• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Dev Biol. Author manuscript; available in PMC Aug 3, 2007.
Published in final edited form as:
PMCID: PMC1939808
NIHMSID: NIHMS24606

Epithelial overexpression of BDNF and NT4 produces distinct gustatory axon morphologies that disrupt initial targeting

Abstract

Most fungiform taste buds fail to become innervated when BDNF or NT4 is overexpressed in the basal layer of tongue epithelium. Here, we examined when and how overexpression of BDNF and NT4 disrupt innervation to fungiform papillae. Overexpression of either factor disrupted chorda tympani innervation patterns either before or during the initial innervation of fungiform papillae. NT4 and BDNF overexpression each disrupted initial innervation by producing different gustatory axon morphologies that emerge at distinct times (E12.5 and E14.5, respectively). Chorda tympani nerve branching was reduced in NT4 overexpressing mice, and neuronal fibers in these mice were fasciculated and remained below the epithelial surface, as if repelled by NT4 overexpression. In contrast, many chorda tympani nerve branches were observed near the epithelial surface in mice overexpressing BDNF, and most were attracted to and invaded non-taste filiform papillae instead of gustatory papillae. These results suggest that BDNF, but not NT4, normally functions as a chemoattractant that allows chorda tympani fibers to distinguish their fungiform papillae targets from non-gustatory epithelium. Since BDNF and NT4 both signal through the p75 and TrkB receptors, trophin-specific activation of different internal signaling pathways must regulate the development of the distinct gustatory axon morphologies in neurotrophin-overexpressing mice.

Keywords: Gustatory, Taste buds, Geniculate ganglion, Neurotrophins, BDNF, NT-4, Chorda tympani, Fungiform papillae, Development, Neuronal morphology

Introduction

Taste bud-containing papillae (i.e., fungiform papillae) are distributed across the front two thirds of the tongue in a spatial array (Miller and Preslar, 1975) that provides predictable targets for innervating neurons. Taste buds are innervated by gustatory neurons of the geniculate ganglion via the chorda tympani nerve, while the remaining epithelium of the tongue is innervated by somatosensory neurons of the trigeminal ganglion via the lingual nerve. During development, gustatory neurons not only innervate very specific regions of the tongue, but the number of neurons that innervate each taste bud is also precisely controlled (Krimm and Hill, 1998, 2000). How neurons innervate the tongue so accurately is unclear, but several lines of evidence suggest that the tongue provides molecular guidance cues to developing gustatory and somatosensory neurons. First, gustatory fibers follow spatially restricted pathways during initial tongue innervation (Mbiene and Mistretta, 1997), suggesting that they are influenced by environmental cues. Second, the oropharyngeal endoderm, which gives rise to taste buds, is chemoattractive for gustatory neurons (Gross et al., 2003). Finally, a chemorepulsive molecule, semaphorin 3A, is expressed in the developing tongue (Giger et al., 1996) and is important for both trigeminal and gustatory axon guidance (Dillon et al., 2004; Rochlin and Farbman, 1998; Rochlin et al., 2000).

Another group of factors that may regulate the specificity of neural innervation in the peripheral taste system are the neurotrophins. In addition to regulating neuronal survival, neurotrophins can influence neuronal morphologies (Cohen-Cory and Fraser, 1995; Lom et al., 2002; McAllister et al., 1995) and function as chemoattractants (Guirland et al., 2004; Li et al., 2005; Ming et al., 1997, 1999; O’Connor and Tessier-Lavigne, 1999; Paves and Saarma, 1997; Tucker et al., 2001). Thus, neurotrophins are capable of regulating the specificity of innervation via several different mechanisms. In the taste system, the neurotrophin brain-derived neurotrophic factor (BDNF) is expressed in fungiform papillae prior to and independently of the arrival of gustatory innervation (Nosrat and Olson, 1995; Nosrat et al., 1996, 2001). BDNF continues to be expressed as taste buds form during development and through adulthood (Ganchrow et al., 2003; Nosrat et al., 1997; Yee et al., 2003). It is well established that BDNF is required for normal gustatory development (Conover et al., 1995; Liu et al., 1995; Mistretta et al., 1999; Nosrat et al., 1997; Oakley et al., 1998; Sun and Oakley, 2002; Zhang et al., 1997). While BDNF is specifically located in the gustatory epithelium, the surrounding lingual epithelium expresses neurotrophin-3 (NT3) (Nosrat and Olson, 1998; Nosrat et al., 1996). Thus, BDNF and NT3 expression occurs at the correct time and in the proper locations to regulate peripheral fiber morphology, target selection, and the initial innervation by gustatory and somatosensory fibers, respectively. In addition, neurotrophin-4 (NT4), which activates the same receptors as BDNF [for review, see (Huang and Reichardt, 2003)], is required for normal gustatory development and, therefore, may also regulate gustatory neuron morphology and/or target selection (Liebl et al., 1999).

Additional evidence supporting a role for the neurotrophins in the ability of gustatory neural fibers to target fungiform papillae comes from in vivo studies, which have demonstrated that disruption of the normal expression pattern of BDNF prevents innervation of the gustatory epithelium (Krimm et al., 2001; Ringstedt et al., 1999). Specifically, when BDNF overexpression is directed to neuroepithelial stem cells of the CNS and PNS and to muscle (Lendahl et al., 1990), developing gustatory axons fail to invade their epithelial taste bud targets and instead remain in the tongue musculature where BDNF levels are high (Ringstedt et al., 1999). In addition, when BDNF or NT4 is overexpressed in basal epithelium, geniculate ganglion neurons fail to innervate many taste buds and in some cases appear to be misdirected to non-gustatory tongue regions, including filiform papillae (Krimm et al., 2001). This misdirection of taste afferents suggests that the spatial distribution of BDNF and NT4 within lingual epithelia is important for appropriate gustatory innervation patterns.

Why chorda tympani axons fail to innervate their appropriate targets in BDNF-overexpressing (BDNF-OE) and NT4-overexpressing (NT4-OE) mice is unclear. Neurotrophin overexpression in skin could disrupt the normal morphological development and branching patterns of chorda tympani axons. BDNF and/or NT4 could function as chemoattractants and, when overexpressed, may cause gustatory neurons to turn towards greater concentrations of neurotrophin (i.e., away from fungiform papillae). Alternatively, chorda tympani neurons could initially innervate fungiform papillae, but continued overexpression of BDNF or NT4 from cells surrounding the taste bud after endogenous BDNF expression normally decreases (Nosrat and Olson, 1995) could induce fiber retraction from fungiform papillae. Such retraction occurs in the skin of BDNF-OE mice, where small unmyelinated fibers withdraw from the epidermis postnatally (LeMaster et al., 1999). The purpose of the current study was to determine whether overexpression of BDNF and/or NT4 disrupts initial targeting of chorda tympani fibers and/or encourages fiber withdraw following innervation of the tongue. We found that both factors act by disrupting initial targeting, and each factor alters neural morphological development in a distinctive manner. BDNF overexpression also encourages fiber withdrawal following initial targeting.

