• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Mol Biol. Author manuscript; available in PMC Aug 10, 2008.
Published in final edited form as:
PMCID: PMC2041833
NIHMSID: NIHMS27874

Effects of Hepatocyte Nuclear Factor-4α on the Regulation of the Hepatic Acute Phase Response

Summary

Following injury, a large number of hepatic acute phase genes are rapidly modulated at the transcriptional level to restore metabolic homeostasis an limit tissue damage. Hepatocyte nuclear factor 4α (HNF-4α) is a liver-enriched transcription factor that controls embryonic liver development and regulates tissue specific gene expression in adult liver cells. Many genes encoding acute phase proteins contain HNF-4α binding sites in their promoter regions and are transcriptionally regulated by HNF-4α. Utilizing a cytokine induced acute phase response in HepG2 cells, we investigated the role of HNF-4α in regulating the transcription of three HNF-4α sensitive genes, α1-antitrypsin (α1-AT), transthyretin (TTR), and apolipoprotein B (ApoB) after injury. The transcriptional behavior of all three genes depends, in part, on the intracellular concentrations of HNF-4α. However, the unique mRNA expression patterns of α1-AT, TTR, and ApoB in response to cytokine treatment were abrogated in HepG2 cells with dramatically reduced HNF-4α protein concentrations. The mechanism by which HNF-4α mediates this injury response is through site specific alterations in HNF-4α binding abilities and transactivation potentials. Cytokine treatment phosphorylates HNF-4α which directly affects HNF-4α activity. Our results demonstrate that HNF-4α is a crucial mediator in the regulation of α1-AT, TTR, and ApoB gene expression before and after injury, providing evidence of a novel role for HNF-4α in the control of the liver's acute phase response.

Keywords: hepatocyte nuclear factor-4, acute phase response, gene expression, cytokines, HepG2 cells

Introduction

Living organisms respond to acute injury or infection with a highly complex reaction, spanning multiple physiological systems, to counter the harmful effects of the injury. The liver is one of the major organs affected, and it responds to injury by initiating the acute phase response (APR). One of the most important features of the APR is the change in concentration of many plasma proteins, known as acute phase proteins (APP). The expression levels of APPs are either positively or negatively regulated by the liver in response to injury. Binding of inflammatory mediators to their respective receptors on hepatocytes induces changes in APR gene expression that are primarily regulated at the transcriptional level 1; 2. A better understanding of the regulation of APR gene expression is essential in order to develop safe and effective means to manipulate this very important clinical response. Although the molecular mechanisms regulating transcriptional events after injury are largely unknown, studies of transcriptional elements regulating gene expression in hepatocytes have identified a number of liver enriched transcription factors, including hepatocyte nuclear factors (HNF)-1, -3, -4, and -6, and members of the CCAAT/enhancer-binding protein (C/EBP) family, that are capable of modulating hepatocyte gene expression in hepatoma cells 3; 4. Among the HNFs, HNF-4α is proposed to play a central role in the regulation of liver transcription factors and their liver-specific targets. Genome-scale location analysis has revealed that the number of genes enriched in HNF-4α chromatin immunoprecipitation is much larger than that observed with typical site-specific regulators, and that HNF-4α binds to about 12% of the genes represented on a human hepatocyte DNA microarray 5.

HNF-4α belongs to the nuclear hormone receptor superfamily (NR2A1) 6 and is expressed in the liver, kidney, intestine, and pancreas 7. Similar to other nuclear receptors, HNF-4α has several functional domains, including the N-terminal transactivation domain (AF-1), a DNA-binding domain, a functionally complex C-terminal region that forms a ligand-binding domain and a dimerization interface, and a transactivation domain (AF-2). In the liver, HNF-4α plays an important role in regulating various genes involved in glucose, fatty acid, amino acid, cholesterol metabolism, blood coagulation, hepatic development and differentiation 8; 9. A key regulatory role of HNF-4α was recently demonstrated in a liver HNF-4α-deficient mouse model 4. HNF-4α was shown to control the expression of other important liver enriched transcription factors in vivo in both a positive (HNF-1α, C/EBP-α and C/EBP-β) and a negative manner (HNF-3α, HNF-3β, HNF-6 and the HNF-4α co-activator PGC-1α) 10. In humans, heterozygous mutations in the HNF-4α gene are associated with an early-onset form of type II diabetes called maturity onset diabetes of the young 1 11. In addition to several mutations in the coding region, a 7-bp deletion of HNF-4α at the 5′ regulatory region was recently found in association with diabetes 12, suggesting that the expression and activity of HNF-4α are important for pancreatic β-cell function. Previous work by our group demonstrated that in several injury models, injury led to significant changes in the binding activities of certain liver specific transcription factors, including HNF-1, HNF-4α, and C/EBP. The most dramatic effects of injury were observed for HNF-4α 13; 14; 15.

The biological characteristics and importance of HNF-4α prompted us to further define the role of HNF-4α on the transcriptional regulation of APR genes, specifically the regulation of the HNF-4α sensitive genes, α1-antitrypsin (α1-AT), transthyretin (TTR), and apolipoprotein B (ApoB). These genes all have unique HNF-4α specific binding sites in their promoter regions 16, and also have differential biological responses to injury in their clinical presentation. Alpha1-AT is a positive APP 17 whose role in APR has not been well defined, whereas TTR represents a well-established negative APP 17. Apolipoprotein B is an HNF-4α sensitive gene 18, but has not been classified as either a classical positive or negative APP. Utilizing a cytokine-stimulated HepG2 cell model of injury, we characterized and compared the effects of injury on HNF-4α binding, transactivation potential, and APR gene expression. To investigate the functional interaction between HNF-4α and the APR, we used RNA interference technology to knock down endogenous HNF-4α in HepG2 cells. Our data indicate that the gene expression and response to cytokines of α1-AT, TTR, and ApoB are dependent, in part, on HNF-4α activity via site specific changes in HNF-4α binding, and that the binding affinity of HNF-4α is modulated by phosphorylation. These findings provide new insight on the function of HNF-4α in regulating α1-AT, TTR, and ApoB expression and underscore the importance of HNF-4α in the hepatic response to injury.

