• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Exp Mol Pathol. Author manuscript; available in PMC Apr 1, 2008.
Published in final edited form as:
PMCID: PMC1934615
NIHMSID: NIHMS21714

Mapping of an Origin of DNA Replication in the Promoter of Fragile X Gene FMR1

Abstract

An origin of bidirectional DNA replication was mapped to the promoter of the FMR1 gene in human chromosome Xq27.3, which has been linked to the fragile X syndrome. This origin is adjacent to a CpG island and overlaps the site of expansion of the triplet repeat (CGG) at the fragile X instability site, FRAXA. The promoter region of FMR2 in the FRAXE site (approximately 600 kb away, in chromosome band Xq28) also includes an origin of replication, as previously described. FMR1 transcripts were detected in foreskin and male fetal lung fibroblasts, while FMR2 transcripts were not. However, both FMR1 and FMR2 were found to replicate late in S phase (approximately six hours into the S phase of normal human fibroblasts). The position of the origin of replication relative to the CGG repeat, and perhaps the late replication of these genes, might be important factors in the susceptibility to triplet repeat amplification at the FRAXA and FRAXE sites.

Keywords: Replication timing, nascent strand abundance, gene transcription, trinucleotide repeats, human fibroblasts

INTRODUCTION

Fragile X syndrome is an X-linked disorder that manifests most typically in males. Disease severity in symptomatic females seems to depend on the fraction of cells in which the X chromosome carrying the mutated FRAXA site remains active (Abrams et al., 1994; Rousseau et al., 1991). Pathophysiological conditions associated with the syndrome include mental retardation, autism or autistic-like behaviors, delays in speech and language development, postpubescent macroorchidism, long and prominent ears and jaws, high-pitched speech, hyperactivity, poor eye contact, and stereotypic hand movements, such as hand flapping and hand biting (Cummings and Zoghbi, 2000; Farzin et al., 2006; Garcia-Nonell et al., 2006; Hatton et al., 2006; Hou et al., 2006). Fragile X syndrome is the most common genetic disorder associated with mental retardation or autism in males, with an estimated prevalence of 1 in 4000 to 1 in 6000 males. Additional physiological conditions have been associated with or related to FRAXA, including tremor ataxia syndrome (Ennis et al., 2006; Greco et al., 2006; Iwahashi et al., 2006; Jacquemont et al., 2006) and premature ovarian failure (Fassnacht et al., 2006; Meskhi and Seif, 2006; Woad et al., 2006). As its name implies, FRAXA was originally identified through its association with a folate-sensitive fragile site at Xq27.3 in a fraction of affected patients. Sequence analysis of cosmids and cDNAs mapping to this fragile site revealed a polymorphic (CGG)n repeat in the 5′ untranslated region of the FMR1 gene at Xq27.3, which is known as the FRAXA site (Verkerk et al., 1991). Triplet repeat amplification in excess of 200 copies (full mutation) leads to hypermethylation of the FMR1 promoter region and gene silencing, hence a loss-of-function effect in affected males (Terracciano et al., 2005). In the pre-mutation stage, amplifications ranging from approximately 60 to 200 repeats, are associated with increased transcription of the mutant FMR1 gene (Tassone et al., 2000). It appears, therefore, that the onset of disease is related to the length of the trinucleotide repeat. Interestingly, an intermediate length of the repeat (i.e., pre-mutation) makes the carrier susceptible to further expansion of the repeat region.

