• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of mbcLink to Publisher's site
Mol Biol Cell. Oct 2007; 18(10): 3883–3893.
PMCID: PMC1995742

CDK-5 Regulates the Abundance of GLR-1 Glutamate Receptors in the Ventral Cord of Caenorhabditis elegans

Francis Barr, Monitoring Editor

Abstract

The proline-directed kinase Cdk5 plays a role in several aspects of neuronal development. Here, we show that CDK-5 activity regulates the abundance of the glutamate receptor GLR-1 in the ventral cord of Caenorhabditis elegans and that it produces corresponding changes in GLR-1–dependent behaviors. Loss of CDK-5 activity results in decreased abundance of GLR-1 in the ventral cord, accompanied by accumulation of GLR-1 in neuronal cell bodies. Genetic analysis of cdk-5 and the clathrin adaptin unc-11 AP180 suggests that CDK-5 functions prior to endocytosis at the synapse. The scaffolding protein LIN-10/Mint-1 also regulates GLR-1 abundance in the nerve cord. CDK-5 phosphorylates LIN-10/Mint-1 in vitro and bidirectionally regulates the abundance of LIN-10/Mint-1 in the ventral cord. We propose that CDK-5 promotes the anterograde trafficking of GLR-1 and that phosphorylation of LIN-10 may play a role in this process.

INTRODUCTION

Cdk5 is a cyclin-dependent kinase whose activity is largely restricted to the nervous system. Cdk5 plays a role in many cellular processes such as neuronal cell migration, axon outgrowth, and neurodegeneration (Dhavan and Tsai, 2001 blue right-pointing triangle). In mammals, the activity of Cdk5 requires association with either of two regulatory subunits, p35 or p39 (Dhavan and Tsai, 2001 blue right-pointing triangle). Cdk5 or p35/p39 knockout mice die perinatally, with aberrant layering of cortical neurons, likely due to cell migration defects (Ohshima et al., 1996 blue right-pointing triangle; Ko et al., 2001 blue right-pointing triangle).

Recent evidence suggests that Cdk5 may also regulate synaptic transmission (Dhavan and Tsai, 2001 blue right-pointing triangle; Bibb, 2003 blue right-pointing triangle; Samuels and Tsai, 2003 blue right-pointing triangle). Both Cdk5 and p35 are localized to synapses, and they are present in subcellular fractions enriched for synaptic membranes (Dhavan and Tsai, 2001 blue right-pointing triangle; Morabito et al., 2004 blue right-pointing triangle). Cdk5 has been proposed to regulate neurotransmitter release by phosphorylating Munc18 and P/Q-type voltage-dependent calcium channels (Fletcher et al., 1999 blue right-pointing triangle; Tomizawa et al., 2002 blue right-pointing triangle) and to regulate synaptic vesicle endocytosis by phosphorylating dynamin, type I phosphatidylinositol (4) phosphate 5-kinase, amphiphysin, and synaptojanin (Samuels and Tsai, 2003 blue right-pointing triangle; Lee et al., 2004 blue right-pointing triangle, 2005 blue right-pointing triangle).

Cdk5 has also been proposed to regulate glutamate receptor function. Fast excitatory synaptic transmission is mediated primarily by two families of glutamate receptors (GluRs): α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors and N-methyl-d-aspartate (NMDA) receptors. Work from several laboratories suggests that regulation of the abundance of postsynaptic AMPA receptors is a cellular mechanism for producing activity-dependent changes in synaptic strength, e.g., long-term potentiation (LTP), long-term depression, and homeostatic plasticity (Malinow and Malenka, 2002 blue right-pointing triangle; Song and Huganir, 2002 blue right-pointing triangle;McGee and Bredt, 2003 blue right-pointing triangle; Park et al., 2004 blue right-pointing triangle). Cdk5 phosphorylates PSD95 and the NMDA receptor subunit NR2A, the latter resulting in increased NMDA receptor currents (Li et al., 2001 blue right-pointing triangle; Wang et al., 2003 blue right-pointing triangle; Morabito et al., 2004 blue right-pointing triangle). Cdk5 may also regulate synaptic plasticity, because manipulation of Cdk5 activity produces defects in LTP and spatial learning (Fischer et al., 2002 blue right-pointing triangle, 2005 blue right-pointing triangle; Ohshima et al., 2005 blue right-pointing triangle).

We have used the nematode Caenorhabditis elegans as a genetic model to study regulation of GluR abundance at synapses. The C.elegans genome encodes two NMDA and eight non-NMDA receptor subunits (Brockie et al., 2001a blue right-pointing triangle), one of which is encoded by the glr-1 gene (Hart et al., 1995 blue right-pointing triangle; Maricq et al., 1995 blue right-pointing triangle). The glr-1 GluR is expressed in ventral cord interneurons (Hart et al., 1995 blue right-pointing triangle; Maricq et al., 1995 blue right-pointing triangle), where it is localized at sensory–interneuron and interneuron–interneuron synapses (Rongo et al., 1998 blue right-pointing triangle; Burbea et al., 2002 blue right-pointing triangle). We previously showed that the synaptic abundance of GLR-1 receptors is regulated by clathrin-mediated endocytosis and ubiquitin ligases (Burbea et al., 2002 blue right-pointing triangle; Juo and Kaplan, 2004 blue right-pointing triangle; Dreier et al., 2005 blue right-pointing triangle), as are mammalian AMPA receptors (Carroll et al., 1999 blue right-pointing triangle; Luscher et al., 1999 blue right-pointing triangle; Man et al., 2000 blue right-pointing triangle; Colledge et al., 2003 blue right-pointing triangle; Patrick et al., 2003 blue right-pointing triangle).

Here, we show that CDK-5 regulates the abundance of GLR-1 in the ventral cord, which may be mediated, in part, by the ability of CDK-5 to regulate the scaffolding protein LIN-10/Mint-1.

MATERIALS AND METHODS

Strains and Reagents

The following strains were used in this study: nuIs24 (Pglr-1::GLR-1::GFP), nuIs125 (Pglr-1::SNB-1::GFP), nuIs1(Pglr-1::gfp), pzIs2 (Pglr-1::cdk-5), nuEx993 (Pglr-1::LIN-10::GFP), p35(gm335), p35(tm648), cdk-5(gm336), cdk-5(ok626), unc-11(e47), glr-1 (n2461), lin-10(n1853), and lin-10(e1439). Note that p35 is also known as cdka-1. All wild-type GLR-1::GFP refers to nuIs24 unless otherwise noted.

The cdk-5 allele gm336 was isolated by screening a C.elegans deletion library. The gm336 mutation corresponds to a 760-base pair deletion defined by the following endpoints (left breakpoint: tagagatttgagagacacaaacaa/right breakpoint: tacttcaattgatatgtggtctgccggg, positionally ambiguous nucleotides are underlined). The cdk-5 allele ok626 was isolated by the C.elegans Knockout Consortium and consists of a 1.6-kb deletion. Both gm336 and ok626 are predicted to be null alleles, because both delete the cdk-5 start codon. The ok626 allele also deletes part of a neighboring gene T27E9.4.

The p35 allele gm335 was isolated by screening a C.elegans deletion library. gm335 deletes the entire coding region of p35. The molecular endpoints of the deletion are undefined. The p35 deletion allele tm648 was isolated by Shohei Mitani (National Bioresource Project) and consists of an 833-base pair deletion. The tm648 deletion removes exons 2 and 3, and it is not likely to encode a functional protein.

Fluorescence Microscopy and Quantitation

All imaging was done using a Zeiss Axiovert 100 microscope (Carl Zeiss, Thornwood, NY) and an ORCA 100 charge-coupled device camera (Hamamatsu, Bridgewater, NJ). Larval stage 4 (L4) animals raised at 20°C were immobilized with 30 mg/ml 2,3-butanedione monoxamine (Sigma-Aldrich, St. Louis, MO) for 5 min before imaging. All images were captured and processed using MetaMorph 4.5 software (Molecular Devices, Downingtown, PA).