Materials and methods

Animals

The K14-BDNF-OE and K14-NT4-OE mice employed in these studies were isolated from mice with a C3H X C57BL/6J hybrid background and have been described elsewhere (Krimm et al., 2001; LeMaster et al., 1999). Embryonic mice were obtained from mouse breedings set up immediately prior to the 8-h dark period. One transgenic mouse was bred with one wild-type mouse so that transgenic mice could be compared to wild-type littermates. The following morning, males were removed from the cages and female mice were examined for plugs. This day was designated embryonic day 0.5 (E0.5). Ages were verified using morphological features for each embryo stage (Kaufman, 1995). Animals were genotyped with PCR using the probes 5′-AGA CTG CAG TGG ACA TGT CT-3′ and 5′-AAA AGC CAG GAG CAG GGA CGT-3′ for the K14-BDNF-OE transgene and 5′-GTA CTT CTT CGA GAC GCG CTG C-3′ and 5′-AAA AGC CAG GAG CAG GGA CGT-3′ for the detection of the K14-NT4-OE transgene. Animals were cared for and used in accordance with guidelines of the U.S. Public Health Service Policy on Humane Care and Use of Laboratory Animals and the NIH Guide for the Care and Use of Laboratory Animals.

Labeling of ganglia with 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI)

DiI-labeling has been described previously (Krimm et al., 2001). Briefly, timed embryos were fixed with 4% phosphate-buffered paraformaldehyde. The next day, the brain and trigeminal ganglia were removed, and DiI crystals (Molecular Probes, Eugene, OR) were placed on the central side of the geniculate ganglion and facial nerve. To label somatosensory innervation to the tongue, the brain was removed from mice on the day of birth, but DiI crystals were placed on the intact trigeminal ganglion. Embryos were placed between two buffer-soaked towels for 0.5–2 h, returned to 4% paraformaldehyde, and placed at 37°C for 2–12 weeks. Differences in the incubation period were based on the age of the animal because DiI transport is faster in younger than in older mice. After incubation, the tongue was dissected, examined, and photographed using a Leica MZFL dissecting microscope and Optronics Spot-CE camera. Some of the tongues were cleared in glycerol prior to photographing. Images were collected and compared for 11 wild-type, 7 BDNF-OE, and 6 NT4-OE mice at age E18.5; 2 wild-type and 2 BDNF-OE mice at age E15.5; 13 wild-type, 4 BDNF-OE, and 2 NT4-OE mice at age E14.5; 3 wild-type and 2 BDNF-OE mice at age E13.5; and 2 wild-type and 2 NT4-OE mice at age E12.5. Three of the tongues from E18.5 and E14.5 mice in each group were processed for scanning electron microscopy (SEM), and the remaining tongues were sectioned and analyzed using confocal microscopy. Tongues from 3 wild-type, 3 BDNF-OE, and 3 NT4-OE mice were examined on the day of birth following labeling of the trigeminal ganglion.

Scanning electron microscopy (SEM)

Following DiI-labeling and imaging, tongues were rinsed in PBS and fixed for a second time in 3.0% glutaraldehyde in 0.1 M cacodylate buffer (pH = 7.3) overnight at 4°C. Tongues were then rinsed in 0.1 M cacodylate buffer, postfixed in 1% aqueous osmium for 2.0–2.5 h, washed in buffer, and dehydrated in a graded series of ethanols followed by hexamethyldisilazane (HMDS). The HMDS was allowed to evaporate from the tongues in a desiccator overnight. Tongues were mounted on stubs, sputter-coated with gold, and examined in a scanning electron microscope (Phillips 505). Digital SEM images were captured at 130× magnification—a magnification sufficient for differentiating fungiform and filiform papillae. Individual fungiform papillae were located and marked without knowledge of the DiI distribution within the tongue. The SEM tongue images were overlaid onto the DiI-images to determine if any given papilla was innervated. Selected innervated and uninnervated papillae were photographed at higher magnification to document their morphology.

Confocal microscopy

Embryonic tongues were embedded in 10% gelatin solution and fixed overnight in 4% paraformaldehyde. The tongues were then sectioned at 50 μm on a vibratome. Sections were mounted on slides, coverslipped with PBS, and viewed using an Olympus confocal microscope.

Analysis of BDNF transgene expression

Tongues were removed from E12.5, E14.5 BDNF-OE, and wild-type mice and stored in RNAlater TissueProtect Tubes (Qiagen) at −80°C until RNA isolation. Tongues were homogenized using a polytron, and total RNA was isolated using an RNAeasy Micro Kit (Qiagen), resulting in 14 μl of RNA solution. Isolated RNA was treated with DNase and was reverse-transcribed using Superscript reverse transcriptase (Invitrogen), resulting in 20 μl of cDNA solution. One microliter of cDNA was added to a PCR reaction mix (50–μl volume) containing primers to amplify the BDNF transgene (forward primer = AGACTGCAGTGGACATGTCT, reverse primer = AAAAGCCAGGAGCAGGGACGT) or the actin gene (forward primer = TGGAATCCTGTGGCATCCATGAAAC, reverse primer = TAAAACGCAGCTCAGTAACAGTCCG). Aliquots (10 μl) of each reaction mixture were loaded on a 2% agarose gel and electrophoresed. The cDNA bands were visualized with ethidium bromide.

Data analysis

SEM and DiI-labeled images of tongues from E18.5 mice were overlaid and the total number of fungiform papillae, innervated papillae, and uninnervated papillae were quantified for wild-type, BDNF-OE, and NT4-OE mice. The total number of papillae in adult wild-type, BDNF-OE, and NT4-OE mice was quantified in whole tongues stained with methylene blue. The number of specific regions of innervation was compared following labeling of the trigeminal ganglion on the day of birth in wild-type, BDNF-OE, and NT4-OE tongues. Comparisons across groups were made using analysis of variance (ANOVA); individual means were compared using the Fischer’s least-significant difference procedure. P values less than 0.05 were accepted as significant.

Results

Overexpression of either BDNF or NT4 prevents the initial innervation of fungiform papillae

Fungiform papillae are initially innervated between E13.5 and E14.5. To determine when chorda tympani innervation patterns are first disrupted in BDNF-OE and NT4-OE mice, DiI-labeled tongues were examined at E12.5–E14.5. Fiber bundles were more fasciculated and less well-developed in NT4-OE mice at E12.5 than in wild-type mice at this age (Figs. 1A, B). In wild-type mouse tongues at E13.5, while much of the tongue remained uninnervated, some fiber bundles terminated near specific regions on the tongue surface where fungiform papillae could be developing. Consistent with earlier reports, the fiber bundles did not reach the epithelial surface by E13.5 (Fig. 1E; Hall et al., 1999; Mbiene and Roberts, 2003). There were no detectable differences between the innervation patterns of BDNF-OE and wild-type mice at E13.5 (Figs. 1C–F). Thus, the effects of NT4 overexpression began earlier in development than the effects of BDNF overexpression.

Fig. 1
Innervation of the tongue by facial nerve taste afferents at E12.5 (A, B) and at E13.5 (C–F), as demonstrated by DiI-labeling and viewed in tongue whole-mounts. For images A and B, the tongue was photographed under both green and blue excitation, ...