The cause of expansion of triplet repeats is not known, but this expansion is likely to occur during DNA replication in proliferating cells (Cleary and Pearson, 2005). Because of the antiparallel structure of double-stranded DNA and because DNA polymerases can only add nucleotides at the 3′ end of the growing strand, the two daughter strands are replicated by different mechanisms during semiconservative DNA replication. The leading strand is elongated in the same direction of the movement of the replication fork from an origin to a termination site; the lagging strand must be synthesized discontinuously, with new fragments initiated at Okazaki fragment Initiation Zones (OIZ) located approximately 150 - 300 nt apart (Cleary and Pearson, 2005; Pearson et al., 2005). CGG and CTG triplet repeats have been shown in vitro to slow or even stop DNA polymerases because of the formation of stable hairpins on template DNA (McMurray, 1999) and it has been reported that the extent of inhibition of fork progression due to this effect increases with the length of the repeat (Kang et al., 1995). The expansion of triplet repeats has been thought to be closely linked to the ability of these sequences to form alternative DNA structures, a degree of flexibility higher than non-repetitive DNA, and the difficulty that DNA polymerases encounter in progressing through repetitive DNA regions (Chastain et al., 1995; Chastain and Sinden, 1998; Pearson et al., 1998; Pearson and Sinden, 1996; Pearson and Sinden, 1998; Pearson et al., 1998; Sinden, 1999). If the newly synthesized DNA strand in these repeat regions forms unusual structures (such as hairpins), mispriming followed by elongation may lead to the expansion of the repeat tract. It has been reported that the CGG repeats on lagging strand DNA are more likely to form stable secondary structures (e.g. hairpins) that may facilitate amplification (Siyanova and Mirkin, 2001). Therefore, the location of the origin of replication with respect to the triplet repeat may determine the probability that expansion during DNA replication will occur in one of the daughter cells.

We reported previously the presence of an origin of replication in the transcriptional promoter of the FMR2 gene (FRAXE), also implicated in fragile X syndrome, located on chromosome Xq28, approximately 600 kb telomere-wise from the FRAXA site (Chastain et al., 2006). In this report, we present the identification of the origin of bidirectional replication associated with the FMR1 gene, the determination of its time of replication, and the expression status of both FMR1 and FMR2 genes in normal human male skin and lung fibroblasts.

METHODS

Cell cultures

The human cells used in these studies were NHF1-hTERT, a cell line derived from normal neonatal foreskin fibroblasts (Boyer et al., 1991) and immortalized by ectopic expression of the catalytic subunit of telomerase (Heffernan et al., 2002); GM1604-hTERT, a male fetal lung fibroblast cell line also immortalized by telomerase expression (Ouellette et al., 2000); and CRL-1502 cells (ATCC), a strain of female fetal lung fibroblasts. The hTERT-immortalized cell lines were grown in minimal essential medium (Invitrogen, Carlsbad, CA) containing 2X the concentration of MEM non-essential amino acids (Invitrogen). The CRL-1502 cells were cultured according to ATCC recommended conditions. Growth media were further supplemented with 2 mM L-glutamine (Invitrogen) and 10% fetal bovine serum (Sigma Chemical Co., St. Louis, MO).

Cell synchronization and determination of replication timing

The protocol used to synchronize cultured human fibroblasts was described previously (Cordeiro-Stone et al., 1986). Cells arrested at confluence were replated at lower densities in medium containing 2 μg/ml of the DNA polymerase inhibitor aphidicolin, and incubated for 24 h (Brylawski et al., 2000; Tribioli et al., 1987). Once cells were released from the aphidicolin inhibition, they resumed DNA synthesis at a normal rate and transited through the S phase as a parasynchronous cohort. DNA synthesized in different 1-h windows of the S phase was isolated by CsCl gradient centrifugation (Cordeiro-Stone et al., 1990). Samples containing equal amounts of DNA were used for testing the timing of replication of the FMR1 region by PCR, as described previously for the region of human chromosome X containing the FMR2 gene (Chastain et al., 2006). DNA samples from two synchronization experiments were tested twice, each time using duplicate PCR reactions. PCR reactions were conducted under non-saturating conditions as determined by a standard curve generated with genomic DNA sheared to the same size as the test DNA (Cohen et al., 2002). Only when the correlation coefficient for the standard curve was equal to or greater than 0.9 were the PCR results taken into consideration.

Preparation of nascent DNA and mapping of the replication origin

Single-stranded nascent DNA ranging in size from ~400-1000 nt in length was prepared from logarithmically growing cells as described previously (Cohen et al., 2002). Quantitative PCR was used to determine the relative copy number of selected genetic markers (Table I) from the FMR1 gene region. A standard curve using sonicated genomic DNA (~ 1500 bp) was amplified together with the nascent DNA sample for each primer set, so that differences in amplification efficiency would not affect the determination of relative abundance. Each preparation of short nascent DNA was also tested by measuring the relative abundance of sequences at the lamin B2 origin using previously described L5 (Cohen et al., 2002) and B13 (Giacca et al., 1994) primers.