Results

Effect of cytokines on the mRNA expression of APR genes

We performed quantitative real-time PCR to determine the effect of cytokines on α1-AT, TTR, and ApoB expression in HepG2 cells. As shown in Figure 1, the incubation of HepG2 cell with IL-1β, IL-6, and TNF-α enhanced α1-AT mRNA levels, which peaked at 1 hour and then decreased to near untreated level by 3 hours (Figure 1(a)). In contrast, TTR mRNA levels were time-dependently reduced by about 40% at 3 hours and dropped progressively to about 80% of control (untreated cells, 0 hour time point) at 18 hours (Figure 1(b)). ApoB mRNA abundance was also reduced in a pattern similar to that of TTR (Figure 1(c)). We confirmed that our cytokine mixture could initiate a classic APR in the cell injury model by detecting mRNA levels of serum amyloid A (SAA), a major positive APP, which contains no known HNF-4α binding sites 19. As expected, cytokine treatment increased SAA mRNA level about 40-50-fold at 1 hour and time-dependently increased the levels about 100-fold at 18 hours compared to untreated HepG2 cells (Figure 1(d)).

Figure 1
Effects of cytokines on the expression of α1-AT, TTR, ApoB, and SAA mRNA

Cytokines modify the DNA binding properties of HNF-4α

The effects of cytokines on the DNA binding properties of HNF-4α were examined. Nuclear extracts prepared from cytokine untreated and treated cells were subjected to electrophoretic mobility-shift assay (EMSA) using radiolabeled double stranded oligonucleotides encompassing the HNF-4α binding sites from the α1-AT, TTR, or ApoB gene promoter region. Time course studies showed that cytokine treatment caused a rapid reduction in HNF-4α binding ability to the TTR specific binding site within 1 hour, and the binding declined to about 50% of control levels at 3- 6 hours (Figure 2(a) and (b), left panels). HNF-4α binding to the α1-AT binding site revealed a slight increase at early time points (30 minutes) and a minor decrease after 1 hour (Figure 2(a) and (b), middle panels). The ApoB binding ability exhibited only marginal changes over the tested time intervals (Figure 2(a) and (b), right panels). The specificity of HNF-4α binding was verified by a supershift assay using an anti-HNF-4α antibody (Figure 2(a), left panel, 2nd lane). In addition, the decrease in HNF-4α DNA binding activity was not due to HNF-4α protein loss from cytokine treatment as shown by Western blot analysis using the same nuclear extracts as those used for running the EMSA. Our results indicate that HNF-4α protein levels did not significantly change in cytokine-treated nuclear extracts at the time points studied compared to untreated controls (p>0.05) (Figure 2(c)).

Figure 2Figure 2
Impact of cytokines on HNF-4α binding to the TTR, α1-AT, and ApoB gene promoters

The effects of cytokines on in vivo HNF-4α binding to the α1-AT, TTR, and ApoB promoter were demonstrated by Chromatin immunoprecipitation (ChIP) assays. HepG2 cell extracts (cytokine untreated and treated) were immunoprecipitated with HNF-4α antibody, and the amount of immunoprecipitated DNA fragments containing HNF-4α binding sites in the promoter regions were amplified by PCR. As shown in Figure 2(d and e), cytokine treatment substantially reduced the amount of HNF-4α bound to the TTR chromatin, as indicated by reduced levels of anti-HNF4α antibody-precipitated chromatin. Also, cytokines slightly reduced the HNF-4α bound to α1-AT, while no significant changes were observed in ApoB chromatin. Non-immune normal goat IgG was used as a negative control. These data are consistent with our EMSA results (Figure 2 (a and b)). The results from both our EMSA and ChIP assays suggest that HNF-4α is capable of binding to the specific sequences present in the α1-AT, TTR, and ApoB gene promoter regions, and that cytokine treatment leads to the modification of HNF-4α binding ability. The variation in the degree of modification appears to be specific to the HNF-4α binding site in a given gene promoter. This observation represents a novel mechanism by which transcriptional activity of HNF-4α could be regulated by injury.

Dephosphorylation of nuclear extract alters HNF-4α binding ability

To test whether HNF-4α binding activity is affected by protein phosphorylation, we incubated nuclear proteins from cytokine-treated and untreated cells with calf intestinal alkaline phosphatase (CIP). Oligonucleotide probe corresponding to the HNF-4α binding site in the promoter region of TTR was labeled with [α-32P]dATP by Klenow fragment of DNA polymerase. After CIP treatment, the ability of HNF-4α binding to TTR specific site was restored in cytokine-treated nuclear extracts; it returned to cytokine-untreated control levels (Figure 3). A similar effect was observed for α1-AT or ApoB site after CIP treatment (data not shown). These data suggest that the cytokine effect on HNF-4α binding activity involves post-translational changes in HNF-4α.

