![]() | ![]() |
Formats:
|
||||||||||||||||
BAC CLONES GENERATED FROM SHEARED DNA a Children’s Hospital and Research Center at Oakland, 747 52nd street Oakland CA 94609 b Department of Genome Biology, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA c Centro de Biología Molecular Severo Ochoa, CSIC-UAM, 28049 Madrid, Spain dCorrespondence: Kazutoyo Osoegawa, Email: kosoegawa/at/chori.org, Phone: 510-450-7911, Fax: 510-450-7951 Abstract BAC libraries generated from restriction-digested genomic DNA display representational bias and lack some sequences. To facilitate completion of genome projects, procedures have been developed to create BACs from DNA physically sheared to create fragments extending up to 200 kb. The DNA fragments were repaired to create blunt ends and ligated to a new BAC vector. This approach has been tested by generating BAC libraries from Drosophila DNA, with average insert lengths between 50 – 150 kb. The libraries lack chimeric clone problems as determined by mapping paired BAC-end sequences to the assembled fly genome sequence. The utility of “sheared” libraries was demonstrated by closure of a previous clone gap and by isolation of clones from telomeric regions, which were notably absent from previous Drosophila BAC libraries. Keywords: bacterial artificial chromosome, BAC, sheared DNA, cloning, vector, adaptor, telomere, centromere and heterochromatin Introduction Bacterial artificial chromosome (BAC) libraries have played a crucial role in many genome mapping and sequencing projects [1–7]. All previous BAC libraries have been constructed from DNA partially-digested with restriction enzymes, such as EcoRI, MboI and HindIII [5, 8–11]. In most mapped and sequenced genomes, a number of regions remain unresolved due to an absence of BAC coverage, in spite of considerable effort. BAC-based physical maps contain persistent clone gaps, and maps created by alignment of BAC-end sequences suffer from gaps and occasional genome assembly errors. Such errors often result from difficulties in assembling regions containing complex repetitive sequence blocks. In addition, genome sequence assemblies derived by the whole genome shotgun (WGS) approach tend to have sequence collapses in regions containing duplicons [6]. Finally, some genomic sequences can not be recovered through conventional BAC cloning presumably due to instability in E. coli, non-uniform distribution of restriction sites in the affected regions, or potential toxicity of the cloned DNA. It has been impossible to clone high AT (>70%) content DNA as large inserts in E. coli, as was observed for Plasmodium falciparum [12] and Dictyostelium discoideum [13]. Telomeric and/or subtelomeric regions are underrepresented in most BAC libraries most likely due to problematic patterns of restriction sites [14, 15]. Obviously the ends of chromosomes are inaccessible to cloning by partial restriction strategies due to the absence of restriction sites in telomeric repeat sequences. To circumvent this problem, half-YAC clones have been created from the human genome to isolate telomeric regions, but at considerable expense [14, 16]. To reduce the cloning bias generated by restriction digestion, we developed procedures to clone large fragments from physically sheared genomic DNA. Four BAC libraries were constructed, two for Drosophila melanogaster, one for D. pseudoobscura and one for human. One of the D. melanogaster BAC libraries has been characterized extensively by mapping end-sequences to the assembled genome sequence. The usefulness of these D. melanogaster libraries has been demonstrated by preparing physical maps of the telomeric regions [17, 18] and by closing a gap in the genome assembly of the X chromosome. Results Development of cloning procedures Our overall goal was to construct BAC libraries with a more random representation of the genome than those generated through partial genomic restriction digestion and hopefully suitable for closing gaps in existing physical maps. To this end, a new cloning vector was developed which enables cloning of blunt-ended DNA fragments. High-molecular-weight (HMW) DNA embedded in agarose blocks was sheared through repeated freezing and thawing. To increase the fraction of blunt-ended DNA fragments, the agarose blocks were incubated consecutively with Mung Bean nuclease and T4 DNA polymerase, or only with T4 DNA polymerase. The “polished” DNA was then isolated from the agarose blocks by electro-elution. Initial attempts to clone these fragments directly into a blunt-ended vector resulted in very low cloning efficiencies, at least 50-fold lower as compared with results from partial restriction-digest fragments. Moreover, the recombinant clones were a minor fraction, with most clones lacking inserts. The low efficiency combined with high levels of non-insert clones made it impractical to create BAC libraries in this way (data not shown). To suppress the non-insert background problem, the blunt ended DNA was ligated to an adaptor to create 5′ protruding, non-complementary (CACA) ends (Figure 1