Table 1
Primer sets used for nascent strand abundance and replication timing analyses.

PCR

Primer3 (frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and the Prime program in the Wisconsin Package (Genetics Computer Group, Madison, WI, version 8) were used to design PCR primers for the amplification of DNA sequences within a length of DNA from nt 146697178 to nt 146701532 of chromosome band Xq27.3 as reported in Build 35 of human genomic sequences available at the UCSC Genome Bioinformatics site (www.genome.ucsc.edu). The primers are listed in Table 1 with their location, the size of the PCR product, and the annealing temperature used in the PCR reaction. PCR was performed in OmnE and PCR-Express thermocyclers (Thermo Electron Corp., Milford, MA) using Thermo-Start Taq DNA polymerase (ABgene, Rochester, NY). PCR reaction conditions were: 95°C for 15 min (once, for the activation of the polymerase), followed by 30-38 cycles of 94°C for 30 sec, annealing temperature (Table 1) for 30 sec, and elongation at 72°C for 30 sec. Some primer sets (marked with asterisks in Table 1) required a two-step PCR program: 95°C for 15 min, 30 cycles of 94°C for 1 min and annealing/elongation temperature (Table 1) for 2 min. For a few primer sets (as indicated in Table 1), 2% DMSO was also added to the reaction mixture. PCR products were separated by gel electrophoresis on 2% agarose and stained with ethidium bromide. Gel images were recorded with a digital imaging system (AlphaInnotech, San Leandro, CA) and the intensity of the bands was analyzed with AlphaEase software from the same manufacturer. Microsoft Excel was used to graph the standard curves, determine the equations of the linear regression lines, and calculate the genomic ng-equivalent value of the unknown samples.

Reverse transcription PCR (RT-PCR)

Total RNA was isolated from NHF1-hTERT, 1604-hTERT, and CRL-1502 cells using the SV Total RNA Isolation System (Promega, Madison, WI). RNA was quantified and aliquots were run on agarose gels to check for quality. First strand cDNA synthesis was performed on 200 ng of total RNA using Superscript III (Invitrogen, Carlsbad, CA) and a reverse primer for either FMR1 or FMR2. PCR was performed with one tenth of the cDNA reaction using Thermo-Start DNA polymerase (ABgene, Rochester, NY) in an OmnE or Express thermocycler (Thermo Electron Corp., Milford, MA). PCR was carried out according to the 3-step protocol described above, with 35 cycles used for each primer set. Primer sequences were as follows: FMR1 forward gctgaagagaagatggaggag, reverse acaggaggtgggaatctgac; FMR2 forward atgggagcggaggaatcaag, reverse ttctggactcggttggcaag. The PCR product for FMR1 extends from exon 2 to 4 and the primer set for FMR2 extends from exon 2 to 3.

RESULTS

Mapping of an origin of DNA replication by measuring nascent strand abundance is based on the concept that newly synthesized strands of DNA are elongated bidirectionally away from a replication start. Therefore, within the population of nascent strands of different lengths purified from the bulk of genomic DNA, the sequences closest to the origin will be found at the highest relative abundance (Giacca et al., 1997), while sequences further from the origin will be progressively less abundant. Semi-quantitative PCR with primer sets targeting the region of interest (Cohen et al., 2002) is used to determine the relative abundance of specific sequence markers in a preparation of nascent DNA fragments and thus establish which are the closest to a functional origin of replication. This type of analysis on the sequence around the promoter region of the FMR1 gene revealed a peak of abundance overlapping the triple repeat sequence previously reported to be linked to the onset of fragile X syndrome. Both cell lines studied displayed the peak of abundance with PCR marker E (Fig. (Fig.11 and and2).2). No other initiation zone was detected in the 5 kb of surrounding sequence.