Quantitative analysis of puncta fluorescence was achieved using a Planapo 100× (numerical aperture = 1.4) objective (Olympus America, Melville, NY). Maximum intensity projections of Z-series stacks were obtained. Identical fluorescence filters were used for all experiments. Exposure settings and camera gain were set to fill the 12-bit dynamic range without saturation. Line scans of ventral cord puncta fluorescence were obtained using MetaMorph, and they were analyzed in Igor Pro (Wavemetrics, Lake Oswego, OR) using custom-written software (J. Dittman, Massachusetts General Hospital, Boston, MA).

Each line scan corresponded to ~60–70 μm of the ventral nerve cord. Unless otherwise noted, all images were taken from an anterior region of the ventral nerve cord just posterior to the RIG neuronal cell bodies. We also imaged a region of the ventral nerve cord just posterior to the vulva (puncta intensity [normalized] ± SEM: wild type: 1.0 ± 0.06 (n = 25), cdk-5(gm336): 0.71 ± 0.07 (n = 22), p < 0.01; width [μm] ± SEM: wild type: 0.91±0.05, cdk-5(gm336): 0.9 ± 0.08; density [puncta/10 μm] ± SEM: wild type: 1.88±0.1, cdk-5(gm336): 1.76 ± 0.1). These results are similar to those observed in the anterior region of the ventral nerve cord (VNC) (Figure 2). These regions are distinct from that which was analyzed in our previous article, which was anterior to the RIG cell bodies (Juo and Kaplan, 2004 blue right-pointing triangle); consequently, the data reported here cannot be directly compared with those reported previously. Puncta intensities, widths, and densities from each line scan were analyzed in an automated manner using Igor Pro, as described previously (Burbea et al., 2002 blue right-pointing triangle). Puncta intensity was measured as the fractional increase in peak fluorescence of each punctum over the diffuse fluorescence in the ventral nerve cord (%ΔF/F). Puncta widths were determined by measuring the width of each punctum at half the maximum peak fluorescence. Puncta density was determined by the average number of puncta per 10 μm of ventral nerve cord, as described previously (Burbea et al., 2002 blue right-pointing triangle). All the values reported in the figures are means ± SEM. Statistical significance was determined using the Student's t test.

Figure 2.
CDK-5 functions in the ventral cord to regulate the abundance of GLR-1::GFP. GLR-1::GFP puncta in the anterior ventral nerve cord of L4 wild-type (A), cdk-5(gm336) (B), and cdk-5(ok626) (C) animals were imaged. The decreased GLR-1::GFP puncta intensities ...

To quantify soluble green fluorescent protein (GFP) from the glr-1 transcriptional reporter nuIs1, we used MetaMorph version 7.1 software (Molecular Devices) to image the ventral nerve cords of wild-type (nuIs1) and nuIs1;cdk-5(gm336) animals. A defined region posterior to the RIG cell bodies was imaged, and the amount of soluble GFP fluorescence was quantitated using Region Statistics in MetaMorph. The values reported in the text refer to the average pixel intensities ± SEM.

To quantitate the amount of GLR-1::GFP in interneuron cell bodies, we imaged the cell body of the interneuron PVC in L4 animals and quantitated the average pixel intensities of three patches per cell body using MetaMorph version 7.1 software.

Real-Time Polymerase Chain Reaction (PCR)

Total RNA was isolated from wild-type (nuIs24) and cdk-5 null mutant [nuIs24;cdk-5(ok626)] animals by using an RNeasy fibrous tissue kit (QIAGEN, Valencia, CA). cDNA was synthesized using Superscript II (Invitrogen, Carlsbad, CA), and real-time PCR was performed using SYBR Green and SureStart Taq (Stratagene, La Jolla, CA) and a Stratagene MxPro real-time PCR machine. Standard curves were used to calculate the relative amount of glr-1 or lin-10 mRNA in each sample, and they were normalized to actin mRNA.

Transgenes and Germline Transformation

Standard techniques were used to isolate transgenic strains by microinjection of various plasmids (50 ng/μl) with Pttx3::dsRed2 (J. Dittman) as a coinjection marker. nuIs24, nuIs125, and nuEx993 have been described previously (Rongo et al., 1998 blue right-pointing triangle; Juo and Kaplan, 2004 blue right-pointing triangle). The p35 (T23F11.3) and cdk-5 open reading frames (ORFs) were obtained by reverse transcription-PCR from wild-type cDNA and subsequently subcloned under the control of the glr-1 promoter (pV6) [pV6::p35 (KP#1413), pV6::cdk-5 (KP#1414)]. Site-directed mutagenesis was performed on pV6::cdk-5 using QuikChange mutagenesis kit (Stratagene) to mutate Asp144 to Asn in pV6::cdk-5(D144N) (KP#1415), and Lys33 to Thr in pV6::cdk-5(K33T) (KP#1416). The lin-10 ORF was subcloned under the control of the glr-1 promoter to create pV6::lin-10 (KP#199) as described previously (Rongo et al., 1998 blue right-pointing triangle). A Not I site was introduced at the C terminus of LIN-10 just before the stop codon. The LIN-10::GFP construct was created by inserting GFP into the NotI site. Phosphomutant LIN-10(10Pm)::GFP was created by using a combination of site-directed mutagenesis and PCR-overlap extension mutagenesis. The following sites in LIN-10 were mutated to alanine in LIN-10(10Pm): S15A, T26A, T28A, S87A, S155A, S201A, T330A, T396A, T416A, S420A. GFP was introduced at the C terminus of LIN-10 by using a NotI site to create pV6::LIN-10(10Pm)::GFP. All constructs were confirmed by sequencing. Full details of plasmids and oligonucleotides are available upon request.

Behavior Assays

Nose touch assays were preformed as described previously (Kaplan and Horvitz, 1993 blue right-pointing triangle). Briefly, young adult wild-type, cdk-5(gm336), cdk-5(ok626), or glr-1(n2461) animals were placed on a thin lawn of OP50 Escherichia coli and assayed for nose touch responses to an eyelash. Each animal was scored 10 times. For locomotion assays, young adult wild-type animals, overexpressing Pglr-1::cdk-5(pzIs2), glr-1(n2461), and Pglr-1::cdk-5(pzIs2);glr-1(n2461) double mutant animals were transferred with halocarbon oil (Sigma-Aldrich) to an NGM plate without food. After 2 min of equilibration, the number of reversals/min was recorded for a total of 5 min/animal. Both behavioral assays were performed by an experimenter unaware of the mutant genotypes (i.e., in a blind manner).

Kinase Assays

Full-length LIN-10, LIN-10(ΔC) (amino acids [aa] 1–572), and LIN-10(ΔN) (aa 565-954) were N-terminally tagged with glutathione S-transferase (GST), expressed in bacteria and purified using standard techniques. GST-tagged substrates were incubated in a 30-μl reaction with [γ32P]ATP and kinase buffer (50 mM HEPES, pH 7, 10 mM MgCl2, 100 μm ATP, 1 mM dithiothreitol, 50 mM β-glycerolphosphate) for 30 min at 37°C either with or without purified, recombinant CDK5/p25 (a gift from L.-H. Tsai, MIT, MA). Kinase assay reactions were stopped with 30 μl of 2X sample buffer (250 mM Tris, pH 6.8, 4% SDS, 10% β-mercaptoethanol, 15% glycerol, and 0.25% bromophenol blue), and analyzed on SDS-polyacrylamide gels, stained with Coomassie Brilliant Blue, dried and autoradiographed.