By E14.5, chorda tympani fiber bundles branch at the base of the tongue and near the dorsal tongue surface in wild-type mice. They appear to end near specific regions of the epithelium where fungiform papillae are developing (Figs. 2A and and3A).3A). In BDNF-OE mice, branching from the chorda tympani at the base of the tongue appears similar to that of wild-type mice (Fig. 2B compared to A); but nearer to the lingual surface, where the branching is more robust, the normal branching patterns appear to be disrupted in BDNF-OE mice (compare Fig. 3B to A). Given the abundance of disorganized branching at the surface of the BDNF-OE mouse tongue, it is difficult to know whether or not some fungiform papillae are still innervated. In summary, chorda tympani innervation patterns are disrupted earlier (E12.5) in NT4-OE mice than in BDNF-OE mice (E14.5); however, both factors disrupt innervation patterns by initial target innervation.

Fig. 2
Branching patterns in E14.5 tongues viewed from the side. The same number of branches exit chorda tympani fiber bundles at the base of the tongue in wild-type (A) and BDNF-OE (B) mice, whereas fewer branches exit fiber bundles at the base of the tongue ...
Fig. 3
DiI-labeling reveals innervation of the tongue by taste afferents at day E14.5 of embryonic development. Differences in gustatory axon morphology between wild-type (A), BDNF-OE (B), and NT4-OE (C) mice can be seen from the dorsal surface in tongue whole ...

The difference in timing of the effects of neurotrophin overexpression in BDNF-OE mice compared to NT4-OE mice could be due to differences in timing of initial expression of each respective transgene. That is, perhaps the transgene is not being expressed in BDNF-OE mice by E12.5. Arguing against this possibility, the Keratin 14 promoter (used to drive neurotrophin expression in these mice) has been shown to drive transgene expression very early (at E11.5), before tongue development begins (Figueiredo et al., 2001). Nevertheless, to determine if transgene expression begins by E12.5 in tongues of BDNF-OE mice, we used RT-PCR to examine BDNF-OE transgene expression in BDNF-OE and wild-type mice on E14.5 and E12.5. While actin expression was robust in all tongues examined (Fig. 4), BDNF transgene expression was specific to BDNF-OE mice of both ages and was not detected in wild-type mice. Thus, while both BDNF and NT4 are overexpressed in the tongue by E12.5, only NT4 influences chorda tympani branching this early in development.

Fig. 4
Expression of the K14-BDNF transgene in tongues isolated from mice at E12.5 and E14.5. To determine if BDNF overexpression had begun by E12.5 in the tongues of BDNF-OE mice, RT-PCR analysis of tongue RNA from wild-type and BDNF-OE mice was performed using ...

Epithelial overexpression of BDNF and NT4 produces distinct spatial patterns of altered chorda tympani innervation

Surprisingly, the pattern of altered chorda tympani innervation is very different in NT4-OE mice compared with BDNF-OE mice at E14.5. In contrast to the increased branching seen near the epithelial surface in BDNF-OE mice (Figs. 2B, ,3B),3B), fiber branching near the epithelial surface of NT4-OE mice was inhibited. In NT4-OE mouse tongues, the chorda tympani fibers were fasciculated, and fewer branches exited the chorda tympani at the base of the tongue (Fig. 2C). Most of these branches terminated near the surface in a thick neural mass, without any additional branching (Fig. 3C). Comparisons of SEM and DiI revealed that almost no fungiform papillae were innervated in NT4-OE mice at E14.5. BDNF overexpression and NT4 overexpression thus have very distinctive and opposite influences on the development of gustatory axon morphology.

To determine if chorda tympani axon morphologies in BDNF-OE and NT4-OE mice remain distinctive at later developmental stages, DiI-labeled tongues were examined on E18.5. In wild-type mice, fibers from the chorda tympani branch as they approach the surface of the tongue and innervate specific regions of the lingual epithelium in a very stereotyped pattern (Figs. 5A, D, E). In the mid-region of the tongue, fiber bundles that have exited the chorda tympani at the base of the tongue branch again and approach the epithelial surface to innervate 3 to 4 adjacent fungiform papillae (Fig. 5D). Fiber bundles at the tongue tip, which exit the chorda tympani at the tongue base, extend both rostrally and medially; small fiber bundles exit from these larger fiber bundles to innervate a row of individual fungiform papillae. In wild-type mice, chorda tympani innervation was specific to fungiform papillae and filiform papillae were not innervated (Fig. 5J). This pattern of chorda tympani innervation was observed in all 11 of the E18.5 wild-type mice examined in this study.

Fig. 5
DiI-labeling reveals innervation of the tongue by taste afferents at day E18.5 of embryonic development. Differences in gustatory axon morphology between wild-type (A), BDNF-OE (B), and NT4-OE (C) mice can be seen in tongue whole mounts. In wild-type ...

At E18.5, both BDNF and NT4 overexpression still showed altered chorda tympani innervation patterns compared with wild-type mice (Figs. 5B and C, compared with A). In BDNF-OE mice, branches exited the chorda tympani at the base of the tongue in a manner similar to that seen in wild-type mice. However, the pattern of branching near the lingual surface was disrupted (Figs. 5B, E, G–I). In BDNF-OE mice, many fine chorda tympani fiber bundles innervating the tongue tip and mid-region branched extensively near the epithelial surface (Figs. 5E, G). However, unlike the branching patterns observed in wild-type mice, the chorda tympani fibers in BDNF-OE mice appeared tangled, suggesting that branches were not directed to any particular location on the tongue surface. This pattern of innervation was observed in all 7 of the BDNF-OE mouse tongues examined at E18.5. Most fiber branches in BDNF-OE mice appeared to reach the epithelial surface, and non-gustatory papillae were frequently innervated (Fig. 5M). Near the inter-molar eminence and occasionally in the tongue mid-region, single innervated putative fungiform papillae were sometimes situated in the center of a substantial number of fiber branches that appeared to innervate adjacent filiform papillae (Figs. 5H, I, arrows point to fungiform papillae). These regions of hyper-innervation occurred in 4 of the 7 BDNF-OE mouse tongues examined at E18.5 but had not been observed in any BDNF-OE mouse tongues at E14.5. Overall, the effects of BDNF overexpression appear to be more severe at E18.5 than by E14.5.

In NT4-OE mice, the number of primary branches exiting the chorda tympani at the base of the tongue was reduced and the fibers were more fasciculated than in either wild-type or BDNF-OE mice (Figs. 5C, K, L). The chorda tympani fibers in NT4-OE animals did not extend branches medially or laterally. Instead, the branches present from the base of the tongue to its surface occupied a narrow strip approximately 0.4 mm lateral to the tongue midline (Figs. 5C, L). In the NT4-OE mice, secondary branching near the surface was almost eliminated, most fiber bundles remained more than 100 μm below the epithelial surface (Figs. 5K, N), and few fiber branches reached the epithelial surface (Fig. 5K, arrows). This pattern of morphology was observed in all 6 of the NT4-OE mice examined at E18.5 and was very similar to the pattern of morphology already established by E14.5, although by E18.5, some thin fiber bundles or individual fibers did exit the disorganized neural mass and reached the epithelium (Fig. 5N, arrows). These fibers did not typically innervate either filiform or fungiform papillae. In general, the neural masses had more branches at E18.5 than at E14.5 (compare Fig. 3C with Fig. 5L).