Figure 3
Dephosphorylation of nuclear protein restores HNF-4α DNA binding ability

HNF-4α–dependent transactivation is inhibited by cytokines

The effect of cytokines on HNF-4α-mediated transactivation potential was investigated. A luciferase reporter containing three copies of the specific HNF-4α binding site derived from the α1-AT, TTR, or ApoB promoter was transiently transfected into HepG2 cells. The results depicted in Figure 4(a) show that the luciferase activity of α1-AT, TTR, and ApoB was 9-fold, 4-fold, and 8-fold higher, respectively, than that of the negative control (empty vector, pGL3-promoter). Cytokine treatment significantly suppressed the transcriptional activity of these three HNF-4α binding sites as exhibited by an approximately 80% reduction in activity compared to untreated cells. To exclude the possibility that the reduced expression was related to cytokine induced generalized cell toxicity, an NF-κB-luciferase reporter was utilized. Cytokine stimulation dramatically increased the NF-κB reporter activity compared to untreated cells. The modification of α1-AT, TTR, and ApoB gene expression by cytokines occurs at the transcriptional level and is mediated, in part, through HNF-4α. Moreover, we verified this observation by co-transfection of an HNF-4α expression plasmid with α1-AT-, TTR-or ApoB luciferase reporter, respectively. Over expression of HNF-4α in HepG2 cells produced marked increases in luciferase activity in a dose-dependent manner for all three tested reporters. Furthermore, cytokine stimulation resulted in a relatively more potent inhibition of reporter activity (Figure 4(b)). This finding supports our hypothesis that HNF-4α plays an important role in the transcriptional regulation of these genes after cytokine treatment.

Figure 4
Cytokines suppress HNF-4α mediated APR gene transcription

Reduction of HNF-4α protein concentration changes the acute phase response for HNF-4α sensitive genes

To provide more evidence for HNF-4α involvement in the regulation of APR gene expression, we used RNA interference technology to knock down endogenous HNF-4α in HepG2 cells. HNF-4α short hairpin RNA (shRNA) plasmids or a control shRNA plasmid were transfected into HepG2 cells. The efficiency and specificity of targeting for HNF-4α were examined by immunocytochemistry and immunoblotting. Transfection efficiency was monitored by fluorescence microscopy utilizing a GFP gene in the targeting vector and its expression was readily detected post-transfection. To test the specificity of targeting, we performed immmunostaining for HNF-4α and overlayed the GFP fluorescence images onto the HNF-4α immmuno-staining images. As shown in Figure 5(a), approximately 70% of HepG2 cells revealed GFP green fluorescence (Figure 5(a), left panel), while only a few cells illustrated red HNF-4α staining ((Figure 5(a), middle panel). In the overlayed image ((Figure 5(a), right panel), the cells exhibited either green or red color, indicating that green colored cells effectively transfected with the shHNF-4α/GFP construct did not contain intracellular HNF-4α, whereas red colored cells with poor transfection of shHNF-4α/GFP showed HNF-4α protein staining. Western blot analysis (Figure 5(b) and (c)) demonstrated that HNF-4α shRNA reduced intracellular HNF-4α protein level by 60%- 80% relative to control levels, which was consistent with the GFP fluorescence findings (Figure 5(a), left panel). The results from Figure 5(b) and (c) indicate that knock-down was HNF-4α specific, since nonspecific control shRNA did not influence endogenous HNF-4α protein expression; HNF-4α protein levels were comparable to that of non-transfected HepG2 cells. In addition, the β-actin protein level, which was used as an internal loading control, was not modified by shRNA transfection (Figure 5(b)), further supporting the specificity of HNF-4α gene silencing.

Figure 5
Knockdown of intracellular HNF-4α in HepG2 cells

To directly address the implication of HNF-4α mediating APR gene expression, the HepG2 cells targeted by shHNF-4α or control shRNA were transfected with α1-AT, TTR or ApoB lucifearse reporter construct. As shown in Figure 6, the reduction of HNF-4α protein led to a 60%-76% decrease in luciferase activity for the three genes of interest compared to non-targeting HNF-4α controls. This is in contrast to the data from Figure 4(b) where over expression of HNF-4α caused a dose-dependent up-regulation of reporter gene transcription. Taken together, these data strongly suggest a key role for HNF-4α in the regulation of α1-AT, TTR, and ApoB gene transcription.

Figure 6
Inhibition of HNF-4α expression leads to down-regulation of α1-AT, TTR and ApoB gene transcription

We hypothesized that HNF-4α is involved in cytokine mediated APR gene expression and that the modulating effect of cytokines should be dependent on HNF-4α expression levels. We, therefore, examined mRNA expression of the three HNF-4α sensitive genes, α1-AT, TTR and ApoB, as well as SAA, an HNF-4α non-sensitive gene 20, in cells with and without shHNF-4α targeting. As shown in Figure 7(a-d), in cytokine-untreated cells (0 hour time point), mRNA levels of α1-AT, TTR, and ApoB were all significantly lower in cells transfected with shRNA HNF-4α than in cells with shRNA controls. Among them, the greatest inhibition was seen in the ApoB gene with an approximately 75% reduction in mRNA expression level compared to control (Figure 7(c)). Alpha1-AT and TTR mRNA expression were reduced by 60% and 50% (Figure 7 (a) and (b), respectively. Furthermore, cytokine treatment of cells with decreased HNF-4α protein concentrations resulted in the elimination of the cytokine induced up- or down-regulation of gene expression (Figure 7(a-c) and Figure 1(a-c)) as reflected by the mRNA levels of α1-AT, TTR, and ApoB remaining unchanged from untreated cells within the time points tested (Figure 7(a-c)). In contrast, the mRNA expression of SAA responded to cytokine stimulation with a time-dependent increase, and no significant difference was found between shRNA HNF-4α targeted cells and shRNA control cells (Figure 7(d)). These results clearly indicate that the expression of α1-AT, TTR, and ApoB are likely to be regulated, in part, by HNF-4α during the acute phase response.

