bradley R. S., Brown A. M. The proto-oncogene int-1 encodes a secreted protein associated with the extracellular matrix. EMBO J. 1990;9:1569–1575. [PMC free article] [PubMed]
  • Bradley R. S., Cowin P., Brown A. M. Expression of Wnt-1 in PC12 cells results in modulation of plakoglobin and E-cadherin and increased cellular adhesion. J. Cell Biol. 1993;123:1857–1865. [PMC free article] [PubMed]
  • Buhler T. A., Dale T. C., Kieback C., Humphreys R. C., Rosen J. M. Localization and quantification of Wnt-2 gene expression in mouse mammary development. Dev. Biol. 1993;155:87–96. [PubMed]
  • Bui T. D., Rankin J., Smith K., Huguet E. L., Ruben S., Strachan T., Harris A. L., Lindsay S. A novel human Wnt gene, WNT10B, maps to 12q13 and is expressed in human breast carcinomas. Oncogene. 1997;14:1249–1253. [PubMed]
  • Cameron E. E., Bachman K. E., Myohanen S., Herman J. G., Baylin S. B. Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat. Genet. 1999;21:103–107. [PubMed]
  • Chan E. F., Gat U., McNiff J. M., Fuchs E. A common human skin tumour is caused by activating mutations in beta-catenin. Nat. Genet. 1999;21:410–413. [PubMed]
  • Cook D., Fry M. J., Hughes K., Sumathipala R., Woodgett J. R., Dale T. C. Wingless inactivates glycogen synthase kinase-3 via an intracellular signalling pathway which involves a protein kinase C. EMBO J. 1996;15:4526–4536. [PMC free article] [PubMed]
  • de La Coste A., Romagnolo B., Billuart P., Renard C. A., Buendia M. A., Soubrane O., Fabre M., Chelly J., Beldjord C., Kahn A., Perret C. Somatic mutations of the beta-catenin gene are frequent in mouse and human hepatocellular carcinomas. Proc. Natl. Acad. Sci. USA. 1998;95:8847–8851. [PMC free article] [PubMed]
  • Dickinson M. E., McMahon A. P. The role of Wnt genes in vertebrate development. Curr. Opin. Genet. Dev. 1992;2:562–566. [PubMed]
  • Du Q., Park K. S., Guo Z., He P., Nagashima M., Shao L., Sahai R., Geller D. A., Hussain S. P. Regulation of human nitric oxide synthase 2 expression by Wnt beta-catenin signaling. Cancer Res. 2006;66:7024–7031. [PubMed]
  • Evan G. I., Wyllie A. H., Gilbert C. S., Littlewood T. D., Land H., Brooks M., Waters C. M., Penn L. Z., Hancock D. C. Induction of apoptosis in fibroblasts by c-myc protein. Cell. 1992;69:119–128. [PubMed]
  • Fukuchi T., Sakamoto M., Tsuda H., Maruyama K., Nozawa S., Hirohashi S. Beta-catenin mutation in carcinoma of the uterine endometrium. Cancer Res. 1998;58:3526–3528. [PubMed]
  • Gavin B. J., McMahon A. P. Differential regulation of the Wnt gene family during pregnancy and lactation suggests a role in postnatal development of the mammary gland. Mol. Cell. Biol. 1992;12:2418–2423. [PMC free article] [PubMed]
  • Hart M. J., de los Santos R., Albert I. N., Rubinfeld B., Polakis P. Downregulation of beta-catenin by human Axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr. Biol. 1998;8:573–581. [PubMed]
  • He T. C., Sparks A. B., Rago C., Hermeking H., Zawel L., da Costa L. T., Morin P. J., Vogelstein B., Kinzler K. W. Identification of c-MYC as a target of the APC pathway. Science. 1998;281:1509–1512. [PubMed]
  • Herman J. G., Graff J. R., Myohanen S., Nelkin B. D., Baylin S. B. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA. 1996;93:9821–9826. [PMC free article] [PubMed]
  • Huguet E. L., McMahon J. A., McMahon A. P., Bicknell R., Harris A. L. Differential expression of human Wnt genes 2, 3, 4, and 7B in human breast cell lines and normal and disease states of human breast tissue. Cancer Res. 1994;54:2615–2621. [PubMed]