Figure 1
Nascent strand abundance analysis in the human FMR1 promoter region of NHF1-hTERT cells. Each marker shown in this histogram was tested at least three times using nascent DNA prepared from normal human fibroblasts (NHF1-hTERT cells). Error bars show the ...
Figure 2
Nascent strand abundance analysis in the human FMR1 promoter region of GM1604-hTERT cells. The relative abundance of markers in a preparation of short nascent DNA from GM1604-hTERT, a fetal lung fibroblast cell line, was determined as described for NHF1-hTERT ...

In both the FMR1 (this report) and FMR2 (Chastain et al., 2006) regions the origin of replication was mapped within the transcriptional promoter. We analyzed the transcriptional activity of FMR1 and FMR2 in the cell lines that were tested for origin activity (NHF1- and 1604-hTERT cells; Fig. 3). FMR1 was expressed in both of these cell lines, but there was no detectable expression of FMR2. These results indicate that even though the origins of replication associated with both the FMR1 and FMR2 genes are located at their transcriptional promoter, transcription itself is not necessary for origin firing. This is in agreement with previous reports that showed that origins of replication associated with the human HPRT and G6PD transcriptional promoters fire on both the active and inactive X chromosomes (Cohen et al., 2003).

Figure 3
Reverse Transcription PCR. RT-PCR of FMR1 and FMR2 messenger RNA in total RNA isolated from log phase NHF1-hTERT (lane 1), 1604-hTERT (lane 2), and CRL-1502 (lane 3) cells. Products were visualized on a 2% agarose gel stained with ethidium bromide (shown ...

We determined that the FRAXA region corresponding to the FMR1 gene in chromosome Xq27.3 replicates in the second half of the S phase in two normal human fibroblasts cell lines (Fig. 4). We were interested in establishing precisely the timing of replication of the FMR1 gene, previously reported to be late replicating (Hansen et al., 1997; Hansen et al., 1993) by using the same cells and the same method we applied previously to the FMR2 region (Chastain et al., 2006). For a particular type of cell, genomic DNA is replicated according to a highly organized and reproducible temporal order. A correlation has been proposed between the time of replication and the expression of genes in metazoan cells, with expressed genes replicating early and silent genes replicated later in S phase (Hatton et al., 1988; Schwaiger and Schubeler, 2006). This difference in replication timing has been attributed to the chromatin status in the genome: chromatin that is more gene-rich (euchromatin) is more open because of transcription and replicates early, while gene-poor, more compacted chromatin (heterochromatin) replicates later in S phase. In the region of the X chromosome we analyzed in these studies, however, we found two genes, one transcriptionally active (FMR1) and the other inactive (FMR2), both replicating towards the end of the S phase. Because of this atypical replication status, it is likely that the FMR1 region displays an unusual chromatin structure, having both the epigenetic markings for active transcription and, perhaps, some yet to be determined cis-acting element determining the late replication timing (Hansen et al., 1997). A shift to replication even later in S phase (closer to the S/G2 border), associated with the silencing of the gene, is found in fragile X syndrome (Hansen et al., 1997). Based on published studies on X inactivation, we would predict that this shift to later replication would occur during embryonic development and should precede methylation of the promoter (reviewed in Heard, 2004). Therefore, it is possible that triplet repeat expansion leading to the alteration of a cis-acting element that controls replication timing may be involved in the switching of this gene to the inactive status (i.e., DNA hypermethylated at the promoter) that is found in fragile X syndrome.

Figure 4
Determination of the timing of replication of the FMR1 gene in NHF1-hTERT cells. Newly synthesized DNA from seven different 1-h S phase intervals was tested by quantitative PCR to determine when the FMR1 gene region replicates. Panel A: Image of PCR products ...