Figure 7
Decreasing endogenous HNF-4α in HepG2 cells abolishes the inhibitory effect of cytokines on α1-AT, TTR and ApoB mRNA expression, but does not significantly change the effect of cytokines on SAA expression

Discussion

The central role of HNF-4α in liver specific gene expression is highlighted by the large number of putative HNF-4α target genes reported in a study using a ChIP assay combined with promoter microarray analysis 5. However, the presence of a target site within the promoter/enhancer does not mean that the binding site and the corresponding gene are exclusively under the control of HNF-4α, or that specific HNF-4α binding sites may form HNF-4α DNA complexes in the same way or with the same affinity. Unrelated transcription factors, such as chicken ovalbumin upstream promoter transcription factor (COUP-TF), retinoic acid receptor/retinoid X receptor, or peroxisome proliferator-activated receptor (PPAR), can interact with HNF-4α binding sites under certain conditions 21. It has been documented that nearly half of the genes with NF-κB binding sites show no change in gene expression after treatment with TNF-α, a potent stimulator of NF-κB activation 22. Along the same line, 85% of the mapped CREB binding sites are located near genes that show no response to forskolin, a known activator of CREB 23. Therefore, the elucidation of the functional roles for the specific transcription factor binding sites is important in understanding the control of specific gene expression. The key question addressed in this paper is whether HNF-4α is responsible, in part, for the regulation of APR gene expression after injury.

Hepatocytes are specialized secretory epithelial cells that respond to a variety of nutritional and inflammatory signals by inducing the coordinate expression of genes which play a common biological role. For example, trauma or infection results in the release of cytokines (e.g. IL-1β, IL-6, and TNF-α) which bind to hepatocyte receptors and lead to transcriptional induction or repression of specific sets of acute phase genes 24; 25. Changes in expression of acute phase proteins alter the serum protein composition to allow recovery from the insult or stress. Acute phase gene expression is mediated by transcription factors which recognize distinct target sequences in acute phase responsive promoter regions. It has been shown that several acute phase genes, such as TTR, α1-AT, as well as ApoB, contain HNF-4α binding sites within their promoters/enhancers. However, the role of HNF-4α in the acute phase response has not been previously investigated. We used cytokine treated HepG2 cells as a model to mimic the in vivo liver's response to injury. The hepatoma cell line, HepG2, is similar to hepatocytes in its biologic responsiveness, and is widely used as a model system for studying the regulation of the acute phase response. HepG2 activation with IL-1β, IL-6, and TNF-α leads to a classic acute phase response with modulation of both positive and negative acute phase proteins. Our results (Figure 1) show that cytokine treatment increases the expression of positive acute phase genes, SAA and α1-AT, and decreases the expression of negative acute phase protein, TTR. The mRNA expression of ApoB, not classically considered as an acute phase protein, is also reduced after cytokine treatment. Furthermore, the different mRNA expression patterns modulated by cytokines in α1-AT, TTR, and ApoB genes, all containing HNF-4α specific binding sites in their promoters, are abolished in HepG2 cells expressing shRNA targeting HNF-4α (Figure 7(a-c)). In contrast, the mRNA expression of SAA, with no reported HNF-4α binding site in its promoter 20, shows no significant change after cytokine treatment when the knock-down HNF-4α cells are compared to control cells (Figure 7(d)). These data provide experimental evidence that HNF-4α is responsible, at least in part, for the transcriptional regulatory changes in our cell injury model. This is a previously unrecognized role for HNF-4α in the regulation of the hepatic acute phase response.

The proposed mechanism by which HNF-4α modifies the transcription of α1-AT, TTR, and ApoB after injury is by the alteration of HNF-4α specific binding ability, which in turn affects HNF-4α transactivation potentials. The variation in specific binding affinity after cytokine treatment appears to be specific to a given HNF-4α binding site. To test our hypothesis, we utilize well characterized HNF-4α binding sites in the TTR, α1-AT, and ApoB genes to examine the HNF-4α DNA binding affinity in cytokine-treated HepG2 cells using EMSA and ChIP assays. In EMSA (Figure 2(a and b)), we show that although all three genes are capable of binding to HNF-4α in untreated cells, treatment with cytokines reveals a different pattern of response. The binding capacity in TTR rapidly and significantly decreases in a time-dependent manner, while ApoB shows a slight decline at later time points (6-18 hours), and α1-AT exhibits a biphasic response with a small increase at earlier time points followed by a minor drop from baseline after 1 hour. Similar results are obtained with the ChIP assay (Figure 2(d and e)), which further confirms these binding ability patterns in vivo.

The alteration in binding affinity induced by cytokines is not due to changes in HNF-4α protein levels as the abundance of protein remains unchanged even after 18 hour of incubation with cytokines (Figure 2(c)). A possible explanation is that HNF-4α binding affinity and/or specificity to these three HNF-4α binding sites is not equivalent due to variations in their DNA sequences, and that injury might enhance these differences in a binding site/gene specific manner. Compared to α1-AT and ApoB, HNF-4α binding to TTR specific binding site appears not only to have the lowest affinity in untreated cells, but also to have the greatest decrease after cytokine treatment as observed in EMSA and ChIP assays. The weaker HNF-4α binding capacity in TTR would explain the lower transcriptional activity measured by transient transfection luciferase assays compared to α1-AT and ApoB (Figure 4(a)).