  • Ikeda S., Kishida S., Yamamoto H., Murai H., Koyama S., Kikuchi A. Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. EMBO J. 1998;17:1371–1384. [PMC free article] [PubMed]
  • Iozzo R. V., Eichstetter I., Danielson K. G. Aberrant expression of the growth factor Wnt-5A in human malignancy. Cancer Res. 1995;55:3495–3499. [PubMed]
  • Kinzler K. W., Vogelstein B. Lessons from hereditary colorectal cancer. Cell. 1996;87:159–170. [PubMed]
  • Kirikoshi H., Sagara N., Saitoh T., Tanaka K., Sekihara H., Shiokawa K., Katoh M. Molecular cloning and characterization of human FGF-20 on chromosome 8p21.3-p22. Biochem. Biophys. Res. Commun. 2000;274:337–343. [PubMed]
  • Koch A., Denkhaus D., Albrecht S., Leuschner I., von Schweinitz D., Pietsch T. Childhood hepatoblastomas frequently carry a mutated degradation targeting box of the beta-catenin gene. Cancer Res. 1999;59:269–273. [PubMed]
  • Korinek V., Barker N., Morin P. J., van Wichen D., de Weger R., Kinzler K. W., Vogelstein B., Clevers H. Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC−/− colon carcinoma. Science. 1997;275:1784–1787. [PubMed]
  • Lane T. F., Leder P. Wnt-10b directs hypermorphic development and transformation in mammary glands of male and female mice. Oncogene. 1997;15:2133–2144. [PubMed]
  • Lee F. S., Lane T. F., Kuo A., Shackleford G. M., Leder P. Insertional mutagenesis identifies a member of the Wnt gene family as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 transgenic mice. Proc. Natl. Acad. Sci. USA. 1995;92:2268–2272. [PMC free article] [PubMed]
  • Lejeune S., Huguet E. L., Hamby A., Poulsom R., Harris A. L. Wnt5a cloning, expression, and up-regulation in human primary breast cancers. Clin. Cancer Res. 1995;1:215–222. [PubMed]
  • McMahon A. P., Bradley A. The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell. 1990;62:1073–1085. [PubMed]
  • McMahon A. P., Moon R. T. Ectopic expression of the proto-oncogene int-1 in Xenopus embryos leads to duplication of the embryonic axis. Cell. 1989;58:1075–1084. [PubMed]
  • Miyoshi Y., Iwao K., Nagasawa Y., Aihara T., Sasaki Y., Imaoka S., Murata M., Shimano T., Nakamura Y. Activation of the beta-catenin gene in primary hepatocellular carcinomas by somatic alterations involving exon 3. Cancer Res. 1998;58:2524–2527. [PubMed]
  • Moon R. T., Brown J. D., Torres M. WNTs modulate cell fate and behavior during vertebrate development. Trends Genet. 1997;13:157–162. [PubMed]
  • Morin P. J., Sparks A. B., Korinek V., Barker N., Clevers H., Vogelstein B., Kinzler K. W. Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science. 1997;275:1787–1790. [PubMed]
  • Nagai H., Ponglikitmongkol M., Mita E., Ohmachi Y., Yoshikawa H., Saeki R., Yumoto Y., Nakanishi T., Matsubara K. Aberration of genomic DNA in association with human hepatocellular carcinomas detected by 2-dimensional gel analysis. Cancer Res. 1994;54:1545–1550. [PubMed]
  • Nusse R., Varmus H. E. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell. 1982;31:99–109. [PubMed]
  • Nusse R., Varmus H. E. Wnt genes. Cell. 1992;69:1073–1087. [PubMed]
  • Orford K., Orford C. C., Byers S. W. Exogenous expression of beta-catenin regulates contact inhibition, anchorage-independent growth, anoikis, and radiation-induced cell cycle arrest. J. Cell Biol. 1999;146:855–868. [PMC free article] [PubMed]
  • Palacios J., Gamallo C. Mutations in the beta-catenin gene (CTNNB1) in endometrioid ovarian carcinomas. Cancer Res. 1998;58:1344–1347. [PubMed]