More fungiform papillae are successfully innervated at E18.5 than in adulthood in BDNF-OE mice

By adulthood, only 32% of the total numbers of fungiform papillae that emerge during development remain in both BDNF-OE and NT4-OE mice (Krimm et al., 2001). It is possible that the 68% of fungiform papillae that are lost by adulthood could be lost because they failed to become innervated by E18.5, while those that remain are those papillae that were successfully innervated by E18.5. If so, the number of papillae innervated at E18.5 should predict the number of papillae that remain by adulthood. To test this hypothesis, we combined DiI-labeling of fungiform papillae with scanning electron microscopy (SEM). This technique allowed us to visualize fungiform papillae independently of innervation. The locations of fungiform papillae were determined in a digital SEM image of a tongue (Fig. 6B) and compared with the location of DiI innervation of the same tongue (Fig. 6A) to determine if any given papilla was successfully innervated (Fig. 6, arrowheads). In wild-type tongues at E18.5, almost all fungiform papillae were successfully innervated; however, some uninnervated papillae were also observed (Figs. 6A, B, D, arrows). In three wild-type tongues examined with both DiI and SEM on E18.5, a total of 5 papillae were not innervated. It is possible that the 1–2 papillae/tongue designated as uninnervated were actually innervated; however, this is unlikely because most of the uninnervated papillae (Fig. 6D) were smaller than innervated papillae (Fig. 6C) and appeared to be adopting a filiform morphology. As expected (Mistretta, 1972), most fungiform papillae did not contain pores at this age.

Fig. 6
Comparisons between DiI images (A, G) and SEM (B, H) images of the same tongue allow innervated and uninnervated papillae to be quantified at E18.5 in wild-type (A, B) and BDNF-OE (G, H) mice. The locations of fungiform papillae can be seen in the SEM ...

BDNF-OE mice already have 28% fewer fungiform papillae than wild-types by E18.5 (P < 0.002). We quantified the number of the remaining papillae that were successfully innervated at E18.5 in BDNF-OE and NT4-OE mice using DiI-labeling combined with SEM (Figs. 6E–H). Substantially fewer of the remaining fungiform papillae were successfully innervated in BDNF-OE mice (62%) compared with wild-type mice (95%, Table 1; P < 0.0001). However, more fungiform papillae were innervated at E18.5 than remained by adulthood in BDNF-OE mice (P < 0.001). Therefore, most fungiform papillae in BDNF-OE mice are lost due to a lack of innervation by E18.5. However, an additional developmental process must account for the loss of papillae that were successfully innervated at E18.5, but missing by adulthood (approximately 16 papillae). For example, innervation could be withdrawn from these 16 innervated papillae after E18.5 in BDNF-OE mice.

Table 1
Differences in the number of innervated fungiform papillae at E18.5 and their impact on the final number of papillae in adult wild-type versus transgenic mice

NT4-OE mice had 45% fewer fungiform papillae at E18.5 than wild-type mice (P < 0.003); 69% of these remaining papillae were not innervated. Fewer fungiform papillae were innervated in NT4-OE mouse tongues than in those of BDNF-OE mice at E18.5 (P < 0.0002). Unlike the BDNF-OE mice, in which more fungiform papillae were innervated at E18.5 than in adulthood, the NT4-OE mice had fewer innervated papillae on the dorsal surface of the tongue at E18.5 than they had papillae in adulthood (P < 0.0001). It is possible that uninnervated papillae become innervated postnatally or simply survive through adulthood without innervation in NT4-OE mice.

Trigeminal fibers innervate fewer fungiform papillae in both BDNF-OE and NT4-OE mice by birth

To determine if somatosensory innervation was also influenced by neurotrophin overexpression in the lingual epithelium, we labeled the trigeminal ganglion with DiI. However, because the trigeminal ganglion is large and the caudal portion is immediately rostral to the geniculate ganglion, we were not able to label the trigeminal without also labeling the geniculate ganglion. Therefore, we compared total sensory innervation of the tongue in wild-type, BDNF-OE, and NT4-OE mice on the day of birth. The overall pattern of innervation was similar. However, fewer specific regions on the tongue surface that might represent fungiform papillae were innervated by sensory afferents in BDNF-OE (mean = 82 ± 1.8) and NT4-OE (mean = 77 ± 4.9) mice compared to their wild-type counterparts (mean = 100 ± 2.7; P < 0.005, Fig. 7). It is probable that most of these specific regions are developing fungiform papillae. The effects of BDNF and NT4 overexpression on somatosensory innervation of the tongue, although present, are not as dramatic as the morphological effects of BDNF and NT4 overexpression on gustatory fibers.

Fig. 7
Innervation of the tongue by both trigeminal and facial afferents at birth. The punctate staining indicates sensory innervation to fungiform papillae. Fewer punctate locations are innervated by combined facial and trigeminal fibers in the tongues of BDNF-OE ...

Discussion

BDNF and NT4 overexpression both disrupt initial targeting, but only BDNF causes innervation to be withdrawn after E18.5

We compared the development of peripheral chorda tympani axons in wild-type mice and mice overexpressing either BDNF or NT4 in the lingual epithelium. We have previously reported that overexpression of either BDNF or NT4 resulted in a loss of approximately 60% of the fungiform papillae by adulthood, even though the number of geniculate neurons was dramatically increased (Krimm et al., 2001). In that study, we showed that fungiform papillae were lost because chorda tympani innervation patterns were altered by E18.5, preventing innervation of the fungiform papillae. However, it was not clear whether initial targeting was disrupted or whether gustatory innervation was withdrawn following initial innervation in mice overexpressing neurotrophins. Here, we demonstrate that overexpression of either BDNF or NT4 disrupts initial targeting such that most gustatory neurons never successfully innervate fungiform papillae. Thus, neurotrophins could regulate gustatory neuron targeting during development.

BDNF is normally expressed in fungiform papillae but not in adjacent epithelium during development (Nosrat and Olson, 1995; Nosrat et al., 1996). BDNF may normally function as a chemoattractant allowing gustatory neurons to distinguish between gustatory and non-gustatory epithelium. Non-gustatory regions that do not normally express BDNF do express BDNF in BDNF-OE mice disrupting normal targeting. BDNF overexpression could therefore prevent initial targeting by attracting gustatory fibers to non-gustatory regions of the tongue. However, BDNF overexpression also disrupts the stereotyped branching pattern that is typical of the chorda tympani nerve. The normal branching pattern may be important for the successful targeting of fungiform papillae during development. It is also possible that BDNF overexpression disrupts chorda tympani fiber targeting by interfering with the internal signaling pathway for a different chemoattractant (Ming et al., 1999). This might occur if BDNF does not normally function as a chemoattractant during taste system development but shares components of an internal signaling pathway with another factor that does.

While NT4 expression has not been observed in the lingual epithelium (Nosrat et al., 1996), NT4 binds to the same receptors as BDNF and could mimic BDNF’s function. However, our results do not support this possibility. Overexpressed NT4 was not chemoattractive, but rather appeared to repel fibers from the lingual epithelium. Gustatory axons failed to innervate fungiform papillae in NT4-OE mice because the basic morphological development of this nerve was completely disrupted, and most gustatory fibers remained well below the lingual epithelium.