RESULTS

CDK-5 and p35 Regulate the Abundance of GLR-1 in the Ventral Nerve Cord

We visualized GLR-1 containing synapses by examining the distribution of a GFP-tagged GLR-1 (GLR-1::GFP) in the ventral nerve cord (VNC). Expression of GLR-1::GFP in the ventral cord interneurons rescues the mechanosensory behavioral defects of glr-1 null mutant animals, indicating that GLR-1::GFP is functional (Rongo et al., 1998 blue right-pointing triangle). GLR-1::GFP has a punctate pattern of localization in the VNC interneurons (Rongo et al., 1998 blue right-pointing triangle). Greater than 80% of the GLR-1::GFP puncta are closely apposed by the presynaptic markers synaptobrevin and the vesicular glutamate transporter (VGLUT), indicating that GLR-1::GFP localizes to postsynaptic elements (Burbea et al., 2002 blue right-pointing triangle).

To test whether CDK-5 regulates GLR-1 trafficking, we analyzed the distribution of GLR-1::GFP in two p35 deletion mutants, p35(tm648) and p35(gm335) (p35 is also known as cdka-1; see Materials and Methods), using quantitative fluorescence microscopy. To estimate the amount of GLR-1::GFP in each punctum, we measured the fluorescence intensities (%ΔF/F) and widths of each punctum, as described previously (see Materials and Methods) (Burbea et al., 2002 blue right-pointing triangle). To assess changes in the number of GLR-1-containing synapses in the ventral cord, we measured the density of GLR-1::GFP puncta. GLR-1::GFP puncta intensities were significantly decreased in both p35 mutants (Figure 1, A–C and E), whereas puncta densities were unchanged (data not shown). The decreased puncta intensities observed in p35(gm335) mutants were corrected by expression of wild-type p35 cDNA in ventral cord interneurons, by using the glr-1 promoter (Figure 1, D–F) (Hart et al., 1995 blue right-pointing triangle; Maricq et al., 1995 blue right-pointing triangle). These data indicate that p35 functions in interneurons to regulate GLR-1::GFP abundance in the ventral cord.

Figure 1.
p35 functions in the ventral cord to regulate the abundance of GLR-1::GFP. GLR-1::GFP puncta in the anterior ventral nerve cord of L4 wild-type (A), p35(tm648) (B), p35(gm335) (C), and rescued p35(gm335) (D) animals were imaged. The decreased GLR-1::GFP ...

We also analyzed the distribution of GLR-1::GFP in the ventral cords of two cdk-5 deletion mutants cdk-5(gm336) and cdk-5(ok626). Both cdk-5 alleles are predicted to be molecular nulls (see Materials and Methods). GLR-1::GFP puncta intensities decreased in both cdk-5(gm336) and cdk-5(ok626) mutants compared with wild-type controls (Figure 2, A–C and E). GLR-1::GFP puncta densities were modestly reduced (13%; p < 0.001) in cdk-5(ok626), but they were unchanged in cdk-5(gm336) (data not shown). The decreased puncta intensities in cdk-5(ok626) were corrected by expression of wild-type cdk-5 cDNA in the interneurons (Figure 2, D and E). Expression of wild type cdk-5 cDNA in cdk-5(ok626) also increased GLR-1::GFP puncta widths compared with wild-type controls (Figure 2, A, D, and F), most likely due to overexpression of CDK-5. These data indicate that cdk-5 functions in the interneurons to regulate GLR-1::GFP abundance in the ventral cord, and the magnitude of this effect was similar to that observed in p35 mutants (Figure 1).

To test whether the kinase activity of CDK-5 is required for regulation of GLR-1, we analyzed the distribution of GLR-1::GFP in strains containing transgenes driving expression of kinase-inactive cdk-5 in interneurons. Overexpression of cdk-5 in wild-type animals increased the intensities and widths of GLR-1::GFP puncta (Figure 3, A and B, G and H), whereas transgenes driving expression of two catalytically inactive CDK-5 mutants (K33T and D144N) (Nikolic et al., 1996 blue right-pointing triangle) did not increase puncta fluorescence (Figure 3, A–D, G, and H). The failure of these mutant constructs to increase GLR-1 abundance in the cord could be caused by decreased stability of the mutant proteins; however, equivalent point mutations in mammalian Cdk5 did not affect protein stability in cultured cells (Nikolic et al., 1996 blue right-pointing triangle). Overexpressing CDK-5(D144N) produced a slight decrease (p < 0.01) in GLR-1::GFP puncta fluorescence (Figure 3G), suggesting that this mutant protein must be expressed at sufficiently high levels to produce dominant-negative activity. The increased GLR-1::GFP abundance caused by overexpression of CDK-5 was eliminated in mutants lacking p35 (Figure 3, A, B, and E–H), suggesting that endogenous p35 is required for this effect. These results indicate that CDK-5/p35 catalytic activity bidirectionally regulates GLR-1::GFP levels in the ventral cord.

Figure 3.
CDK-5 regulation of GLR-1::GFP requires the kinase domain and the regulatory subunit, p35, and it alters GLR-1–mediated behaviors. Expression of wild-type cdk-5 cDNA under the glr-1 promoter increases the abundance of GLR-1::GFP in the ventral ...

The decreased abundance of GLR-1::GFP in cdk-5 null mutants could be due to decreased glr-1 transcription. We tested this possibility by analyzing expression of a glr-1 transcriptional reporter, nuIs1 (Pglr-1::gfp) and by measuring the levels of glr-1 mRNA by using real-time PCR. We found that the levels of soluble GFP in the ventral nerve cord of wild-type and cdk-5 null mutants were not significantly different (average intensity values ± SEM: wild type: 1769 ± 52 AU, n = 22; cdk-5(gm336): 1725 ± 56 arbitrary units [AU], n = 21). Similarly, the abundance of glr-1 mRNA was not significantly different between wild-type and cdk-5 null mutant animals (mean glr-1 mRNA levels ± SEM normalized to actin mRNA: wild-type animals = 0.82 ± 0.1, n = 4; cdk-5(ok626) null mutant animals = 1.08 ± 0.2, n = 6; Student's t test, p = 0.2). These results indicate that the decreased GLR-1::GFP abundance in the ventral nerve cord of cdk-5 null mutants was not caused by decreased glr-1 transcription.

CDK-5 Regulates GLR-1–dependent Behaviors

If CDK-5 regulates the abundance of GLR-1 at synapses, we might expect an effect on GLR-1 function and a consequent change in behavior. Two simple behavioral assays can be used to assess the function of GLR-1–containing synapses: the nose touch assay and locomotion (Hart et al., 1995 blue right-pointing triangle; Maricq et al., 1995 blue right-pointing triangle; Zheng et al., 1999 blue right-pointing triangle). Gentle touch to the nose of the worm results in a mechanosensory reflex that induces backward locomotion. Mutants with defects in glutamatergic signaling, such as glr-1 or eat-4 VGLUT (a presynaptic vesicular glutamate pump) nulls are less responsive to nose touch (Hart et al., 1995 blue right-pointing triangle, 1999 blue right-pointing triangle; Maricq et al., 1995 blue right-pointing triangle; Berger et al., 1998 blue right-pointing triangle). We found that cdk-5 null mutant animals had decreased responses to nose touch compared with wild-type controls (Figure 3I; Student's t test, p < 0.01 for both cdk-5 alleles). We also tested whether increased CDK-5 activity affected locomotion behavior. C.elegans moves in a sinusoidal pattern and alternates between periods of forward and reverse locomotion. The frequency of reversals is dependent on the amount of glutamatergic signaling. For example, mutants with decreased glutamatergic signaling, such as glr-1 or eat-4 VGLUT mutants, have decreased reversal frequencies compared with controls (Zheng et al., 1999 blue right-pointing triangle; Brockie et al., 2001b blue right-pointing triangle; Burbea et al., 2002 blue right-pointing triangle; Juo and Kaplan, 2004 blue right-pointing triangle; Schaefer and Rongo, 2006 blue right-pointing triangle) (Figure 3J). Conversely, mutants with increased glutamatergic signaling have increased reversal frequencies compared with controls (Zheng et al., 1999 blue right-pointing triangle; Burbea et al., 2002 blue right-pointing triangle; Juo and Kaplan, 2004 blue right-pointing triangle; Schaefer and Rongo, 2006 blue right-pointing triangle). We found that animals overexpressing cdk-5 under the glr-1 promoter (Pglr-1::cdk-5) had increased reversal frequencies compared with wild-type controls (Figure 3J), as would be predicted if glutamatergic signaling were increased. Furthermore, the increased reversal frequency caused by overexpressed cdk-5 (Pglr-1::cdk-5) was suppressed in glr-1 null mutant animals (Figure 3J), suggesting that CDK-5 regulation of locomotion behavior is dependent on endogenous GLR-1. Thus, CDK-5 activity bidirectionally regulates GLR-1::GFP abundance in the ventral cord, and produces corresponding changes in GLR-1–mediated behaviors.