Construction of a new cloning vector BstXI restriction sites were removed from the pTARBAC1 vector resulting in the intermediate pTARBAC1.3 vector [11]. Two new BstXI sites were inserted at positions flanking a stuffer fragment to be removed when creating a BAC library. A small EcoRI (2,728)–EcoRI (2801) fragment in the pTARBAC1.3 vector was removed when the two BstXI sites were inserted (Figure 1 Construction of BAC libraries Two Drosophila melanogaster BAC libraries designated as CHORI-221 and CHORI-223 were constructed from sheared DNA using the pTARBAC6 vector. Each library is composed of 18,000 clones arrayed into 384-well microtiter dishes (Table 1). We hypothesize that some cloning gaps in previous BAC libraries [RPCI-98: [5]] might result from the combined instability of multiple elements, which perhaps can be propagated separately using smaller insert clones. In addition, stable sequences adjacent to unclonable elements will be under-represented in large insert libraries. The CHORI-223 library was therefore constructed with a ~50 kb average insert size as compared to 115 kb for the CHORI-221 library. Two BAC libraries designated as CHORI-222 and CHORI-16 were constructed from sheared D. pseudoobscura and sheared human DNA (Table 1) and are composed of 8,200 and 151,000 arrayed clones, respectively.
Average insert sizes BAC insert sizes were sampled for the four libraries by pulsed-field gel electrophoresis. The average insert sizes were 115 kb, 152 kb, 48 kb and 84 kb with standard deviations of 33 kb, 52 kb, 17 kb and 36 kb for the CHORI-221, CHORI-222, CHORI-223 and CHORI-16 libraries, respectively. The insert size distributions for the libraries are shown in Figure 2
Efficiency of constructing sheared DNA BAC libraries BAC cloning efficiency is defined by the number of independently-transformed cells, also known as colony-forming units (cfu), generated per microgram of size-fractionated DNA. Using conventional BAC cloning from partially restriction-digested genomic DNA, a sharp decrease in the cloning efficiency is always observed with increasing insert size. For instance, cloning from the 130 kb DNA size-fraction is at least 5-fold higher than from the 170-kb fraction (unpublished observations). We observed a similar decrease in cloning efficiency, inversely proportional to DNA size, when we cloned sheared genomic DNA. It is important to consider the relative cloning efficiency from sheared DNA versus partially-digested DNA. The results of comparison of cloning efficiencies by the different methods are presented in Table 1, for five BAC libraries. We have constructed fly (CHORI-221 and CHORI-223) and human (CHORI-16) BAC libraries from sheared DNA. We have also constructed many more BAC libraries from EcoRI-partially digested DNA, for instance the fly (RPCI-98) and human (RPCI-11) libraries [5, 9]. The efficiency for constructing the CHORI-221 library was 3.6-fold lower than that of the RPCI-98 library even though the average insert size of CHORI-221 is 50 kb less than that of RPCI-98. Similarly the efficiency for creating CHORI-16 was 4.2-fold lower than that of RPCI-11, while the average insert size of CHORI-16 is 95-kb less than that of RPCI-11. The high cloning efficiency for CHORI-223 was mainly due to the small average size of sheared fragments (48 kb). We were able to generate the CHORI-222 library with 152 kb average insert size from sheared DNA at very high cloning efficiency, but were never able to reproduce this for the other libraries. Mapping BAC ends Cloning artifacts which combine unrelated genomic fragments in a single derivative clone can be a major impediment for genome mapping and sequencing if they occur at significant levels. Chimeric clone levels in Yeast Artificial Chromosome (YAC) libraries were always high with chimeric clones representing at least 10% of the total. By contrast, BAC libraries prepared by partial restriction-digest cloning have a relatively low numbers of chimeras: levels of 1% or lower have been reported for the human, mouse and rat BAC libraries used in support of genome projects [9–11]. To ascertain the levels of such cloning artifacts resulting from the blunt-end cloning strategy, paired “CHORI-221” BAC end sequences were mapped onto Release 3 of the D. melanogaster genome sequence assembly [7]. A small number of BAC end sequences containing