DISCUSSION

This study disclosed the presence of an active origin of replication in the promoter region of the human FMR1 gene. Although the nascent DNA abundance method for origin mapping allows the positioning of an origin in a fairly precise location, it does not specify an initiation site at the nucleotide level. Because of the difficulty in amplifying certain sequences (particularly CGG repeats), when analyzing the FMR1 origin region we could not generate PCR products between or overlapping markers D and E, and E and F (Fig. 1). Therefore, we cannot be certain that sequence markers in these areas are not represented at a relative abundance higher than E. Consequently, we defined an “initiation region” as spanning from the midpoint of the sequence between markers D and E to the midpoint of the sequence between marker E and F (Fig. 1). Accordingly, the initiation region for the FMR1 origin spans 483 bp, and it overlaps the triplet repeat site (Fig. 5A). Since no other initiation zone was detected within the surrounding 5 kb, we assume that this is the origin responsible for the replication of the triplet repeat tract. With the origin of replication in this position, the repeat (CGG)n is located in the upper strand of the diagram (Fig. 5A), which would represent the template for the lagging strand. This arrangement is not considered to be conducive to amplification (Siyanova and Mirkin, 2001) because the strand containing the (GCC)n repeat would serve as the template to the leading strand, which is synthesized continuously and is less likely to form hairpin loops at the complementary (CGG)n repeat. In our study, however, the FMR1 origin was mapped in neonatal (NHF1) and 12-week fetal cells (GM1604). In embryonic cells, where more origins of DNA replication are likely to be active, replication through this repeat may be controlled by another origin, not active in the adult cells, located on the 3′ side of the triplet repeat (Fig 5B). In that case, the (GCC)n template would direct the synthesis of the lagging strand, favoring the formation of secondary structures (e.g. CGG hairpins) in the nascent complementary strand, possibly leading to expansion. This event would explain expansion occurring in early development rather than in adult cells, as has been reported (Wohrle et al., 1993). Further, if either origin selection or amplification is a stochastic rather than deterministic process and expansion shows strong strand bias, then triplet repeat expansion mutations would not be found in all adult cells of fragile X syndrome patients, which is consistent with diagnoses of mosaicism for the triplet repeat expansion seen in affected patient. In fact, it has been reported that fragile X female fetal fibroblasts display dynamic instability in culture, whereas fragile X adult male fibroblasts do not (Sun and Han, 2004). Another explanation for the generation of instability in the FMR1 region would be the presence of acquired changes in the location where Okazaki fragments are primed relative to the position of the repeat (Cleary and Pearson, 2005). It has been reported that difficulty in the anchoring of primers in repeat regions (Lyons-Darden and Topal, 1999) may favor slippage in primer binding and lead to expansion.

Fig. 5
Schematic representation of the relative position of initiation region and triplet repeats for the FMR1 and FMR2 origins. The boxed areas in A and C represent the “initiation region” for the found origins spanning from the midpoint of ...

Interestingly, in the origin of replication associated with the promoter/trinucleotide repeat of the FMR2 gene that we reported recently (Chastain et al., 2006), the conditions are reversed. The initiation region (defined as above) is 373 bp and overlaps the triplet repeat as well (Fig. 5C). However, unlike the FMR1 origin, the (CCG)n repeat is in the template for the lagging strand, potentially resulting in the expansion of the complementary (GGC)n repeat in the nascent strand that is synthesized discontinuously, consequent to the generation of unusual secondary structures, such as stable hairpins. For this origin configuration, the risk of amplification would be lessened if the repeat tract were replicated from another origin active on its 3′ side (Fig. 5D). According to this model for the amplification of triplet repeats, it would appear that the configuration at the FRAXE origin site is much more conducive to expansion than the one at the FRAXA site. This conclusion, however, is not supported by the observed prevalence of full mutation of 1 in 5530 for FRAXA and 1 in 23423 for FRAXE (Youings et al., 2000). Therefore, it is likely that different molecular mechanisms are responsible for expansion at the FRAXA and FRAXE sites, thus accounting for the differences in the incidence of these mutations among fragile X syndrome patients.