While the full effect of NT4 overexpression was evident by E14.5, the effects of BDNF overexpression continued to progress in severity following initial innervation. Even by E18.5, more fungiform papillae were innervated than would ultimately remain in adulthood. It is possible that altered local interactions between BDNF and its receptor, TrkB, result in the loss of some fungiform papillae even though they remained innervated. TrkB is expressed by taste buds (Ganchrow et al., 2003; Yee et al., 2005) as well as neurons; however, there is no evidence that activation of TrkB in taste cells results in the degeneration of the taste bud, making this scenario unlikely. It is also possible that these fungiform papillae continue to lose innervation after E18.5; and it is well established that postnatal loss of chorda tympani innervation causes a loss of fungiform papillae (Nagato et al., 1995; Sollars, 2005; Sollars and Bernstein, 2000; Sollars et al., 2002). Thus, while NT4 overexpression in non-gustatory areas disrupts initial targeting, BDNF overexpression interferes with both initial targeting and the maintenance of innervation at the correct locations. Once taste buds develop, BDNF is limited to cells within the taste bud that form synapses (Yee et al., 2003). Since taste cells turn over and constantly reform neural connections, it is possible that the normal pattern of BDNF is required for synapses to form on the correct taste cells even after initial target innervation. Ectopic BDNF overexpression may disrupt this process, resulting in fiber withdrawal and subsequent papilla degeneration after initial innervation is established.

Trigeminal innervation is not severely disrupted in either BDNF-OE or NT4-OE mice

We examined total sensory innervation on the day of birth to determine if trigeminal innervation to the tongue was also disrupted in BDNF- and NT4-OE mice. There were fewer specific sites of innervation, where fungiform papillae are located, in BDNF-OE and NT4-OE mice than in wild-types. While these decreases were consistent, they were also comparatively minor. BDNF-OE mice only lose trigeminal innervation to 18% of fungiform papillae but lose chorda tympani innervation to 52% of the fungiform papillae. Similarly, NT4-OE mice only lose trigeminal innervation to 23% of fungiform papillae but lose chorda tympani innervation to 82% of the fungiform papillae. Furthermore, it is not clear whether the loss of trigeminal innervation to fungiform papillae is a direct or indirect effect of BDNF and NT4 overexpression. That is, the lack of trigeminal innervation to fungiform papillae by the day of birth could be due to the loss of fungiform papillae, which is due in turn to a lack of chorda tympani innervation. Chorda tympani innervation pioneers trigeminal innervation to the tongue and is capable of attracting trigeminal innervation (Farbman and Mbiene, 1991; Rochlin and Farbman, 1998). However, if trigeminal fibers use chorda tympani fibers as their primary method of navigating the tongue, then trigeminal innervation should be as disrupted as chorda tympani innervation. Our results suggest that trigeminal pathfinding to the papillae is largely independent of geniculate axons.

BDNF and NT4 overexpression have distinct influences on gustatory neuron morphologies that occur at different ages

Both BDNF and NT4 overexpression influence the morphology of chorda tympani axons during development; however, overexpression of each factor produces a distinctive and opposite chorda tympani branching pattern. NT4 overexpression increases fiber fasciculation and inhibits branching. The reduction in branches may be due to the failure of the nerves to defasciculate in NT4-OE mice. Most gustatory fibers in NT4-OE mice remain below the surface of the tongue as if repelled by the epithelium and fail to innervate either gustatory or non-gustatory epithelium. In contrast, BDNF overexpression increases fiber branching near the surface of the tongue; but the branching is disorganized: most branches fail to innervate fungiform papillae, and some innervate non-gustatory filiform papillae.

Our findings that BDNF and NT4 influence gustatory neuron morphology in different ways are not without precedence in other systems (Bibel and Barde, 2000). NT3 promotes branching in developing DRG neurons, and nerve growth factor (NGF) promotes axon elongation in these cells (Lentz et al., 1999). The differential effects of BDNF and NT4 on the development of neuronal morphology have been described in several CNS sensory neuron populations. For example, BDNF promotes the branching and complexity of the terminal axonal arbors of retinal ganglion neurons, while NT4 has little effect on the morphological development of retinal neurons (Cohen-Cory and Fraser, 1995). In cortical neurons, NT4 increases the length and complexity of basal dendrites of layer 5 and 6 cells, while BDNF influences the length and complexity of dendrites of neurons situated in layer 4 (McAllister et al., 1995). While all of these studies concur that different neurotrophins can differentially influence morphological development, in most the distinction between the effects was not as dramatic as that described in this study.

In addition to having different effects on gustatory neuronal morphology, BDNF and NT4 overexpression each affected chorda tympani morphologies over different developmental time courses. NT4 overexpression influenced the development of chorda tympani morphology by E12.5, but BDNF overexpression did not influence chorda tympani development until E14.5, even though transgene expression in BDNF-OE mice began by E12.5. In vitro, both neurotrophins regulate neurite outgrowth by E12 in the rat (Rochlin et al., 2000). Since the equivalent age in a mouse is even earlier, geniculate neurons should be capable of responding to either BDNF or NT4 overexpression by E12.5. It is possible that even though BDNF is expressed by E12.5, it is present in sub-threshold quantities in tongues of BDNF-OE mice. Alternatively, BDNF may normally play different roles at different stages during development. Geniculate neurons may be responding to BDNF with increased geniculate neuron survival by E12.5, but BDNF may not influence morphological development or targeting until later stages. Consistent with this explanation, the initial outgrowth of chorda tympani axons does not require BDNF (O’Connor and Tessier-Lavigne, 1999). The effects of BDNF overexpression were seen after the effects of NT4, and they continued to progress from E14.5 to E18.5 and adulthood, after the effects of NT4 overexpression had become stable. These findings indicate that compensation for these effects does not occur during development.

The observed differences in axon morphology between BDNF-OE and NT4-OE mice could be either qualitative or quantitative. There is an earlier and more severe effect on innervation in NT4-OE mice than in BDNF-OE mice, which could be due to greater neurotrophin expression in NT4-OE mice. However, ELISA measurements of neurotrophin levels in the dorsal skin of the back revealed a 4.3-fold increase in BDNF in BDNF-OE mice (LeMaster et al., 1999), whereas NT4 levels are increased by 2.3-fold in NT4-OE mice (Krimm et al., in press). This finding that BDNF-OE mice are more robust neurotrophin overexpressors than NT4-OE mice does not support a quantitative explanation for the differences in axon morphology between BDNF-OE and NT4-OE mice; however, ELISA measurements in the tongue may differ from those of the back skin. A more compelling argument for a qualitative rather than a quantitative explanation for our in vivo observations comes from earlier in vitro studies, in which NT4-stimulated neuronal outgrowth from geniculate ganglion explants was much more fasciculated than BDNF-stimulated outgrowth (Rochlin et al., 2000; Vilbig et al., 2004) regardless of concentration. While the morphological differences do not appear to be quantitative, it is possible that gustatory axon morphologies are influenced earlier in NT4-OE mice than BDNF-OE mice, because NT4 overexpression is more robust than BDNF overexpression at E12.5.