highly repetitive sequences were aligned onto Release 5 D. melanogaster genome sequence assembly (http://www.fruitfly.org/sequence/release5genomic.shtml). High quality sequences were obtained from raw sequence trace files for 288 BACs by trimming vector-, adapter- and low quality 3′-sequences. A total of 239 BACs had high quality sequences at both ends. These BAC-end sequences were mapped by BLASTN to the fly genome sequence. A total of 227 clones (95%) map to unique locations and display a virtual insert size compatible with the properties of the BAC library. Nine BACs could not be used to test chimera levels because at least one end lacked unique sequence or lacked a corresponding BLASTN hit in the Release 3 and 5 fly genome sequence. These BAC ends are probably representing heterochromatic regions. The remaining three clones had unmapped heterochromatic sequences at both ends. No chimeric BACs were identified in this analysis. To exhibit the distribution of BACs from CHORI-221 and RPCI-98 libraries, the number of mapped BACs to all chromosome arms is summarized in Table 2.
Screening D. melanogaster BAC libraries Most eukaryotic genomes contain regions of highly repetitive sequences, designated as heterochromatin, that are mainly clustered in centromeric and telomeric regions. Most genome analyses have been focused on the euchromatic portion of the genomes [5] where most of the genes are found. The repetitive nature of the heterochromatic regions has made mapping and sequencing difficult. Heterochromatic regions are often under-represented in BAC libraries constructed by the partial restriction-digest approach. For instance, we previously reported under-representation of α-satellite sequences with the 340 bp EcoRI repeat in the human BAC library, presumably due to the abundance of EcoRI sites and the use of EcoRI for the cloning strategy [9]. To examine if sheared libraries affect the efficiency of cloning heterochromatic regions, three fly libraries were compared: the RPCI-98 BAC library generated by cloning EcoRI restriction fragments and the CHORI-221 and CHORI-223 BAC libraries generated from sheared DNA. To this end, the libraries were initially screened with the 359 satellite, a major variant of the D. melanogaster 1.688 satellite DNA family. This DNA sequence consists of a tandemly-repeated 359 bp monomer lacking EcoRI sites. The 359 satellite expands across the centromere of the X chromosome and has been estimated to account for about 11 Mb (6.1%) of the D. melanogaster genome [21, 22]. The three libraries each contain 18,000 clones with the genomic redundancies estimated to be 22-, 15.6- and 7.2-fold, respectively, by taking the average insert size of the clones into account. Only six hybridizing clones were found in the RPCI-98 library as compared to 26 and 218 hybridizing clones in the CHORI-221 and CHORI-223 libraries, respectively (Table 3). This indicates improved cloning efficiency of genomic regions containing this satellite sequence following the new strategy. Nevertheless, the fraction of positive clones in the “sheared” libraries was much less than the 6.1% fraction of the genome corresponding to the 1.688 satellite, indicating that additional factors creating cloning bias against these heterochromatic regions exist. Further hybridizations were performed using seven additional heterochromatin repeat probes (Table 3). In principal, larger insert clones would be more useful for construction of physical maps. It is remarkable that a larger fraction of positive clones was detected in CHORI-223 (48 kb average insert size) as compared to CHORI-221 (115 kb average insert size) for all probes except Mst77F. The aberrant results with the Mst77F probe may relate to its distribution in the genome. It is not exclusively derived from heterochromatic regions, and hybridizes to a euchromatic gene on chromosome 3 and to heterochromatic pseudogenes on the Y chromosome [23]. Three major dodeca satellite blocks, two of which are larger than 200 kb in size, have been found in the centromeric region (h53) of the D. melanogaster chromosome 3 [24]. Mapping BACs in the h53 region revealed that none of the 110 hybridization positive clones from the RPCI-98 library (Table 3) was localized onto the two large dodeca satellite blocks, indicating all the positive clones are derived from regions containing small dodeca satellite blocks. By contrast, several sheared DNA clones from CHORI-221 and CHORI-223 are mapping to the large dodeca satellite blocks (Villasante et at, unpublished results). It is therefore important to note that the number of hybridization positive clones using repeat probes may not reflect the true representation of the library.