Acknowledgments

This work was sponsored by NIH grant CA084493 and the UNC Medical Alumni Endowment Award (to PDC).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • Abrams MT, Reiss AL, Freund LS, Baumgardner TL, Chase GA, Denckla MB. Molecular-neurobehavioral associations in females with the fragile X full mutation. Am J Med Genet. 1994;51:317–327. [PubMed]
  • Boyer JC, Kaufmann WK, Cordeiro-Stone M. Role of postreplication repair in transformation of human fibroblasts to anchorage independence. Cancer Res. 1991;51:2960–2964. [PubMed]
  • Brylawski BP, Cohen SM, Longmire JL, Doggett NA, Cordeiro-Stone M, Kaufman DG. Construction of a cosmid library of DNA replicated early in the S phase of normal human fibroblasts. J Cell Biochem. 2000;78:509–517. [PubMed]
  • Chastain PD, 2nd, Cohen SM, Brylawski BP, Cordeiro-Stone M, Kaufman DG. A late origin of DNA replication in the trinucleotide repeat region of the human FMR2 gene. Cell Cycle. 2006;5:869–872. [PubMed]
  • Chastain PD, 2nd, Eichler EE, Kang S, Nelson DL, Levene SD, Sinden RR. Anomalous rapid electrophoretic mobility of DNA containing triplet repeats associated with human disease genes. Biochemistry. 1995;34:16125–16131. [PubMed]
  • Chastain PD, Sinden RR. CTG repeats associated with human genetic disease are inherently flexible. J Mol Biol. 1998;275:405–411. [PubMed]
  • Cleary JD, Pearson CE. Replication fork dynamics and dynamic mutations: the fork-shift model of repeat instability. Trends Genet. 2005;21:272–280. [PubMed]
  • Cohen SM, Brylawski BP, Cordeiro-Stone M, Kaufman DG. Mapping of an origin of DNA replication near the transcriptional promoter of the human HPRT gene. J Cell Biochem. 2002;85:346–356. [PubMed]
  • Cohen SM, Brylawski BP, Cordeiro-Stone M, Kaufman DG. Same origins of DNA replication function on the active and inactive human X chromosomes. J Cell Biochem. 2003;88:923–931. [PubMed]
  • Cordeiro-Stone M, Boyer JC, Smith BA, Kaufmann WK. Effect of benzo[a]pyrenediol-epoxide-I on growth of nascent DNA in synchronized human fibroblasts. Carcinogenesis. 1986;7:1775–1781. [PubMed]
  • Cordeiro-Stone M, Doggett NA, Laundon CA, Kaufman DG. Timing of proto-oncogene replication and its relationship to transformation sensitivity to chemical carcinogens. In: Paukovits WR, editor. Growth Regulation and Carcinogenesis. CRC Press; Boca Raton, FL: 1990. pp. 131–142.
  • Cummings CJ, Zoghbi HY. Trinucleotide repeats: mechanisms and pathophysiology. Annu Rev Genomics Hum Genet. 2000;1:281–328. [PubMed]
  • Drouin R, Angers M, Dallaire N, Rose TM, Khandjian EW, Rousseau F. Structural and functional characterization of the human FMR1 promoter reveals similarities with the hnRNP-A2 promoter region. Hum Mol Genet. 1997;6:2051–2060. [PubMed]
  • Ennis S, Murray A, Youings S, Brightwell G, Herrick D, Ring S, Pembrey M, Morton NE, Jacobs PA. An investigation of FRAXA intermediate allele phenotype in a longitudinal sample. Ann Hum Genet. 2006;70:170–180. [PubMed]
  • Farzin F, Perry H, Hessl D, Loesch D, Cohen J, Bacalman S, Gane L, Tassone F, Hagerman P, Hagerman R. Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation. J Dev Behav Pediatr. 2006;27:S137–144. [PubMed]
  • Fassnacht W, Mempel A, Strowitzki T, Vogt PH. Premature ovarian failure (POF) syndrome: towards the molecular clinical analysis of its genetic complexity. Curr Med Chem. 2006;13:1397–1410. [PubMed]