Changes in HNF-4α binding activity have been seen in several models of injury and stress, such as in burn trauma 14, fasting 26, and protein restriction 27. These findings suggest that post-translational modification of HNF-4α is involved in this event. DNA binding properties of HNF-4α can be modulated in a positive or a negative manner by modifications such as acetylation 28 and phosphorylation, which are induced by different signal transduction pathways. Works by Jahan and Chiang indicated that a JNK-dependent pathway inhibits HNF-4α expression and DNA binding in the presence of IL-1β 29. Kuo et al reported that p38 kinase-mediated Ser158 phosphorylation is essential for augmentation of the DNA binding and transactivation potential of HNF-4α by IL-1β and H2O2 30. In addition, Sun et al recently documented that protein kinase C phosphorylates Ser78 of HNF-4α. A phosphomimetic mutant of HNF-4α (S78D) reduces DNA binding and transactivation ability 31. Given that HNF-4α has been shown to be phosphorylated in as many as 13 sites 32, we have not attempted to determine the exact location of the phosphorylated residues; instead we used a cytokine mixture (IL-1β, IL-6, and TNF-α) to induce the acute phase response in HepG2 cells to mimic an in vivo injury model. Focusing on whether alterations in the phosphorylation state of HNF-4α affects its DNA binding ability. Figure 3 shows that dephosphorylation of crude nuclear extracts with phosphatase does not change the binding intensity in cytokine-untreated control cells; however, the binding ability in cytokine-treated cells is restored to control levels. This result suggests that phosphorylation of HNF-4α protein induced by cytokines appears to reduce its DNA binding activity. Combining with our findings that a cytokine-mediated decrease in HNF-4α binding can be blocked with a specific of Janus kinase 2 (JAK2) inhibitor (AG490) 14, we propose that the activation of JAK2 by cytokines leads to HNF-4α phosphorylation, which may account for the decrease in HNF-4α DNA binding ability and subsequent transactivation.

Although cytokine treatment only causes minor changes of HNF-4α binding affinity to the ApoB and α1-AT HNF-4α binding sites, the transactivation potential of HNF-4α as measured by transient transfection assays fell dramatically for both genes at 18 hours after treatment (Figure 4(a)). Other authors have reported the similar findings. Oxombre et al 33 showed that HNF-4α mutations, G115E and G115S, bound the TTR probe poorly compared to wild-type HNF-4α. However, HNF-4α's transcriptional activity was impaired to a greater degree by these mutations than that of their DNA binding activity. Metzgert et al 18 also found that an HNF-4α binding site mutantion in the ApoB promoter yielded a significantly decreased transcriptional activity, while in vitro protein binding was only marginally affected. In our luciferase assay, we cannot exclude the possibility that after cytokine treatment in addition to a partial, but significant, loss of DNA binding, a lack of recruitment of a co-activator may contribute to the strong impairment observed. Alternatively, cytokines may enhance recruitment of a co-repressor.

Both our cell and animal injury models14 demonstrate that cytokine treatment/injury reduces HNF-4α DNA binding affinity. To define whether exogenous HNF-4α could mediate the effect of cytokine on HNF-4α function, HepG2 cells were transfected with an HNF-4α expression plasmid. We found that over expression of HNF-4α causes a dramatic increase in luciferase activity in a dose-dependent manner for all three genes. However, the increased abundance of HNF4α. by over expression fails to reverse the cytokine effect (Figure 4(b)). In contrast, exogenous HNF-4α can overcome the suppressive effect of cytokines on HNF-4α binding to all three binding sites as seen in EMSA (data not shown). The discrepancy between EMSA and luciferase assay reflects, in part, differences in experimental techniques, but may also reflect an additional mechanism by which injury/cytokine treatment affects HNF-4α ability to modulate gene transcription.

Gene knock-out studies of Hnf4, whether in the fetus or adult, have been found to disrupt expression of a large number of genes involved in most aspects of mature hepatocyte function 34. These functions include control of energy metabolism, xenobiotic detoxification, bile acid synthesis, and serum protein production. To address the function of HNF-4α in adult livers, Hayhurst et al. used the Cre-loxP system to produce adult hepatocytes lacking HNF-4α 4. Mice with Hnf4 null hepatocytes (H4LivKO) exhibited decreased expression of ApoB. This is consistent with our observations that HepG2 cells with significantly reduced HNF-4α protein have a dramatic decline in the expression of ApoB compared to cells with normal intracellular HNF-4α concentrations (Figure 7(c)). Furthermore, we found a loss of the cytokine response in cells expressing shRNA targeting HNF-4α (Figure 7(a-c)), indicating a key role for HNF-4α in regulating the expression of these HNF-4α sensitive genes after injury.

Injury response is a complex and regulated process. We present evidence that injury induces an alteration in the binding affinity and transactivation potential of HNF-4α. These changes in HNF-4α binding affinity are binding site specific and represent a novel means by which the injury response is capable of simultaneously regulating different genes with diverse responses using the same signaling cascades.

Materials and methods

Cell culture injury model

HepG2 cells (ATCC # HB-8065), human hepatoma cells, were grown in Dulbecco Modified Eagle Medium (DMEM) supplemented with penicillin (100 units/ml), streptomycin (100 μg/ml) and, 10% heat-inactivated fetal bovine serum (Mediatech, Herndon, VA) at 37°C in a humidified atmosphere with 5% CO2. At 5 hours prior to the experiment cells were placed in serum-free medium. The injury response in the cells was stimulated with a cytokine mixture consisting 1 ng/ml of recombinant human interleukin (IL)-1β, 10 ng/ml of IL-6, and 10 ng/ml of tumor necrosis factor (TNF)-α (PeproTech, Rocky Hill, NJ) in serum-free medium for the times indicated 14.