  • Papkoff J., Brown A. M., Varmus H. E. The int-1 proto-oncogene products are glycoproteins that appear to enter the secretory pathway. Mol. Cell. Biol. 1987;7:3978–3984. [PMC free article] [PubMed]
  • Papkoff J., Rubinfeld B., Schryver B., Polakis P. Wnt-1 regulates free pools of catenins and stabilizes APC-catenin complexes. Mol. Cell. Biol. 1996;16:2128–2134. [PMC free article] [PubMed]
  • Papkoff J., Schryver B. Secreted int-1 protein is associated with the cell surface. Mol. Cell. Biol. 1990;10:2723–2730. [PMC free article] [PubMed]
  • Parr B. A., McMahon A. P. Dorsalizing signal Wnt-7a required for normal polarity of D-V and A-P axes of mouse limb. Nature. 1995;374:350–353. [PubMed]
  • Peifer M., Pai L. M., Casey M. Phosphorylation of the Drosophila adherens junction protein Armadillo: roles for wingless signal and zeste-white 3 kinase. Dev. Biol. 1994;166:543–556. [PubMed]
  • Pelengaris S., Rudolph B., Littlewood T. Action of Myc in vivo–proliferation and apoptosis. Curr. Opin. Genet. Dev. 2000;10:100–105. [PubMed]
  • Polakis P. Wnt signaling and cancer. Genes Dev. 2000;14:1837–1851. [PubMed]
  • Prendergast G. C. Mechanisms of apoptosis by c-Myc. Oncogene. 1999;18:2967–2987. [PubMed]
  • Ramakrishna N. R., Brown A. M. Wingless, the Drosophila homolog of the proto-oncogene Wnt-1, can transform mouse mammary epithelial cells. Dev. Suppl. 1993:95–103. [PubMed]
  • Rijsewijk F., van Deemter L., Wagenaar E., Sonnenberg A., Nusse R. Transfection of the int-1 mammary oncogene in cuboidal RAC mammary cell line results in morphological transformation and tumorigenicity. EMBO J. 1987;6:127–131. [PMC free article] [PubMed]
  • Roelink H., Wagenaar E., Lopes da Silva S., Nusse R. Wnt-3, a gene activated by proviral insertion in mouse mammary tumors, is homologous to int-1/Wnt-1 and is normally expressed in mouse embryos and adult brain. Proc. Natl. Acad. Sci. USA. 1990;87:4519–4523. [PMC free article] [PubMed]
  • Ross S. E., Hemati N., Longo K. A., Bennett C. N., Lucas P. C., Erickson R. L., MacDougald O. A. Inhibition of adipogenesis by Wnt signaling. Science. 2000;289:950–953. [PubMed]
  • Rubinfeld B., Robbins P., El-Gamil M., Albert I., Porfiri E., Polakis P. Stabilization of beta-catenin by genetic defects in melanoma cell lines. Science. 1997;275:1790–1792. [PubMed]
  • Satoh S., et al. AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1. Nat. Genet. 2000;24:245–250. [PubMed]
  • Shackleford G. M., Varmus H. E. Expression of the proto-oncogene int-1 is restricted to postmeiotic male germ cells and the neural tube of mid-gestational embryos. Cell. 1987;50:89–95. [PubMed]
  • Shackleford G. M., Willert K., Wang J., Varmus H. E. The Wnt-1 proto-oncogene induces changes in morphology, gene expression, and growth factor responsiveness in PC12 cells. Neuron. 1993;11:865–875. [PubMed]
  • Shimizu H., Julius M. A., Giarre M., Zheng Z., Brown A. M., Kitajewski J. Transformation by Wnt family proteins correlates with regulation of beta-catenin. Cell Growth Differ. 1997;8:1349–1358. [PubMed]
  • Stark K., Vainio S., Vassileva G., McMahon A. P. Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature. 1994;372:679–683. [PubMed]
  • Takada S., Stark K. L., Shea M. J., Vassileva G., McMahon J. A., McMahon A. P. Wnt-3a regulates somite and tailbud formation in the mouse embryo. Genes Dev. 1994;8:174–189. [PubMed]
  • Tetsu O., McCormick F. Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature. 1999;398:422–426. [PubMed]