It is likely that geniculate neurons are more sensitive to NT4 than to BDNF. Replacing the BDNF coding sequence with that of NT4 results in increased neuronal survival (Fan et al., 2000). Likewise, when BDNF and NT4 are co-applied in vitro at the same concentration, outgrowth of geniculate axons is identical to NT4-stimulated, rather than to BDNF-stimulated, outgrowth (Vilbig et al., 2004). That is, NT4 can completely block the effects of BDNF when the two neurotrophins are applied together. Therefore, it is possible that one of the effects of NT4 overexpression may be to block normal BDNF function.

Differential signaling could mediate differences in gustatory neuron responses to BDNF and NT4 overexpression

BDNF and NT4 both function via two types of receptors, the tyrosine kinase receptor TrkB and the panneurotrophin receptor, p75. Geniculate neurons are known to express both of these receptors in addition to TrkA and TrkC (Cho and Farbman, 1999; Farbman et al., 2004a, b; Matsumoto et al., 2001). How BDNF and NT4 regulate distinct morphologies via the same receptors is unclear. However, given the multiple neurotrophin receptor forms and the numerous effects that neurotrophins are capable of eliciting (Huang and Reichardt, 2001; Kovalchuk et al., 2004; Lee et al., 2001; Yamada and Nabeshima, 2004), it is clear that they act through numerous and varied signaling strategies. Among many other possibilities, binding of BDNF to TrkB may result in receptor configurations different from those induced by NT4 binding, which may lead to differential intra-cellular signaling activation. Consistent with this possibility, a point mutation in the Shc adapter binding site of TrkB resulted in greater losses in NT4-dependent neurons than in BDNF-dependent neurons during development (Minichiello et al., 1998). Thus, NT4 signaling may be more dependent on Shc binding than BDNF signaling, which is known to require a combination of binding sites (Medina et al., 2004; Minichiello et al., 2002).

The mammalian trkB locus undergoes alternative splicing to produce two different types of receptors: a full-length receptor and a receptor that lacks a tyrosine kinase signaling domain (truncated TrkB). It is unclear whether truncated TrkB receptors function as dominant-negative receptors to sequester neurotrophins or by direct activation of a signaling cascade (Baxter et al., 1997; Luikart et al., 2003). However, full-length TrkB and truncated TrkB are capable of differentially regulating the dendritic morphologies of cortical neurons (Yacoubian and Lo, 2000). Truncated TrkB isoforms are expressed frequently in geniculate ganglion neurons, (Farbman et al., 2004a, b) and not always in the same neurons that express the full-length receptor. It is possible that the two TrkB receptors may also regulate gustatory fiber morphologies. In addition to binding TrkB, both BDNF and NT4 bind to a panneurotrophin receptor known as p75. The p75 receptor interacts with Trk receptors to modify their affinity and specificity (Huang and Reichardt, 2003), and it binds the proforms of neurotrophins with a greater affinity than Trk receptors (Lee et al., 2001). In addition, the p75 receptor interacts with the actin cytoskeleton to modify axonal growth and branching, effects that are regulated by neurotrophins (Gallo and Letourneau, 2004; Gehler et al., 2004; Yamashita et al., 1999). Thus, the p75 receptor may be important for the differential effects of BDNF and NT4 on gustatory axonal morphologies.

Differential BDNF and NT4 signaling could also influence the responses of geniculate neurons to other guidance factors. For example, NT4, but not BDNF, can enhance the responses of geniculate neurons to Sema3A and Sema3F (Vilbig et al., 2004). Sema3A is a chemorepellent expressed by the lingual epithelium, that prevents premature innervation of the lingual epithelium by gustatory neurons (Dillon et al., 2004). In NT4-OE mice, most chorda tympani fibers remained below the surface as if repelled by the lingual epithelium. This finding could be explained, at least in part, by NT4-mediated enhancement of geniculate fibers’ responses to Sema3A. NGF reduces the sensitivity of somatosensory neurons to Sema3A (Dillon et al., 2004; Dontchev and Letourneau, 2002). Similarly, it is possible that BDNF could reduce the sensitivity of geniculate neurons to Sema3A inhibition, although it has not been shown to inhibit responses to Sema3A in culture (Vilbig et al., 2004), and, unlike in Sema3A knockout mice (Dillon et al., 2004), chorda tympani fibers did not prematurely contact the epithelium in BDNF-OE mice at E13.5.

In conclusion, overexpression of either BDNF or NT4 disrupts the initial innervation of fungiform papillae during development, and alters the normal morphology of gustatory neurons. NT4 overexpression throughout the basal epithelium increases fasciculation and decreases branching, while the same pattern of BDNF overexpression increases branching and results in innervation of inappropriate regions of the taste epithelium. Perhaps, the vastly different morphologies produced by BDNF and NT4 when overexpressed reflect these neurotrophins’ roles in regulating chorda tympani axon morphologies and targeting during normal gustatory development. For example, NT4 may play an integral role in keeping fibers fasciculated along the initial projection pathway, thereby preventing cell death as fibers grow toward the tongue or palate. BDNF may encourage branching as chorda tympani fibers approach their peripheral targets and may serve as a chemoattractant allowing gustatory fibers to distinguish taste epithelium from non-taste regions. The differential effects of BDNF and NT4 overexpression on both the timing and the morphology of chorda tympani projections that we have described here are consistent with these possibilities.

Supplementary Material

Supplementary Figure Legend

Supplementary Figure

Acknowledgments

We would like to thank Dr. Kathryn Albers for providing us with the BDNF-OE and NT4-OE transgenic mouse lines. We would like to thank Beverly Giammara for her SEM assistance. This work was supported by NIH Grants DC04763 and DC05252 to RFK.

Appendix A. Supplementary data

Supplementary data associated with this article can be found in the online version at 10.1016/j.ydbio.2006.01.021