Total RNA isolation and RT–PCR

Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions and treated with RNase-free DNase I (Qiagen). Total RNA was diluted and used for quantitative analyses. Reverse transcription was performed in duplicate using the GeneAmp RNA PCR core kit according to the manufacturer's instructions (Applied Biosystems, Foster City, CA) under the following conditions: 10 minutes at 25°C, 15 minutes at 42°C, and a final inactivation step of 5 minutes at 99°C. Samples were amplified in a MicroAmp 96-well reaction plate with the ABI Prism® 7000 Sequence Detection System in TaqMan Universal PCR Master Mix (containing AmpliTaq Gold enzyme; ABI, no. 4304437). TaqMan probes were used for the human TTR (Hs00174914_m1), α1-AT (Hs00165475_m1), ApoB (Hs00181142_m1), serum amyloid A (Hs00761940_s1), and β-microglobulin (Hs99999907_m1) from the TaqMan® Gene Expression Assays (Applied Biosystems). The thermocycler conditions were 2 minutes at 50°C and 10 minutes at 95°C, followed by 40 cycles, each consisting of a denaturing step for 15 seconds at 95°C, and an annealing and extension step for 1 minute at 60°C. Relative quantification was calculated with the RQ study software module of the 7000 System SDS software version 1.2.3 (Applied Biosystems), which uses the comparative threshold cycle (ΔΔCT) method. Human β-microglobulin was used as the endogenous control. Assays were performed in triplicate.

Electrophoretic mobility-shift assay (EMSA)

The preparation of nuclear extracts from HepG2 cells and EMSA were performed as previously described 14. Oligonucleotide sequences corresponding to the HNF-4α binding site in the promoter region of α1-AT (nts −106 to −124; 5'-ACAGGGGCTAAGTCCACTG-3'), TTR (nts −154 to −136; 5'-CTAGGCAAGGTTCATATTT-3'), and ApoB (−63 to −81; 5'-AAAGGTCCAAAGGGCGCCT -3 ') 16 were synthesized and labeled with [α-32P]dATP by Klenow fragment of DNA polymerase as previously described 14.

In vitro dephosphorylation of nuclear extracts

Nuclear protein (10 μg) from HepG2 cells was incubated with 4 units of calf intestinal alkaline phosphatase (CIP, New England Biolabs) at room temperature for 20 minutes and then at 37°C for 10 minutes in dephosphorylation buffer (100 mM NaCl, 50 mM Tris-HCl, pH 7.9, 10 mM MgCl2, 1 mM Dithiothreitol). CIP-treated and -untreated nuclear extracts were subsequently used for EMSA as described above.

Chromatin immunoprecipitation (ChIP) assay

HepG2 cells were grown in 100-mm culture dishes to 80% confluence. The cells were then treated with cytokines for different time periods (1, 3, and 6 hours). Chromatin from HepG2 cells was fixed and assayed using the EZ ChIP assay kit (Upstate Cell Signaling Solutions, Temecula, CA) as recommended by the manufacturer. The purified chromatin was immunoprecipitated using 10 μg of anti-HNF-4α (sc6556, Santa Cruz Biotechnology, Santa Cruz, CA) or normal goat IgG (Santa Cruz). After DNA purification, the presence of the selected DNA sequence was assessed by PCR. The primers used were as follows: 1) TTR gene: CCTAACTGGTCAAATGACCT and ATACTCACTTCTCCTGAGCT, and the PCR product was 191-bp in length; 2) α1-AT: AGCTAAGTGGTACTCTCCCA and ACCAAGGTCACCCCAGTTAT, PCR product was 226-bp; 3). ApoB: CCGAGGCTCTTCAAGGCTCA and CAGCAACCGAGAAGGGCACT for amplifying a 186-bp DNA fragment. The PCR conditions were as follows: 95°C for 15 minutes, followed by 95°C for 30 seconds, 57°C for 30 seconds, and 72°C for 60 seconds for a total of 35-40 cycles. PCR products were resolved in a 1.5% agarose gel and visualized with ethidine bromide stains under UV light.

Expression and reporter plasmids

The expression plasmid for rat HNF-4α was kindly provided by Dr A. Kahn 26. pNF-κB-luc plasmid was purchased from Stratagene (La Jolla, CA). Alpha1-AT, TTR, and ApoB luciferase reporters with three tandem copies of the specific HNF-4α binding site were prepared as follows. Complementary oligonucleotides corresponding to the HNF-4α binding site in the α1-AT (nts 106 to 124), TTR (nts −154 to −136), and ApoB (nts −63 to −81) gene promoter, containing NheI and BglII site adapters, were subcloned into the corresponding restriction sites of the luciferase reporter pGL3-promoter vector (Promega, San Luis Obispo CA). All subcloned sequences were verified by DNA sequence analyses.

Reporter gene transfection studies: Luciferase assay

Plasmids were transiently transfected into subconfluent HepG2 cells using FuGENE HD transfection reagent (Roche Applied Science, Indianapolis, IN). Co-transfection with pRL-CMV (Renilla-luciferase vector, Promega) was carried out to standardize the transfection efficiency. Typically, each well of a 48-well tissue culture plate received 300 ng of each reporter plasmid and 12 ng of pRL-CMV mixed with FuGENE HD reagent (ratio 1: 3) in 14 μl of Opti-MEM medium. Twenty-four hours after transfection, the cells were either treated with cytokines for 18 hours or left untreated. Cell lysates were prepared by shaking the cells in 1× Promega lysis buffer for 15 minutes at room temperature. Firefly and Renilla luciferase activities were measured using a dual reporter assay system (Promega). Firefly luciferase activity values were divided by Renilla luciferase activity values to obtain normalized luciferase activities. Relative luciferase activities were then calculated to facilitate comparisons between samples within a given experiment. All transfection experiments were performed at least three times and with each experimental point run in triplicate. The data are expressed as the mean ± SD. Statistical analyses were performed using Student's t test; p < 0.05 was considered significant.