  • Garcia-Nonell C, Rigau-Ratera E, Artigas-Pallares J. [Autism in fragile X syndrome.] Rev Neurol. 2006;42(Suppl 2):S95–98. [PubMed]
  • Giacca M, Pelizon C, Falaschi A. Mapping replication origins by quantifying relative abundance of nascent DNA strands using competitive polymerase chain reaction. Methods. 1997;13:301–312. [PubMed]
  • Giacca M, Zentilin L, Norio P, Diviacco S, Dimitrova D, Contreas G, Biamonti G, Perini G, Weighardt F, Riva S, et al. Fine mapping of a replication origin of human DNA. Proc Natl Acad Sci U S A. 1994;91:7119–7123. [PMC free article] [PubMed]
  • Greco CM, Berman RF, Martin RM, Tassone F, Schwartz PH, Chang A, Trapp BD, Iwahashi C, Brunberg J, Grigsby J, Hessl D, Becker EJ, Papazian J, Leehey MA, Hagerman RJ, Hagerman PJ. Neuropathology of fragile X-associated tremor/ataxia syndrome (FXTAS) Brain. 2006;129:243–255. [PubMed]
  • Hansen RS, Canfield TK, Fjeld AD, Mumm S, Laird CD, Gartler SM. A variable domain of delayed replication in FRAXA fragile X chromosomes: X inactivation-like spread of late replication. Proc Natl Acad Sci U S A. 1997;94:4587–4592. [PMC free article] [PubMed]
  • Hansen RS, Canfield TK, Lamb MM, Gartler SM, Laird CD. Association of fragile X syndrome with delayed replication of the FMR1 gene. Cell. 1993;73:1403–1409. [PubMed]
  • Hatton DD, Sideris J, Skinner M, Mankowski J, Bailey DB, Jr., Roberts J, Mirrett P. Autistic behavior in children with fragile X syndrome: Prevalence, stability, and the impact of FMRP. Am J Med Genet A. 2006;140:1804–1813. [PubMed]
  • Hatton KS, Dhar V, Brown EH, Iqbal MA, Stuart S, Didamo VT, Schildkraut CL. Replication program of active and inactive multigene families in mammalian cells. Mol Cell Biol. 1988;8:2149–2158. [PMC free article] [PubMed]
  • Heard E. Recent advances in X-chromosome inactivation. Curr Opin Cell Biol. 2004;16:247–255. [PubMed]
  • Heffernan TP, Simpson DA, Frank AR, Heinloth AN, Paules RS, Cordeiro-Stone M, Kaufmann WK. An ATR- and Chk1-dependent S checkpoint inhibits replicon initiation following UVC-induced DNA damage. Mol Cell Biol. 2002;22:8552–8561. [PMC free article] [PubMed]
  • Hou M, Wang MJ, Zhong N. Principal genetic syndromes and autism: from phenotypes, proteins to genes. Beijing Da Xue Xue Bao. 2006;38:110–115. [PubMed]
  • Iwahashi CK, Yasui DH, An HJ, Greco CM, Tassone F, Nannen K, Babineau B, Lebrilla CB, Hagerman RJ, Hagerman PJ. Protein composition of the intranuclear inclusions of FXTAS. Brain. 2006;129:256–271. [PubMed]
  • Jacquemont S, Leehey MA, Hagerman RJ, Beckett LA, Hagerman PJ. Size bias of fragile X premutation alleles in late-onset movement disorders. J Med Genet. 2006 [PMC free article] [PubMed]
  • Kang S, Jaworski A, Ohshima K, Wells RD. Expansion and deletion of CTG repeats from human disease genes are determined by the direction of replication in E. coli. Nat Genet. 1995;10:213–218. [PubMed]
  • Lyons-Darden T, Topal MD. Effects of temperature, Mg2+ concentration and mismatches on triplet-repeat expansion during DNA replication in vitro. Nucleic Acids Res. 1999;27:2235–2240. [PMC free article] [PubMed]
  • McMurray CT. DNA secondary structure: a common and causative factor for expansion in human disease. Proc Natl Acad Sci U S A. 1999;96:1823–1825. [PMC free article] [PubMed]
  • Meskhi A, Seif MW. Premature ovarian failure. Curr Opin Obstet Gynecol. 2006;18:418–426. [PubMed]