The Distribution of Synaptobrevin Was Not Altered in cdk-5 Mutants

To determine whether CDK-5 regulates the trafficking of other synaptic proteins, we examined the distribution of the synaptic vesicle protein, synaptobrevin, tagged with GFP (SNB-1::GFP). The intensities, widths, and densities of SNB-1::GFP puncta were unaltered in both cdk-5(gm336) and cdk-5(ok626) compared with wild-type controls (Figure 4, A–C). These results suggest that the effects of CDK-5 on GLR-1::GFP are unlikely to be a secondary consequence of decreased synaptic inputs, because the density of presynaptic SNB-1::GFP puncta was normal in cdk-5 mutants. Cdk5 has been implicated in synaptic vesicle endocytosis; however, we did not observe increased, diffuse SNB-1::GFP fluorescence in the ventral cord, which is characteristically found in other endocytic mutants (Jorgensen et al., 1995 blue right-pointing triangle; Burbea et al., 2002 blue right-pointing triangle; Schuske et al., 2003 blue right-pointing triangle; Dittman and Kaplan, 2006 blue right-pointing triangle). These results do not exclude the possibility that CDK-5 regulates synaptic vesicle endocytosis, as has been suggested previously (Samuels and Tsai, 2003 blue right-pointing triangle; Lee et al., 2004 blue right-pointing triangle; Lee et al., 2005 blue right-pointing triangle), because our analysis is likely insensitive to small changes in endocytosis (Dittman and Kaplan, 2006 blue right-pointing triangle). Together, our results are most consistent with the idea that CDK-5 directly regulates some aspect of GLR-1 trafficking.

Figure 4.
cdk-5 mutants do not affect the distribution of GFP-tagged synaptobrevin. Synaptobrevin::GFP puncta in the anterior ventral nerve cord of L4 wild-type (A), cdk-5(gm336) (B), and cdk-5(ok626) (C), animals were imaged. Puncta intensities (normalized), widths, ...

CDK-5 Acts Early in the Secretory Pathway to Regulate GLR-1

Cdk5 has been implicated in regulating both anterograde trafficking (Ratner et al., 1998 blue right-pointing triangle; Dhavan and Tsai, 2001 blue right-pointing triangle; Morfini et al., 2004 blue right-pointing triangle), and endocytic recycling of cargo proteins (Samuels and Tsai, 2003 blue right-pointing triangle; Lee et al., 2004 blue right-pointing triangle, 2005 blue right-pointing triangle). Either of these functions could explain the effects of CDK-5 on the distribution of GLR-1::GFP. The decreased GLR-1::GFP observed in cdk-5 mutants could result from increased postendocytic degradation of GLR-1 or from decreased anterograde trafficking of GLR-1 to the VNC. To distinguish between these possibilities, we analyzed unc-11;cdk-5 double mutants (Figure 5, A–F). Null mutations in unc-11, which encodes the clathrin adaptin AP180, have defects in clathrin-mediated endocytosis (Zhang et al., 1998 blue right-pointing triangle; Nonet et al., 1999 blue right-pointing triangle), resulting in the accumulation of GLR-1::GFP in the VNC (Figure 5, A and B) (Burbea et al., 2002 blue right-pointing triangle). If GLR-1::GFP endocytosis is enhanced in a cdk-5 loss-of-function mutant, then the distribution of GLR-1::GFP in unc-11;cdk-5 double mutants should be similar to that seen in unc-11 single mutants, because unc-11 AP180 mutations should block this enhanced retrieval. By contrast, we found that unc-11;cdk-5 double mutants had GLR-1::GFP puncta intensities that were indistinguishable from those found in cdk-5(gm336) single mutants (p = 0.4) (Figure 5, C–F). Similar results were observed in unc-11 double mutants by using the cdk-5(ok626) allele (data not shown). These results suggest that CDK-5 regulates a process that occurs earlier in the secretory pathway than receptor recycling, and they are consistent with a role for CDK-5 in regulating anterograde trafficking of GLR-1::GFP.

Figure 5.
CDK-5 functions upstream of endocytosis. GLR-1::GFP puncta in the anterior ventral nerve cords of L4 wild-type (A), unc-11(e55) AP180 (B), cdk-5(gm336) (C), and double mutant unc-11(e55) AP180;cdk-5(gm336) (D) animals were imaged. Puncta intensities (normalized) ...

If CDK-5 regulates GLR-1 trafficking early in the secretory pathway, we would expect GLR-1 to accumulate in interneuron cell bodies of cdk-5 null mutant animals. We tested this possibility by measuring the abundance of GLR-1::GFP in PVC interneuron cell bodies of wild-type and cdk-5 null mutant animals. We found that GLR-1::GFP cell body fluorescence increased in two independent cdk-5 null mutants, cdk-5(gm336) and cdk-5(ok626), compared with wild-type controls (Figure 5, G and H). This effect was rescued by expressing wild-type cdk-5 cDNA in the interneurons by using the glr-1 promoter (Figure 5, G and H). This cell body accumulation is unlikely to represent a postendocytic compartment, because our double mutant analysis indicates that the CDK-5 effect was not altered by mutations that disrupt clathrin-mediated endocytosis (i.e., unc-11 AP180). Thus, decreased GLR-1::GFP in the ventral cord is accompanied by increased abundance in cell bodies, consistent with our model that CDK-5 regulates GLR-1 trafficking early in the secretory pathway, perhaps by regulating receptor assembly or transit through the endoplasmic reticulum (ER)/Golgi.

CDK-5 Negatively Regulates the Abundance of LIN-10/Mint-1

What is the target of CDK-5 that mediates its effects on GLR-1::GFP? Several studies suggest that the PDZ protein LIN-10/Mint-1 may regulate anterograde membrane trafficking from the ER/Golgi to the synapse. LIN-10/Mint-1 localizes to the Golgi and to synapses, and it regulates the surface expression of AMPA receptors in mammalian hippocampal neurons (Butz et al., 1998 blue right-pointing triangle; Borg et al., 1999 blue right-pointing triangle; Whitfield et al., 1999 blue right-pointing triangle; Tomita et al., 2001 blue right-pointing triangle; Stricker and Huganir, 2003 blue right-pointing triangle). In addition, mammalian LIN-10/Mint-1 has been proposed to act as a cargo adaptor promoting association of the kinesin KIF17 with NMDA receptor-containing transport vesicles (Setou et al., 2000 blue right-pointing triangle). We showed previously that the distribution of GLR-1::GFP is abnormal in lin-10 mutants (Rongo et al., 1998 blue right-pointing triangle). The intensities and widths of GLR-1::GFP puncta increase in lin-10(n1853) loss-of-function mutants compared with wild-type controls (Figure 6A and C–E) (Rongo et al., 1998 blue right-pointing triangle). Similar results were seen in a second loss-of-function mutant lin-10(e1439) (data not shown) (Rongo et al., 1998 blue right-pointing triangle). Conversely, overexpression of lin-10 cDNA in interneurons (using the glr-1 promoter) resulted in a small but significant decrease in GLR-1::GFP puncta intensities and widths compared with wild-type controls (Figure 6, A and B, and D and E). These results indicate that LIN-10/Mint-1 negatively regulates the abundance of GLR-1::GFP in the VNC. These findings are consistent with data from cultured rat neurons where overexpression of wild-type Mint-1 decreased GluR1 surface clusters, whereas expression of a mutant Mint-1 protein, in which the first PDZ domain was mutated, increased GluR1 clusters (Stricker and Huganir, 2003 blue right-pointing triangle).