References

  • Baxter GT, Radeke MJ, Kuo RC, Makrides V, Hinkle B, Hoang R, Medina-Selby A, Coit D, Valenzuela P, Feinstein SC. Signal transduction mediated by the truncated trkB receptor isoforms, trkB.T1 and trkB.T2. J Neurosci. 1997;17:2683–2690. [PubMed]
  • Bibel M, Barde YA. Neurotrophins: key regulators of cell fate and cell shape in the vertebrate nervous system. Genes Dev. 2000;14:2919–2937. [PubMed]
  • Cho TT, Farbman AI. Neurotrophin receptors in the geniculate ganglion. Brain Res Mol Brain Res. 1999;68:1–13. [PubMed]
  • Cohen-Cory S, Fraser SE. Effects of brain-derived neurotrophic factor on optic axon branching and remodelling in vivo. Nature. 1995;378:192–196. [PubMed]
  • Conover JC, Erickson JT, Katz DM, Bianchi LM, Poueymirou WT, McClain J, Pan L, Helgren M, Ip NY, Boland P, et al. Neuronal deficits, not involving motor neurons, in mice lacking BDNF and/or NT4. Nature. 1995;375:235–238. [PubMed]
  • Dillon TE, Saldanha J, Giger R, Verhaagen J, Rochlin MW. Sema3A regulates the timing of target contact by cranial sensory axons. J Comp Neurol. 2004;470:13–24. [PubMed]
  • Dontchev VD, Letourneau PC. Nerve growth factor and semaphorin 3A signaling pathways interact in regulating sensory neuronal growth cone motility. J Neurosci. 2002;22:6659–6669. [PubMed]
  • Fan G, Egles C, Sun Y, Minichiello L, Renger JJ, Klein R, Liu G, Jaenisch R. Knocking the NT4 gene into the BDNF locus rescues BDNF deficient mice and reveals distinct NT4 and BDNF activities. Nat Neurosci. 2000;3:350–357. [PubMed]
  • Farbman AI, Mbiene JP. Early development and innervation of taste bud-bearing papillae on the rat tongue. J Comp Neurol. 1991;304:172–186. [PubMed]
  • Farbman AI, Brann JH, Rozenblat A, Rochlin MW, Weiler E, Bhattacharyya M. Developmental expression of neurotrophin receptor genes in rat geniculate ganglion neurons. J Neurocytol. 2004a;33:331–343. [PubMed]
  • Farbman AI, Guagliardo N, Sollars SI, Hill DL. Each sensory nerve arising from the geniculate ganglion expresses a unique fingerprint of neurotrophin and neurotrophin receptor genes. J Neurosci Res. 2004b;78:659–667. [PMC free article] [PubMed]
  • Figueiredo HF, Davis BM, Albers KM. Skin-derived nerve growth factor blocks programmed cell death in the trigeminal ganglia but does not enhance neuron proliferation. Mech Dev. 2001;109:205–214. [PubMed]
  • Gallo G, Letourneau PC. Regulation of growth cone actin filaments by guidance cues. J Neurobiol. 2004;58:92–102. [PubMed]
  • Ganchrow D, Ganchrow JR, Verdin-Alcazar M, Whitehead MC. Brain-derived neurotrophic factor-, neurotrophin-3-, and tyrosine kinase receptor-like immunoreactivity in lingual taste bud fields of mature hamster. J Comp Neurol. 2003;455:11–24. [PubMed]
  • Gehler S, Gallo G, Veien E, Letourneau PC. p75 neurotrophin receptor signaling regulates growth cone filopodial dynamics through modulating RhoA activity. J Neurosci. 2004;24:4363–4372. [PubMed]
  • Giger RJ, Wolfer DP, De Wit GM, Verhaagen J. Anatomy of rat semaphorin III/collapsin-1 mRNA expression and relationship to developing nerve tracts during neuroembryogenesis. J Comp Neurol. 1996;375:378–392. [PubMed]
  • Gross JB, Gottlieb AA, Barlow LA. Gustatory neurons derived from epibranchial placodes are attracted to, and trophically supported by, taste bud-bearing endoderm in vitro. Dev Biol. 2003;264:467–481. [PubMed]
  • Guirland C, Suzuki S, Kojima M, Lu B, Zheng JQ. Lipid rafts mediate chemotropic guidance of nerve growth cones. Neuron. 2004;42:51–62. [PubMed]
  • Hall JM, Hooper JE, Finger TE. Expression of sonic hedgehog, patched, and Gli1 in developing taste papillae of the mouse. J Comp Neurol. 1999;406:143–155. [PubMed]
  • Huang EJ, Reichardt LF. Neurotrophins: roles in neuronal development and function. Annu Rev Neurosci. 2001;24:677–736. [PMC free article] [PubMed]
  • Huang EJ, Reichardt LF. TRK receptors: roles in neuronal signal transduction. Annu Rev Biochem 2003 [PubMed]
  • Kaufman MH. The Atlas of Mouse Development. Academic Press; London: 1995.
  • Kovalchuk Y, Holthoff K, Konnerth A. Neurotrophin action on a rapid timescale. Curr Opin Neurobiol. 2004;14:558–563. [PubMed]
  • Krimm RF, Hill DL. Innervation of single fungiform taste buds during development in rat. J Comp Neurol. 1998;398:13–24. [PubMed]
  • Krimm RF, Hill DL. Neuron/target matching between chorda tympani neurons and taste buds during postnatal rat development. J Neurobiol. 2000;43:98–106. [PubMed]
  • Krimm RF, Miller KK, Kitzman PH, Davis BM, Albers KM. Epithelial overexpression of BDNF or NT4 disrupts targeting of taste neurons that innervate the anterior tongue. Dev Biol. 2001;232:508–521. [PubMed]
  • Krimm RF, Davis BM, Noel T, Albers KM. Overexpression of NT4 in skin enhances myelinated sensory endings but does not influence sensory neuron number. J Comp Neurol in press. [PMC free article] [PubMed]
  • Lee R, Kermani P, Teng KK, Hempstead BL. Regulation of cell survival by secreted proneurotrophins. Science. 2001;294:1945–1948. [PubMed]
  • LeMaster AM, Krimm RF, Davis BM, Noel T, Forbes ME, Johnson JE, Albers KM. Overexpression of brain-derived neurotrophic factor enhances sensory innervation and selectively increases neuron number. J Neurosci. 1999;19:5919–5931. [PubMed]
  • Lendahl U, Zimmerman LB, McKay RD. CNS stem cells express a new class of intermediate filament protein. Cell. 1990;60:585–595. [PubMed]
  • Lentz SI, Knudson CM, Korsmeyer SJ, Snider WD. Neurotrophins support the development of diverse sensory axon morphologies. J Neurosci. 1999;19:1038–1048. [PubMed]
  • Li Y, Jia YC, Cui K, Li N, Zheng ZY, Wang YZ, Yuan XB. Essential role of TRPC channels in the guidance of nerve growth cones by brain-derived neurotrophic factor. Nature. 2005;434:894–898. [PubMed]
  • Liebl DJ, Mbiene JP, Parada LF. NT4/5 mutant mice have deficiency in gustatory papillae and taste bud formation. Dev Biol. 1999;213:378–389. [PubMed]
  • Liu X, Ernfors P, Wu H, Jaenisch R. Sensory but not motor neuron deficits in mice lacking NT4 and BDNF. Nature. 1995;375:238–241. [PubMed]
  • Lom B, Cogen J, Sanchez AL, Vu T, Cohen-Cory S. Local and target-derived brain-derived neurotrophic factor exert opposing effects on the dendritic arborization of retinal ganglion cells in vivo. J Neurosci. 2002;22:7639–7649. [PubMed]
  • Luikart BW, Nef S, Shipman T, Parada LF. In vivo role of truncated trkb receptors during sensory ganglion neurogenesis. Neuroscience. 2003;117:847–858. [PubMed]
  • Matsumoto I, Emori Y, Ninomiya Y, Abe K. A comparative study of three cranial sensory ganglia projecting into the oral cavity: in situ hybridization analyses of neurotrophin receptors and thermosensitive cation channels. Brain Res Mol Brain Res. 2001;93:105–112. [PubMed]