Design and construction of HNF-4α shRNA (short hairpin RNA) expression plasmids

Target sequences for the HNF-4α shRNAs and control shRNA were determined using Invitrogen Block-it™ RNAi Designer web-based criteria (Invitrogen, Carlsbad, California). The structure of sequences is shown in Figure 8. The pSIF-H1vector (System Biosciences, Mountain View, CA) contains a CMV driven copGFP reporter and an H1 promoter upstream of the cloning restriction sites (BamHI and EcoRI) which allow the introduction of oligonucleotides encoding shRNAs. We constructed a control shRNA and two HNF-4α shRNAs targeting human HNF-4α mRNA starting at 351 and 727, respectively. Each hairpin consisted of a 21 nt sense sequence, a short spacer (CTTCCTGTCAGA), the antisense sequence, and a sequence of 5 Ts (a stop signal for RNA polymerase III). The oligonucleotides were annealed and inserted between the BamHI and EcoRI sites of pSIF-H1vector. Correct insertions of shRNA cassettes were confirmed by restriction mapping and direct DNA sequencing. shRNA plasmids were transfected into HepG2 cells with FuGENE HD transfection reagent (Roche Applied Science) following the manufacture's instructions. Seven-two hours after transfection, cells were prepared for immunofluoresence or Western analyses as described below.

Figure 8
Construction of shHNF-4α plasmid for knocking down intracellular HNF-4α in HepG2 cells

In situ immunofluorescence assay

Transfected cells were grown on glass coverslips and fixed for 10 minutes at −20°C with methanol:acetone (1:1, v/v). After blocking with PBS containing 1% BSA, cells were immunostained with anti-HNF-4α antibody (sc6556, Santa Cruz Biotechnology, Santa Cruz, CA; 1:200) for 1 hour at room temperature, followed by a 30 minutes incubation with Cy3-conjugated anti-goat secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA ;1:200) for 30 minutes at room temperature. Cells were washed in PBS three times between each incubation. The slides were visualized by fluorescence microscopy.

Immunoblotting

Ten micrograms of protein from cell nuclear extracts was used for immunoblotting using standard procedures. We incubated blots with antibodies recognizing HNF-4α (sc6556, Santa Cruz Biotechnology; 1:2,000), and re-probed with β-actin (Sigma; 1:2,000) as an internal loading control.

Acknowledgments

This work was supported by NIH grant (3R01DK064945).

Abbreviations used:

HNF-4α
hepatocyte nuclear factor 4α
APR
acute phase response
APP
acute phase protein
α1-AT
α1-antitrypsin
TTR
transthyretin
ApoB
apolipoprotein B
EMSA
electrophoretic mobility-shift assay
CIP
calf intestinal alkaline phophatase
ChIP
Chromatin immunoprecipitation
shRNA
short hairpin RNA
CMV
cytomegalovirus promoter
GFP
green fluorescent protein
MCS
multiple cloning sites