Figure 6.
LIN-10/Mint-1 negatively regulates GLR-1 abundance in the ventral cord. GLR-1::GFP puncta in the anterior ventral nerve cords of L4 wild-type animals (A), animals expressing lin-10 cDNA under the glr-1 promoter, Pglr-1::lin-10 (B), and lin-10(n1853) Mint-1 ...

One potential model that could explain CDK-5 regulation of GLR-1 is that CDK-5 regulates LIN-10/Mint-1 levels. We tested this idea by examining the effects of CDK-5 activity on the abundance of LIN-10::GFP in the VNC. We previously showed that LIN-10::GFP is expressed in a punctate pattern in the ventral cord and that a subset of these puncta colocalize with GLR-1 (Rongo et al., 1998 blue right-pointing triangle; Juo and Kaplan, 2004 blue right-pointing triangle; Dreier et al., 2005 blue right-pointing triangle). Overexpression of the cdk-5 cDNA in interneurons, by using the glr-1 promoter, decreased the intensities and density of LIN-10::GFP puncta, with no effect on puncta widths (Figure 7, A and B, E–G). Conversely, LIN-10::GFP puncta intensities increased in both cdk-5(gm336) and cdk-5(ok626) loss-of-function mutants (Figure 7, A–E). These results indicate that CDK-5 decreases the abundance of LIN-10::GFP in the ventral nerve cord. Changes in LIN-10::GFP abundance were not caused by changes in expression of the transgene because expression of the glr-1 promoter (which was used to drive expression of this construct) was not altered in cdk-5 mutants (detailed above). Moreover, the abundance of endogenous lin-10 mRNA was not significantly different between wild-type and cdk-5 null mutant animals (mean lin-10 mRNA levels ± SEM normalized to actin mRNA: wild-type animals = 1.1 ± 0.1, n = 4; cdk-5(ok626) null mutant animals = 1.2 ± 0.1, n = 6; Student's t test, p = 0.06). These results indicate that CDK-5 regulates LIN-10::GFP abundance by a posttranscriptional mechanism.

Figure 7.
CDK-5 negatively regulates LIN-10/Mint-1 abundance in the ventral nerve cord. LIN-10::GFP puncta in the anterior ventral nerve cords of L4 wild-type animals (A); animals expressing cdk-5 cDNA under the glr-1 promoter, Pglr-1::cdk-5 (B) and cdk-5(gm336) ...

We next tested whether CDK-5 could directly phosphorylate LIN-10. The amino-terminal half of LIN-10/Mint-1 contains 10 potential CDK-5 phosphorylation sites, Ser/Pro (SP) or Thr/Pro (TP) sequences. The amino-terminal regions of LIN-10/Mint1 proteins are not well conserved in mouse, flies, and worms; however, SP/TP sequences are found in the amino-terminal domains of all LIN-10/Mint1 orthologues, and phophoproteomic analysis indicates that LIN-10/Mint proteins are phosphorylated on SP/TP sites in mouse brain extracts (Ballif et al., 2004 blue right-pointing triangle). To determine whether LIN-10/Mint-1 is a direct substrate for CDK-5, we performed an in vitro kinase assay by using recombinant mammalian Cdk5/p25 and GST-tagged LIN-10 proteins (Figure 8, A and B). p25 is a truncated, more active form of p35 (Dhavan and Tsai, 2001 blue right-pointing triangle). Cdk5/p25 phosphorylated full-length LIN-10 and a deletion mutant lacking the C terminus (ΔC), but not a mutant lacking the N terminus (ΔN) (Figure 8B; data not shown). These results indicate that Cdk5 can directly phosphorylate the amino-terminal domain of LIN-10 in vitro.

Figure 8.
CDK-5 phosphorylates LIN-10/Mint-1 in vitro and phosphomutant LIN-10 blocks the effects of CDK-5 in vivo. (A) Schematic showing N-terminally GST-tagged LIN-10(ΔC) and LIN-10(ΔN). (B) Recombinant substrates GST (lanes 1 and 2), GST-LIN-10(ΔC) ...

To test the in vivo relevance of the CDK-5 phosphorylation sites, we expressed a GFP-tagged mutant protein in which all 10 SP/TP sites were mutated to alanine residues [LIN-10(10Pm)]. The intensity and density of wild-type LIN-10::GFP in the ventral nerve cord were both significantly decreased by overexpression of CDK-5 (Figure 7). By contrast, cdk-5 overexpression did not significantly reduce the intensity (p = 0.14) or density (p = 0.28) of LIN-10(10Pm)::GFP (Figure 8, C–F). An increase in LIN-10(10Pm)::GFP puncta intensity still occurred in cdk-5 null mutants, although the magnitude of the increase was reduced compared with wild-type LIN-10::GFP (Figure 7 and data not shown). These results suggest that phosphorylation of LIN-10 contributes to CDK-5–mediated regulation of LIN-10 abundance in vivo.

Thus far, our results suggest that CDK-5 regulates LIN-10 abundance, which may contribute to CDK-5–mediated regulation of GLR-1 abundance and behaviors. To further test this idea, we analyzed GLR-1 abundance in lin-10;cdk-5 double mutants (Figure 9). If LIN-10 is the only CDK-5 target required for regulation of GLR-1, then we would expect that CDK-5 would not be able to regulate GLR-1 in the absence of LIN-10 in a lin-10 mutant. Instead, we found that GLR-1::GFP puncta intensities in cdk-5;lin-10 double mutants were intermediate in value between cdk-5 and lin-10 single mutants (Figure 9). These results suggest that CDK-5 must have other relevant targets, in addition to LIN-10, because CDK-5 was still able to regulate GLR-1 in lin-10 mutants (i.e., double mutant puncta intensities were significantly lower than those found in lin-10 single mutants).

Figure 9.
LIN-10 is not the only downstream mediator of CDK-5. GLR-1::GFP puncta in the anterior ventral nerve cords of L4 wild-type (A), lin-10(n1853) Mint-1 (B), cdk-5(gm336) (C), and lin-10(n1853);cdk-5(gm336) (D) animals were imaged. Puncta intensities (normalized) ...

DISCUSSION

Cdk5 participates in diverse cellular processes such as cell migration, axon outgrowth, and neurodegeneration (Dhavan and Tsai, 2001 blue right-pointing triangle). Our results suggest that CDK-5 positively regulates the abundance of GLR-1 in the ventral cord and that it has corresponding effects on GLR-1-mediated behaviors (nose touch and locomotion). CDK-5 regulation of GLR-1 depends on its kinase activity and on the regulatory subunit p35. The effects of CDK-5/p35 on GLR-1 are cell autonomous and consistent with the idea that CDK-5 plays a role in regulating GLR-1 trafficking.

CDK-5 Regulation of the Polarized Protein Trafficking Machinery

The scaffolding protein LIN-10/Mint-1 is required for polarized sorting of the LET-23 epidermal growth factor receptor to the basolateral domain of epithelial cells in C.elegans (Kaech et al., 1998 blue right-pointing triangle). In both mammals and worms, LIN-10/Mint-1 proteins have been shown to exist in heteromultimeric protein complexes containing LIN-2/CASK, LIN-7/Veli, Caskin, and SAP97 proteins (Butz et al., 1998 blue right-pointing triangle; Borg et al., 1999 blue right-pointing triangle). These protein complexes have been proposed to play a general role in polarized receptor trafficking in both epithelial cells and neurons (to basolateral and dendritic domains, respectively).