  • Mbiene JP, Mistretta CM. Initial innervation of embryonic rat tongue and developing taste papillae: nerves follow distinctive and spatially restricted pathways. Acta Anat (Basel) 1997;160:139–158. [PubMed]
  • Mbiene JP, Roberts JD. Distribution of keratin 8-containing cell clusters in mouse embryonic tongue: evidence for a prepattern for taste bud development. J Comp Neurol. 2003;457:111–122. [PubMed]
  • McAllister AK, Lo DC, Katz LC. Neurotrophins regulate dendritic growth in developing visual cortex. Neuron. 1995;15:791–803. [PubMed]
  • Medina DL, Sciarretta C, Calella AM, Von Bohlen Und Halbach O, Unsicker K, Minichiello L. TrkB regulates neocortex formation through the Shc/PLCgamma-mediated control of neuronal migration. EMBO J. 2004;23:3803–3814. [PMC free article] [PubMed]
  • Miller IJ, Jr, Preslar AJ. Spatial distribution of rat fungiform papillae. Anat Rec. 1975;181:679–684. [PubMed]
  • Ming G, Lohof AM, Zheng JQ. Acute morphogenic and chemotropic effects of neurotrophins on cultured embryonic Xenopus spinal neurons. J Neurosci. 1997;17:7860–7871. [PubMed]
  • Ming G, Song H, Berninger B, Inagaki N, Tessier-Lavigne M, Poo M. Phospholipase C-gamma and phosphoinositide 3-kinase mediate cytoplasmic signaling in nerve growth cone guidance. Neuron. 1999;23:139–148. [PubMed]
  • Minichiello L, Casagranda F, Tatche RS, Stucky CL, Postigo A, Lewin GR, Davies AM, Klein R. Point mutation in trkB causes loss of NT4-dependent neurons without major effects on diverse BDNF responses. Neuron. 1998;21:335–345. [PubMed]
  • Minichiello L, Calella AM, Medina DL, Bonhoeffer T, Klein R, Korte M. Mechanism of TrkB-mediated hippocampal long-term potentiation. Neuron. 2002;36:121–137. [PubMed]
  • Mistretta CM. Topographical and histological study of the developing rat tongue, palate and taste buds. In: Bosma JF, editor. Third Symposium on Oral Sensation and Perception: The Mouth of the Infant. Charles C. Thomas; Springfield, IL: 1972. pp. 163–187.
  • Mistretta CM, Goosens KA, Farinas I, Reichardt LF. Alterations in size, number, and morphology of gustatory papillae and taste buds in BDNF null mutant mice demonstrate neural dependence of developing taste organs. J Comp Neurol. 1999;409:13–24. [PMC free article] [PubMed]
  • Nagato T, Matsumoto K, Tanioka H, Kodama J, Toh H. Effect of denervation on morphogenesis of the rat fungiform papilla. Acta Anat (Basel) 1995;153:301–309. [PubMed]
  • Nosrat CA, Olson L. Brain-derived neurotrophic factor mRNA is expressed in the developing taste bud-bearing tongue papillae of rat. J Comp Neurol. 1995;360:698–704. [PubMed]
  • Nosrat CA, Olson L. Changes in neurotrophin-3 messenger RNA expression patterns in the prenatal rat tongue suggest guidance of developing somatosensory nerves to their final targets. Cell Tissue Res. 1998;292:619–623. [PubMed]
  • Nosrat CA, Ebendal T, Olson L. Differential expression of brain-derived neurotrophic factor and neurotrophin 3 mRNA in lingual papillae and taste buds indicates roles in gustatory and somatosensory innervation. J Comp Neurol. 1996;376:587–602. [PubMed]
  • Nosrat CA, Blomlof J, ElShamy WM, Ernfors P, Olson L. Lingual deficits in BDNF and NT3 mutant mice leading to gustatory and soma-tosensory disturbances, respectively. Development. 1997;124:1333–1342. [PubMed]
  • Nosrat CA, MacCallum DK, Mistretta CM. Distinctive spatiotemporal expression patterns for neurotrophins develop in gustatory papillae and lingual tissues in embryonic tongue organ cultures. Cell Tissue Res. 2001;303:35–45. [PubMed]
  • Oakley B, Brandemihl A, Cooper D, Lau D, Lawton A, Zhang C. The morphogenesis of mouse vallate gustatory epithelium and taste buds requires BDNF-dependent taste neurons. Brain Res Dev Brain Res. 1998;105:85–96. [PubMed]
  • O’Connor R, Tessier-Lavigne M. Identification of maxillary factor, a maxillary process-derived chemoattractant for developing trigeminal sensory axons. Neuron. 1999;24:165–178. [PubMed]
  • Paves H, Saarma M. Neurotrophins as in vitro growth cone guidance molecules for embryonic sensory neurons. Cell Tissue Res. 1997;290:285–297. [PubMed]
  • Ringstedt T, Ibanez CF, Nosrat CA. Role of brain-derived neurotrophic factor in target invasion in the gustatory system. J Neurosci. 1999;19:3507–3518. [PubMed]
  • Rochlin MW, Farbman AI. Trigeminal ganglion axons are repelled by their presumptive targets. J Neurosci. 1998;18:6840–6852. [PubMed]
  • Rochlin MW, O’Connor R, Giger RJ, Verhaagen J, Farbman AI. Comparison of neurotrophin and repellent sensitivities of early embryonic geniculate and trigeminal axons. J Comp Neurol. 2000;422:579–593. [PubMed]
  • Sollars SI. Chorda tympani nerve transection at different developmental ages produces differential effects on taste bud volume and papillae morphology in the rat. J Neurobiol. 2005;64:310–320. [PubMed]
  • Sollars SI, Bernstein IL. Neonatal chorda tympani transection permanently disrupts fungiform taste bud and papilla structure in the rat. Physiol Behav. 2000;69:439–444. [PubMed]
  • Sollars SI, Smith PC, Hill DL. Time course of morphological alterations of fungiform papillae and taste buds following chorda tympani transection in neonatal rats. J Neurobiol. 2002;51:223–236. [PubMed]
  • Sun H, Oakley B. Development of anterior gustatory epithelia in the palate and tongue requires epidermal growth factor receptor. Dev Biol. 2002;242:31–43. [PubMed]
  • Tucker KL, Meyer M, Barde YA. Neurotrophins are required for nerve growth during development. Nat Neurosci. 2001;4:29–37. [PubMed]
  • Vilbig R, Cosmano J, Giger R, Rochlin MW. Distinct roles for Sema3A, Sema3F, and an unidentified trophic factor in controlling the advance of geniculate axons to gustatory lingual epithelium. J Neurocytol. 2004;33:591–606. [PubMed]
  • Yacoubian TA, Lo DC. Truncated and full-length TrkB receptors regulate distinct modes of dendritic growth. Nat Neurosci. 2000;3:342–349. [PubMed]
  • Yamada K, Nabeshima T. Interaction of BDNF/TrkB signaling with NMDA receptor in learning and memory. Drug News Perspect. 2004;17:435–438. [PubMed]
  • Yamashita T, Tucker KL, Barde YA. Neurotrophin binding to the p75 receptor modulates Rho activity and axonal outgrowth. Neuron. 1999;24:585–593. [PubMed]
  • Yee CL, Jones KR, Finger TE. Brain-derived neurotrophic factor is present in adult mouse taste cells with synapses. J Comp Neurol. 2003;459:15–24. [PubMed]
  • Yee C, Bartel DL, Finger TE. Effects of glossopharyngeal nerve section on the expression of neurotrophins and their receptors in lingual taste buds of adult mice. J Comp Neurol. 2005;490:371–390. [PubMed]
  • Zhang C, Brandemihl A, Lau D, Lawton A, Oakley B. BDNF is required for the normal development of taste neurons in vivo. NeuroReport. 1997;8:1013–1017. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...