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Derman E, Krauter K, Walling L, Weinberger C, Ray M, Darnell JE., Jr. Transcriptional control in the production of liver-specific mRNAs. Cell. 1981;23:731–9. [PubMed]
2. Milland J, Tsykin A, Thomas T, Aldred AR, Cole T, Schreiber G. Gene expression in regenerating and acute-phase rat liver. Am J Physiol. 1990;259:G340–7. [PubMed]
3. Kuo CJ, Conley PB, Chen L, Sladek FM, Darnell JE, Jr., Crabtree GR. A transcriptional hierarchy involved in mammalian cell-type specification. Nature. 1992;355:457–61. [PubMed]
4. Hayhurst GP, Lee YH, Lambert G, Ward JM, Gonzalez FJ. Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol. 2001;21:1393–403. [PMC free article] [PubMed]
5. Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, Murray HL, Volkert TL, Schreiber J, Rolfe PA, Gifford DK, Fraenkel E, Bell GI, Young RA. Control of pancreas and liver gene expression by HNF transcription factors. Science. 2004;303:1378–81. [PMC free article] [PubMed]
6. Chen WS, Manova K, Weinstein DC, Duncan SA, Plump AS, Prezioso VR, Bachvarova RF, Darnell JE., Jr. Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev. 1994;8:2466–77. [PubMed]
7. Sladek FM, Zhong WM, Lai E, Darnell JE., Jr. Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev. 1990;4:2353–65. [PubMed]
8. Sladek FM. Orphan receptor HNF-4 and liver-specific gene expression. Receptor. 1993;3:223–32. [PubMed]
9. Li J, Ning G, Duncan SA. Mammalian hepatocyte differentiation requires the transcription factor HNF-4alpha. Genes Dev. 2000;14:464–74. [PMC free article] [PubMed]
10. Wiwi CA, Gupte M, Waxman DJ. Sexually dimorphic P450 gene expression in liver-specific hepatocyte nuclear factor 4alpha-deficient mice. Mol Endocrinol. 2004;18:1975–87. [PubMed]
11. Yamagata K, Furuta H, Oda N, Kaisaki PJ, Menzel S, Cox NJ, Fajans SS, Signorini S, Stoffel M, Bell GI. Mutations in the hepatocyte nuclear factor-4alpha gene in maturity-onset diabetes of the young (MODY1) Nature. 1996;384:458–60. [PubMed]
12. Price JA, Fossey SC, Sale MM, Brewer CS, Freedman BI, Wuerth JP, Bowden DW. Analysis of the HNF4 alpha gene in Caucasian type II diabetic nephropathic patients. Diabetologia. 2000;43:364–72. [PubMed]
13. Burke PA, Luo M, Zhu J, Yaffe MB, Forse RA. Injury induces rapid changes in hepatocyte nuclear factor-1: DNA binding. Surgery. 1996;120:374–80. discussion 380-1. [PubMed]
14. Li X, Salisbury-Rowswell J, Murdock AD, Forse RA, Burke PA. Hepatocyte nuclear factor 4 response to injury involves a rapid decrease in DNA binding and transactivation via a JAK2 signal transduction pathway. Biochem J. 2002;368:203–11. [PMC free article] [PubMed]
15. Burke PA, Drotar M, Luo M, Yaffe M, Forse RA. Rapid modulation of liver-specific transcription factors after injury. Surgery. 1994;116:285–92. discussion 292-3. [PubMed]
16. Jiang G, Nepomuceno L, Hopkins K, Sladek FM. Exclusive homodimerization of the orphan receptor hepatocyte nuclear factor 4 defines a new subclass of nuclear receptors. Mol Cell Biol. 1995;15:5131–43. [PMC free article] [PubMed]
17. Gabay C, Kushner I. Acute-phase proteins and other systemic responses to inflammation. N Engl J Med. 1999;340:448–54. [PubMed]
18. Metzger S, Halaas JL, Breslow JL, Sladek FM. Orphan receptor HNF-4 and bZip protein C/EBP alpha bind to overlapping regions of the apolipoprotein B gene promoter and synergistically activate transcription. J Biol Chem. 1993;268:16831–8. [PubMed]
19. Gruys E, Toussaint MJ, Niewold TA, Koopmans SJ. Acute phase reaction and acute phase proteins. J Zhejiang Univ Sci B. 2005;6:1045–56. [PMC free article] [PubMed]
20. Li XX, Huang JH, Rienhoff HY, Jr., Liao WS. Two adjacent C/EBP-binding sequences that participate in the cell-specific expression of the mouse serum amyloid A3 gene. Mol Cell Biol. 1990;10:6624–31. [PMC free article] [PubMed]
21. Sladek F. M. a. S., S.D. Nuclear Receptors and Disease. Academic Press; London: 2001. Hepatocyte nuclear factor 4α pp. 309–361.
22. Martone R, Euskirchen G, Bertone P, Hartman S, Royce TE, Luscombe NM, Rinn JL, Nelson FK, Miller P, Gerstein M, Weissman S, Snyder M. Distribution of NF-kappaB-binding sites across human chromosome 22. Proc Natl Acad Sci U S A. 2003;100:12247–52. [PMC free article] [PubMed]
23. Euskirchen G, Royce TE, Bertone P, Martone R, Rinn JL, Nelson FK, Sayward F, Luscombe NM, Miller P, Gerstein M, Weissman S, Snyder M. CREB binds to multiple loci on human chromosome 22. Mol Cell Biol. 2004;24:3804–14. [PMC free article] [PubMed]
24. Baumann H, Gauldie J. The acute phase response. Immunol Today. 1994;15:74–80. [PubMed]
25. Ihle JN, Witthuhn BA, Quelle FW, Yamamoto K, Thierfelder WE, Kreider B, Silvennoinen O. Signaling by the cytokine receptor superfamily: JAKs and STATs. Trends Biochem Sci. 1994;19:222–7. [PubMed]
26. Viollet B, Kahn A, Raymondjean M. Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4. Mol Cell Biol. 1997;17:4208–19. [PMC free article] [PubMed]
27. Marten NW, Sladek FM, Straus DS. Effect of dietary protein restriction on liver transcription factors. Biochem J. 1996;317(Pt 2):361–70. [PMC free article] [PubMed]
28. Soutoglou E, Katrakili N, Talianidis I. Acetylation regulates transcription factor activity at multiple levels. Mol Cell. 2000;5:745–51. [PubMed]
29. Jahan A, Chiang JY. Cytokine regulation of human sterol 12alpha-hydroxylase (CYP8B1) gene. Am J Physiol Gastrointest Liver Physiol. 2005;288:G685–95. [PubMed]
30. Guo H, Gao C, Mi Z, Wai PY, Kuo PC. Phosphorylation of Ser158 regulates inflammatory redox-dependent hepatocyte nuclear factor-4alpha transcriptional activity. Biochem J. 2006;394:379–87. [PMC free article] [PubMed]
31. Sun K, Montana V, Chellappa K, Brelivet Y, Moras D, Maeda Y, Parpura V, Paschal BM, Sladek FM. Phosphorylation of a conserved serine in the DNA binding domain of nuclear receptors alters intracellular localization. Mol Endocrinol. 2007 [PubMed]
32. Jiang G, Nepomuceno L, Yang Q, Sladek FM. Serine/threonine phosphorylation of orphan receptor hepatocyte nuclear factor 4. Arch Biochem Biophys. 1997;340:1–9. [PubMed]
33. Oxombre B, Kouach M, Moerman E, Formstecher P, Laine B. The G115S mutation associated with maturity-onset diabetes of the young impairs hepatocyte nuclear factor 4alpha activities and introduces a PKA phosphorylation site in its DNA-binding domain. Biochem J. 2004;383:573–80. [PMC free article] [PubMed]
34. Watt AJ, Garrison WD, Duncan SA. HNF4: a central regulator of hepatocyte differentiation and function. Hepatology. 2003;37:1249–53. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...