We showed that LIN-10/Mint-1 is likely a physiological substrate of CDK-5. Recombinant CDK-5 phosphorylated LIN-10/Mint-1 in vitro. In vivo, CDK-5 activity decreased the abundance of the scaffolding protein LIN-10/Mint-1 in the ventral cord, and a nonphosphorylatable mutant LIN-10 protein was resistant to this effect (Figures 7 and and8).8). These results suggest that CDK-5 is likely to directly regulate the function of protein complexes containing LIN-10/Mint-1, and thus it could potentially regulate the polarized trafficking of axonal and dendritic proteins.

What Aspect of GLR-1 Trafficking Is Regulated by CDK-5?

CDK-5/p35 seems to regulate an early step in the secretory pathway. Our data show that cdk-5 loss-of-function mutants have decreased GLR-1::GFP in the ventral cord, whereas overexpression of cdk-5 results in increased GLR-1::GFP (Figures 2 and and3).3). Loss of CDK-5 activity prevents accumulation of GLR-1::GFP in the ventral cord after blockade of clathrin-mediated endocytosis (Figure 5). This result suggests that CDK-5 regulates an aspect of GLR-1 trafficking that occurs before receptor recycling. In support of this model, GLR-1::GFP accumulates in neuronal cell bodies in cdk-5 null mutant animals (Figure 5). Thus, CDK-5 could regulate assembly of receptors in the endoplasmic reticulum, budding of receptors from the Golgi, or anterograde transport of receptors from the Golgi to the ventral cord. Consistent with the idea that CDK-5 regulates anterograde transport of GLR-1, previous studies have suggested that Cdk5 promotes kinesin-mediated transport of membrane bound cargo in squid axoplasm (Ratner et al., 1998 blue right-pointing triangle; Morfini et al., 2004 blue right-pointing triangle).

Because LIN-10 regulates GLR-1 in the VNC and has been implicated in receptor trafficking (Rongo et al., 1998 blue right-pointing triangle; Borg et al., 1999 blue right-pointing triangle; Whitfield et al., 1999 blue right-pointing triangle; Setou et al., 2000 blue right-pointing triangle; Tomita et al., 2001 blue right-pointing triangle; Hill et al., 2003 blue right-pointing triangle; Stricker and Huganir, 2003 blue right-pointing triangle), we tested whether LIN-10 was required for the effects of CDK-5 on GLR-1. We found that GLR-1::GFP puncta fluorescence intensities in cdk-5;lin-10 double mutants were intermediate in value between those observed in cdk-5 and lin-10 single mutants (Figure 9). This result could be interpreted in either of two ways: 1) CDK-5 and LIN-10 function in independent parallel pathways to regulate GLR-1, or 2) CDK-5 regulation of GLR-1 is mediated, in part, through LIN-10, but there are other relevant CDK-5 targets in vivo. We favor the second interpretation for several reasons. Changes in LIN-10 abundance are sufficient to alter GLR-1 in the nerve cord (Figure 6). As detailed above, LIN-10 is likely to be a CDK-5 substrate in vivo, whereby LIN-10 abundance in the nerve cord is negatively regulated by CDK-5. These results strongly support the idea that CDK-5 and LIN-10 are two components of a single biochemical pathway. Nonetheless, further experiments will be required to decisively determine the role of LIN-10 in CDK-5–mediated regulation of GLR-1. Our results do clearly indicate that CDK-5 must have additional targets that contribute to regulating GLR-1. Although we have no direct data bearing on the identity of these targets, two interesting possibilities are the microtubule-associated proteins TAU and MAP1B, both of which are known Cdk5 targets (Pigino et al., 1997 blue right-pointing triangle; Flaherty et al., 2000 blue right-pointing triangle).

CDK-5–mediated regulation of LIN-10/Mint1 abundance provides a potential mechanism coupling CDK-5 activity to the anterograde trafficking process. Several previous studies support the idea that LIN-10/Mint-1 proteins are involved in anterograde transport of GluRs. First, mammalian LIN-10/Mint-1 proteins are localized to the trans-Golgi network (TGN), as well as to both pre- and postsynaptic elements (Butz et al., 1998 blue right-pointing triangle; Borg et al., 1999 blue right-pointing triangle; Whitfield et al., 1999 blue right-pointing triangle; Tomita et al., 2001 blue right-pointing triangle; Stricker and Huganir, 2003 blue right-pointing triangle). Thus, LIN-10/Mint1 proteins are found in subcellular locations consistent with a role in anterograde transport. Second, LIN-10/Mint-1 proteins have been proposed to act as coat proteins that promote budding of cargo into transport vesicles at the TGN (Hill et al., 2003 blue right-pointing triangle). Third, the mouse LIN-10/Mint-1 protein has been proposed to act as a cargo adaptor linking NMDA receptor subunits to the anterograde motor protein KIF17 (Setou et al., 2000 blue right-pointing triangle). Fourth, overexpression of LIN-10/Mint-1 proteins in cultured rat neurons decreases delivery of GluR1 to the cell surface (Stricker and Huganir, 2003 blue right-pointing triangle).

These studies raise the possibility that LIN-10/Mint-1 and CDK-5 regulate trafficking of GLR-1 from the ER/Golgi to synaptic sites and that they may do so as part of a single biochemical pathway. Our studies also suggest that CDK-5 regulation of GLR-1 is functionally important, because perturbing CDK-5 activity produces changes in GLR-1–mediated behaviors.

Implications for Neurodegeneration and Synaptic Plasticity

Many previous studies have suggested that Cdk5 plays a central role in neurodegeneration. More recent studies have suggested that Cdk5 also regulates synaptic transmission (Fu et al., 2001 blue right-pointing triangle; Fischer et al., 2002 blue right-pointing triangle, 2005 blue right-pointing triangle; Bibb, 2003 blue right-pointing triangle; Ohshima et al., 2005 blue right-pointing triangle). Our results provide further support for a potential synaptic function for CDK-5. These results have several potentially interesting implications. It is possible that misregulation of anterograde transport of GluRs contributes to the effects of CDK-5 on neurodegeneration. Increased CDK-5 activity, for example, after cleavage of p35 to the more active p25 by the protease calpain, could predispose neurons to excitotoxicity by increasing the delivery of GluRs to dendrites and nerve terminals. Conversely, inhibition of CDK-5 activity may provide a useful therapy for mitigating neuron death by potentially decreasing excitotoxicity.

Several studies have suggested that regulated delivery of GluRs to synapses is an important mechanism for expressing activity-dependent synaptic plasticity (Malinow and Malenka, 2002 blue right-pointing triangle; Song and Huganir, 2002 blue right-pointing triangle; McGee and Bredt, 2003 blue right-pointing triangle). In most cases, the activity-dependent step is proposed to be some aspect of endocytic recycling of GluRs at nerve terminals. For example, a recent study shows that delivery of GluRs from recycling endosomes to the synaptic cell surface is the critical step in LTP (Park et al., 2004 blue right-pointing triangle). Other studies suggest that activity also regulates earlier steps in the secretory pathway. For example, chronic activity blockade regulates the splicing of the NMDA receptor subunit NR1 pre-mRNAs, leading to expression of an NR1 isoform that has accelerated exit from the ER (Mu et al., 2003 blue right-pointing triangle). Our studies provide further support for the idea that regulated anterograde transport of GluRs may provide an additional cellular mechanism for synaptic plasticity.