  • Thomas K. R., Capecchi M. R. Targeted disruption of the murine int-1 proto-oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature. 1990;346:847–850. [PubMed]
  • van de Wetering M., et al. Armadillo coactivates transcription driven by the product of the Drosophila segment polarity gene dTCF. Cell. 1997;88:789–799. [PubMed]
  • Van Den Berg D. J., Sharma A. K., Bruno E., Hoffman R. Role of members of the Wnt gene family in human hematopoiesis. Blood. 1998;92:3189–3202. [PubMed]
  • Veltmaat J. M., Van Veelen W., Thiery J. P., Bellusci S. Identification of the mammary line in mouse by Wnt10b expression. Dev. Dyn. 2004;229:349–356. [PubMed]
  • Vider B. Z., Zimber A., Chastre E., Prevot S., Gespach C., Estlein D., Wolloch Y., Tronick S. R., Gazit A., Yaniv A. Evidence for the involvement of the Wnt 2 gene in human colorectal cancer. Oncogene. 1996;12:153–158. [PubMed]
  • Voeller H. J., Truica C. I., Gelmann E. P. Beta-catenin mutations in human prostate cancer. Cancer Res. 1998;58:2520–2523. [PubMed]
  • Weber-Hall S. J., Phippard D. J., Niemeyer C. C., Dale T. C. Developmental and hormonal regulation of Wnt gene expression in the mouse mammary gland. Differentiation. 1994;57:205–214. [PubMed]
  • Willert K., Nusse R. beta-Catenin: a key mediator of Wnt signaling. Curr. Opin. Genet. Dev. 1998;8:95–102. [PubMed]
  • Ye Q. H., et al. Predicting hepatitis B virus-positive metastatic hepatocellular carcinomas using gene expression profiling and supervised machine learning. Nat. Med. 2003;9:416–423. [PubMed]
  • Yoshikawa H., Matsubara K., Qian G. S., Jackson P., Groopman J. D., Manning J. E., Harris C. C., Herman J. G. SOCS-1, a negative regulator of the JAK/STAT pathway, is silenced by methylation in human hepatocellular carcinoma and shows growth-suppression activity. Nat. Genet. 2001;28:29–35. [PubMed]
  • Yoshikawa H., Nagai H., Oh K. S., Tamai S., Fujiyama A., Nakanishi T., Kajiyama G., Matsubara K. Chromosome assignment of aberrant NotI restriction DNA fragments in primary hepatocellular carcinoma. Gene. 1997;197:129–135. [PubMed]
  • Young C. S., Kitamura M., Hardy S., Kitajewski J. Wnt-1 induces growth, cytosolic beta-catenin, and Tcf/Lef transcriptional activation in Rat-1 fibroblasts. Mol. Cell. Biol. 1998;18:2474–2485. [PMC free article] [PubMed]
  • Yuza Y., Agawa M., Matsuzaki M., Yamada H., Urashima M. Gene and protein expression profiling during differentiation of neuroblastoma cells triggered by 13-cis retinoic acid. J. Pediatr. Hematol. Oncol. 2003;25:715–720. [PubMed]
  • Zurawel R. H., Chiappa S. A., Allen C., Raffel C. Sporadic medulloblastomas contain oncogenic beta-catenin mutations. Cancer Res. 1998;58:896–899. [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Gene
    Gene
    Gene links
  • Gene (nucleotide)
    Gene (nucleotide)
    Records in Gene identified from shared sequence links
  • GEO Profiles
    GEO Profiles
    Related GEO records
  • HomoloGene
    HomoloGene
    HomoloGene links
  • MedGen
    MedGen
    Related information in MedGen
  • Nucleotide
    Nucleotide
    Published Nucleotide sequences
  • Pathways + GO
    Pathways + GO
    Pathways, annotations and biological systems (BioSystems) that cite the current article.
  • PubMed
    PubMed
    PubMed citations for these articles
  • Substance
    Substance
    PubChem Substance links
  • Taxonomy
    Taxonomy
    Related taxonomy entry
  • Taxonomy Tree
    Taxonomy Tree

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...