  • Ouellette MM, McDaniel LD, Wright WE, Shay JW, Schultz RA. The establishment of telomerase-immortalized cell lines representing human chromosome instability syndromes. Hum Mol Genet. 2000;9:403–411. [PubMed]
  • Pearson CE, Eichler EE, Lorenzetti D, Kramer SF, Zoghbi HY, Nelson DL, Sinden RR. Interruptions in the triplet repeats of SCA1 and FRAXA reduce the propensity and complexity of slipped strand DNA (S-DNA) formation. Biochemistry. 1998;37:2701–2708. [PubMed]
  • Pearson CE, Nichol Edamura K, Cleary JD. Repeat instability: mechanisms of dynamic mutations. Nat Rev Genet. 2005;6:729–742. [PubMed]
  • Pearson CE, Sinden RR. Alternative structures in duplex DNA formed within the trinucleotide repeats of the myotonic dystrophy and fragile X loci. Biochemistry. 1996;35:5041–5053. [PubMed]
  • Pearson CE, Sinden RR. Trinucleotide repeat DNA structures: dynamic mutations from dynamic DNA. Curr Opin Struct Biol. 1998;8:321–330. [PubMed]
  • Pearson CE, Wang YH, Griffith JD, Sinden RR. Structural analysis of slipped-strand DNA (S-DNA) formed in (CTG)n. (CAG)n repeats from the myotonic dystrophy locus. Nucleic Acids Res. 1998;26:816–823. [PMC free article] [PubMed]
  • Rousseau F, Heitz D, Oberle I, Mandel JL. Selection in blood cells from female carriers of the fragile X syndrome: inverse correlation between age and proportion of active X chromosomes carrying the full mutation. J Med Genet. 1991;28:830–836. [PMC free article] [PubMed]
  • Schwaiger M, Schubeler D. A question of timing: emerging links between transcription and replication. Curr Opin Genet Dev. 2006;16:177–183. [PubMed]
  • Sinden RR. Biological implications of the DNA structures associated with disease-causing triplet repeats. Am J Hum Genet. 1999;64:346–353. [PMC free article] [PubMed]
  • Siyanova E, Mirkin SM. [Expansion of trinucleotide repeats] Mol Biol (Mosk) 2001;35:208–223. [PubMed]
  • Sun YJ, Han X. Dynamic behavior of fragile X full mutations in cultured female fetal fibroblasts. Acta Pharmacol Sin. 2004;25:973–976. [PubMed]
  • Tassone F, Hagerman RJ, Taylor AK, Gane LW, Godfrey TE, Hagerman PJ. Elevated levels of FMR1 mRNA in carrier males: a new mechanism of involvement in the fragile-X syndrome. Am J Hum Genet. 2000;66:6–15. [PMC free article] [PubMed]
  • Terracciano A, Chiurazzi P, Neri G. Fragile X syndrome. Am J Med Genet C Semin Med Genet. 2005;137:32–37. [PubMed]
  • Tribioli C, Biamonti G, Giacca M, Colonna M, Riva S, Falaschi A. Characterization of human DNA sequences synthesized at the onset of S-phase. Nucleic Acids Res. 1987;15:10211–10232. [PMC free article] [PubMed]
  • Verkerk AJ, Pieretti M, Sutcliffe JS, Fu YH, Kuhl DP, Pizzuti A, Reiner O, Richards S, Victoria MF, Zhang FP, et al. Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell. 1991;65:905–914. [PubMed]
  • Woad KJ, Watkins WJ, Prendergast D, Shelling AN. The genetic basis of premature ovarian failure. Aust N Z J Obstet Gynaecol. 2006;46:242–244. [PubMed]
  • Wohrle D, Hennig I, Vogel W, Steinbach P. Mitotic stability of fragile X mutations in differentiated cells indicates early post-conceptional trinucleotide repeat expansion. Nat Genet. 1993;4:140–142. [PubMed]
  • Youings SA, Murray A, Dennis N, Ennis S, Lewis C, McKechnie N, Pound M, Sharrock A, Jacobs P. FRAXA and FRAXE: the results of a five year survey. J Med Genet. 2000;37:415–421. [PMC free article] [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...