ACKNOWLEDGMENTS

We thank the following for strains, reagents and advice: L. Dreier (UCLA, CA), J. Dittman, J. McEwen (Massachusetts General Hospital, Boston, MA), H. C. Tseng (MIT, MA), L.-H. Tsai, S. Mitani, the C.elegans Gene Knockout Consortium, and the C.elegans Genetics Center (University of Minnesota, Twin Cities, MN). We thank Emily Malkin for technical assistance and Michele Jacob and members of the Kaplan laboratory for critical comments on this manuscript. This work was supported by grants from the National Institutes of Health (NIH) to J.M.K. (NS32196), and G.G. P.J. was supported by postdoctoral fellowships and NIH grants 1F32NS10957 and NS59953, the American Cancer Society grant PF-00-149-01-CSM, the Massachusetts General Hospital Fund for Medical Discovery, and the March of Dimes (Basil O'Connor Scholar Award).

Footnotes

This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-09-0818) on August 1, 2007.

REFERENCES

  • Ballif B. A., Villen J., Beausoleil S. A., Schwartz D., Gygi S. P. Phosphoproteomic analysis of the developing mouse brain. Mol. Cell. Proteomics. 2004;3:1093–1101. [PubMed]
  • Berger A. J., Hart A. C., Kaplan J. M. G alphas-induced neurodegeneration in Caenorhabditis elegans. J. Neurosci. 1998;18:2871–2880. [PubMed]
  • Bibb J. A. Role of Cdk5 in neuronal signaling, plasticity, and drug abuse. Neurosignals. 2003;12:191–199. [PubMed]
  • Borg J. P., Lopez-Figueroa M. O., de Taddeo-Borg M., Kroon D. E., Turner R. S., Watson S. J., Margolis B. Molecular analysis of the X11-mLin-2/CASK complex in brain. J. Neurosci. 1999;19:1307–1316. [PubMed]
  • Brockie P. J., Madsen D. M., Zheng Y., Mellem J., Maricq A. V. Differential expression of glutamate receptor subunits in the nervous system of Caenorhabditis elegans and their regulation by the homeodomain protein UNC-42. J. Neurosci. 2001a;21:1510–1522. [PubMed]
  • Brockie P. J., Mellem J. E., Hills T., Madsen D. M., Maricq A. V. The C. elegans glutamate receptor subunit NMR-1 is required for slow NMDA-activated currents that regulate reversal frequency during locomotion. Neuron. 2001b;31:617–630. [PubMed]
  • Burbea M., Dreier L., Dittman J. S., Grunwald M. E., Kaplan J. M. Ubiquitin and AP180 regulate the abundance of GLR-1 glutamate receptors at postsynaptic elements in C. elegans. Neuron. 2002;35:107–120. [PubMed]
  • Butz S., Okamoto M., Sudhof T. C. A tripartite protein complex with the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Cell. 1998;94:773–782. [PubMed]
  • Carroll R. C., Beattie E. C., Xia H., Luscher C., Altschuler Y., Nicoll R. A., Malenka R. C., von Zastrow M. Dynamin-dependent endocytosis of ionotropic glutamate receptors. Proc. Natl. Acad. Sci. USA. 1999;96:14112–14117. [PMC free article] [PubMed]
  • Colledge M., Snyder E. M., Crozier R. A., Soderling J. A., Jin Y., Langeberg L. K., Lu H., Bear M. F., Scott J. D. Ubiquitination regulates PSD-95 degradation and AMPA receptor surface expression. Neuron. 2003;40:595–607. [PMC free article] [PubMed]
  • Dhavan R., Tsai L. H. A decade of CDK5. Nat. Rev. Mol. Cell Biol. 2001;2:749–759. [PubMed]
  • Dittman J. S., Kaplan J. M. Factors regulating the abundance and localization of synaptobrevin in the plasma membrane. Proc. Natl. Acad. Sci. USA. 2006;103:11399–11404. [PMC free article] [PubMed]
  • Dreier L., Burbea M., Kaplan J. M. LIN-23-mediated degradation of beta-catenin regulates the abundance of GLR-1 glutamate receptors in the ventral nerve cord of C. elegans. Neuron. 2005;46:51–64. [PubMed]
  • Fischer A., Sananbenesi F., Pang P. T., Lu B., Tsai L. H. Opposing roles of transient and prolonged expression of p25 in synaptic plasticity and hippocampus-dependent memory. Neuron. 2005;48:825–838. [PubMed]
  • Fischer A., Sananbenesi F., Schrick C., Spiess J., Radulovic J. Cyclin-dependent kinase 5 is required for associative learning. J. Neurosci. 2002;22:3700–3707. [PubMed]
  • Flaherty D. B., Soria J. P., Tomasiewicz H. G., Wood J. G. Phosphorylation of human tau protein by microtubule-associated kinases: GSK3beta and cdk5 are key participants. J. Neurosci. Res. 2000;62:463–472. [PubMed]
  • Fletcher A. I., Shuang R., Giovannucci D. R., Zhang L., Bittner M. A., Stuenkel E. L. Regulation of exocytosis by cyclin-dependent kinase 5 via phosphorylation of Munc18. J. Biol. Chem. 1999;274:4027–4035. [PubMed]
  • Fu A. K., Fu W. Y., Cheung J., Tsim K. W., Ip F. C., Wang J. H., Ip N. Y. Cdk5 is involved in neuregulin-induced AChR expression at the neuromuscular junction. Nat. Neurosci. 2001;4:374–381. [PubMed]
  • Hart A. C., Kass J., Shapiro J. E., Kaplan J. M. Distinct signaling pathways mediate touch and osmosensory responses in a polymodal sensory neuron. J. Neurosci. 1999;19:1952–1958. [PubMed]
  • Hart A. C., Sims S., Kaplan J. M. Synaptic code for sensory modalities revealed by C. elegans GLR-1 glutamate receptor. Nature. 1995;378:82–85. [PubMed]
  • Hill K., Li Y., Bennett M., McKay M., Zhu X., Shern J., Torre E., Lah J. J., Levey A. I., Kahn R. A. Munc18 interacting proteins: ADP-ribosylation factor-dependent coat proteins that regulate the traffic of β-Alzheimer's precursor protein. J. Biol. Chem. 2003;278:36032–36040. [PubMed]
  • Jorgensen E. M., Hartwieg E., Schuske K., Nonet M. L., Jin Y., Horvitz H. R. Defective recycling of synaptic vesicles in synaptotagmin mutants of Caenorhabditis elegans. Nature. 1995;378:196–199. [PubMed]
  • Juo P., Kaplan J. M. The anaphase-promoting complex regulates the abundance of GLR-1 glutamate receptors in the ventral nerve cord of C. elegans. Curr. Biol. 2004;14:2057–2062. [PubMed]
  • Kaech S. M., Whitfield C. W., Kim S. K. The LIN-2/LIN-7/LIN-10 complex mediates basolateral membrane localization of the C. elegans EGF receptor LET-23 in vulval epithelial cells. Cell. 1998;94:761–771. [PMC free article] [PubMed]
  • Kaplan J. M., Horvitz H. R. A dual mechanosensory and chemosensory neuron in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA. 1993;90:2227–2231. [PMC free article] [PubMed]
  • Ko J., Humbert S., Bronson R. T., Takahashi S., Kulkarni A. B., Li E., Tsai L. H. p35 and p39 are essential for cyclin-dependent kinase 5 function during neurodevelopment. J. Neurosci. 2001;21:6758–6771. [PubMed]
  • Lee S. Y., Voronov S., Letinic K., Nairn A. C., Di Paolo G., De Camilli P. Regulation of the interaction between PIPKI gamma and talin by proline-directed protein kinases. J. Cell Biol. 2005;168:789–799. [PMC free article] [PubMed]
  • Lee S. Y., Wenk M. R., Kim Y., Nairn A. C., De Camilli P. Regulation of synaptojanin 1 by cyclin-dependent kinase 5 at synapses. Proc. Natl. Acad. Sci. USA. 2004;101:546–551. [PMC free article] [PubMed]
  • Li B. S., Sun M. K., Zhang L., Takahashi S., Ma W., Vinade L., Kulkarni A. B., Brady R. O., Pant H. C. Regulation of NMDA receptors by cyclin-dependent kinase-5. Proc. Natl. Acad. Sci. USA. 2001;98:12742–12747. [PMC free article] [PubMed]
  • Luscher C., Xia H., Beattie E. C., Carroll R. C., von Zastrow M., Malenka R. C., Nicoll R. A. Role of AMPA receptor cycling in synaptic transmission and plasticity. Neuron. 1999;24:649–658. [PubMed]
  • Malinow R., Malenka R. C. AMPA receptor trafficking and synaptic plasticity. Annu. Rev. Neurosci. 2002;25:103–126. [PubMed]
  • Man H. Y., Lin J. W., Ju W. H., Ahmadian G., Liu L., Becker L. E., Sheng M., Wang Y. T. Regulation of AMPA receptor-mediated synaptic transmission by clathrin-dependent receptor internalization. Neuron. 2000;25:649–662. [PubMed]
  • Maricq A. V., Peckol E., Driscoll M., Bargmann C. I. Mechanosensory signalling in C. elegans mediated by the GLR-1 glutamate receptor. Nature. 1995;378:78–81. [PubMed]
  • McGee A. W., Bredt D. S. Assembly and plasticity of the glutamatergic postsynaptic specialization. Curr. Opin. Neurobiol. 2003;13:111–118. [PubMed]
  • Morabito M. A., Sheng M., Tsai L. H. Cyclin-dependent kinase 5 phosphorylates the N-terminal domain of the postsynaptic density protein PSD-95 in neurons. J. Neurosci. 2004;24:865–876. [PubMed]
  • Morfini G., Szebenyi G., Brown H., Pant H. C., Pigino G., DeBoer S., Beffert U., Brady S. T. A novel CDK5-dependent pathway for regulating GSK3 activity and kinesin-driven motility in neurons. EMBO J. 2004;23:2235–2245. [PMC free article] [PubMed]
  • Mu Y., Otsuka T., Horton A. C., Scott D. B., Ehlers M. D. Activity-dependent mRNA splicing controls ER export and synaptic delivery of NMDA receptors. Neuron. 2003;40:581–594. [PubMed]
  • Nikolic M., Dudek H., Kwon Y. T., Ramos Y. F., Tsai L. H. The cdk5/p35 kinase is essential for neurite outgrowth during neuronal differentiation. Genes Dev. 1996;10:816–825. [PubMed]
  • Nonet M. L., Holgado A. M., Brewer F., Serpe C. J., Norbeck B. A., Holleran J., Wei L., Hartwieg E., Jorgensen E. M., Alfonso A. UNC-11, a Caenorhabditis elegans AP180 homologue, regulates the size and protein composition of synaptic vesicles. Mol. Biol. Cell. 1999;10:2343–2360. [PMC free article] [PubMed]
  • Ohshima T., et al. Impairment of hippocampal long-term depression and defective spatial learning and memory in p35 mice. J. Neurochem. 2005;94:917–925. [PubMed]
  • Ohshima T., Ward J. M., Huh C. G., Longenecker G., Veeranna, Pant H. C., Brady R. O., Martin L. J., Kulkarni A. B. Targeted disruption of the cyclin-dependent kinase 5 gene results in abnormal corticogenesis, neuronal pathology and perinatal death. Proc. Natl. Acad. Sci. USA. 1996;93:11173–11178. [PMC free article] [PubMed]
  • Park M., Penick E. C., Edwards J. G., Kauer J. A., Ehlers M. D. Recycling endosomes supply AMPA receptors for LTP. Science. 2004;305:1972–1975. [PubMed]
  • Patrick G. N., Bingol B., Weld H. A., Schuman E. M. Ubiquitin-mediated proteasome activity is required for agonist-induced endocytosis of GluRs. Curr. Biol. 2003;13:2073–2081. [PubMed]
  • Pigino G., Paglini G., Ulloa L., Avila J., Caceres A. Analysis of the expression, distribution and function of cyclin dependent kinase 5 (cdk5) in developing cerebellar macroneurons. J. Cell Sci. 1997;110:257–270. [PubMed]
  • Ratner N., Bloom G. S., Brady S. T. A role for cyclin-dependent kinase(s) in the modulation of fast anterograde axonal transport: effects defined by olomoucine and the APC tumor suppressor protein. J. Neurosci. 1998;18:7717–7726. [PubMed]
  • Rongo C., Whitfield C. W., Rodal A., Kim S. K., Kaplan J. M. LIN-10 is a shared component of the polarized protein localization pathways in neurons and epithelia. Cell. 1998;94:751–759. [PubMed]
  • Samuels B. A., Tsai L. H. Cdk5 is a dynamo at the synapse. Nat. Cell Biol. 2003;5:689–690. [PubMed]
  • Schaefer H., Rongo C. KEL-8 is a substrate receptor for CUL3-dependent ubiquitin ligase that regulates synaptic glutamate receptor turnover. Mol. Biol. Cell. 2006;17:1250–1260. [PMC free article] [PubMed]
  • Schuske K. R., Richmond J. E., Matthies D. S., Davis W. S., Runz S., Rube D. A., van der Bliek A. M., Jorgensen E. M. Endophilin is required for synaptic vesicle endocytosis by localizing synaptojanin. Neuron. 2003;40:749–762. [PubMed]
  • Setou M., Nakagawa T., Seog D. H., Hirokawa N. Kinesin superfamily motor protein KIF17 and mLin-10 in NMDA receptor-containing vesicle transport. Science. 2000;288:1796–1802. [PubMed]
  • Song I., Huganir R. L. Regulation of AMPA receptors during synaptic plasticity. Trends Neurosci. 2002;25:578–588. [PubMed]
  • Stricker N. L., Huganir R. L. The PDZ domains of mLin-10 regulate its trans-Golgi network targeting and the surface expression of AMPA receptors. Neuropharmacology. 2003;45:837–848. [PubMed]
  • Tomita S., Nicoll R. A., Bredt D. S. PDZ protein interactions regulating glutamate receptor function and plasticity. J. Cell Biol. 2001;153:F19–F24. [PMC free article] [PubMed]
  • Tomizawa K., Ohta J., Matsushita M., Moriwaki A., Li S. T., Takei K., Matsui H. Cdk5/p35 regulates neurotransmitter release through phosphorylation and downregulation of P/Q-type voltage-dependent calcium channel activity. J. Neurosci. 2002;22:2590–2597. [PubMed]
  • Wang J., Liu S., Fu Y., Wang J. H., Lu Y. Cdk5 activation induces hippocampal CA1 cell death by directly phosphorylating NMDA receptors. Nat. Neurosci. 2003;6:1039–1047. [PubMed]
  • Whitfield C. W., Benard C., Barnes T., Hekimi S., Kim S. K. Basolateral localization of the Caenorhabditis elegans epidermal growth factor receptor in epithelial cells by the PDZ protein LIN-10. Mol. Biol. Cell. 1999;10:2087–2100. [PMC free article] [PubMed]
  • Zhang B., Koh Y. H., Beckstead R. B., Budnik V., Ganetzky B., Bellen H. J. Synaptic vesicle size and number are regulated by a clathrin adaptor protein required for endocytosis. Neuron. 1998;21:1465–1475. [PubMed]
  • Zheng Y., Brockie P. J., Mellem J. E., Madsen D. M., Maricq A. V. Neuronal control of locomotion in C. elegans is modified by a dominant mutation in the GLR-1 ionotropic glutamate receptor. Neuron. 1999;24:347–361. [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...