Extension of contigs toward telomere and closing gaps The most distal regions of the telomeres of D. melanogaster chromosomes had not previously been cloned and mapped, reflecting deficiencies of the earlier BAC libraries [5, 25]. Physical maps of telomeric regions of each chromosome arm have now been prepared using the new BAC libraries (CHORI-221 and CHORI-223). The physical maps of chromosome arms XL, 2L, 2R, 3L, 3R and 4R were extended by ~270 kb, ~45 kb, ~90 kb, ~35 kb, ~20 kb and ~35 kb, respectively, from the most distal clones obtained from earlier libraries and have permitted the detailed structural analysis of the telomeric regions of D. melanogaster [18]. A persistent clone gap (~45 kb) near the tip of X chromosome has been reported between the genomic sequences with GeneBank accession numbers of AABU01002701 and AE003417 [25]. No clones spanning this gap could be found in three libraries generated from partial genomic digest fragments created with EcoRI (RPCI-98), NdeII and HindIII (the European Drosophila Genome Project “DrosBAC” BACN and BACH libraries), respectively. The end of the most distal clone (RP98-37P7) contained several copies of the 1.688 satellite repeat (Figure 3
Discussion We present here procedures enabling the construction of BAC libraries derived from sheared DNA. A new BAC vector, pTARBAC6, was constructed to clone sheared DNA following adaptor ligation. Three Drosophila BAC libraries have been constructed, and characterized by BAC-end sequence mapping, screening with heterochromatic probes and probes flanking a prior cloning gap. No chimeric clones were found in a sample of 227 BAC clones with unique end-sequence pairs (Table 2). An increased fraction of clones containing highly repetitive sequences could be identified in the libraries generated from sheared DNA (Table 3). Interestingly, the smaller insert library presented better representation in terms of number of hybridization positive clones using various probes derived from heterochromatic regions. It is not clear why the smaller insert library had more positive clones for these probes, but we speculate that it may be due to cloning of relatively short regions of heterochromatic DNA situated between highly repetitive or toxic regions. The sheared DNA libraries have provided clones for regions with highly repetitive sequences and for sub-telomeric regions [7, 17, 18, 26]. Although we have not shown that sheared DNA BACs are more randomly distributed than BACs generated by restriction-digest (Table 2), we demonstrated that the sheared DNA libraries have a different and complementary distribution with better representation of problematic and repeat-rich regions at telomeres (Figure 3 Materials and Methods Construction and preparation of BAC vectors The pTARBAC1.3 vector was constructed from the pTARBAC1 vector [27] by eliminating two ApaLI and one BstXI sites by cross-over PCR [11]. The pTARBAC1.3 vector was digested with BamHI and EcoRI, and separated in a 0.7 % agarose gel. The BamHI-BamHI (10.6 kb) and EcoRI-EcoRI (2.8 kb) fragments were recovered from the gel and ligated to a partial-duplex linker (BglII-BstXI-EcoRI) composed of overlapping oligonucleotides (GATCTCCATTGTGTTGGG; AATTCCCAACACAATGGA). This resulted in the pTARBAC6 vector (Figure 1 Preparation of high-molecular-weight DNA High-molecular-weight DNA from mixed-sex adult flies was prepared in agarose blocks (InCert agarose: FMC) as previously described [5]. The D. melanogaster BAC libraries CHORI-221 and CHORI-223 were prepared from an isogenic y1; cn1 bw1 sp1 strain [29]. The D. pseudoobscura BAC library CHORI-222 was prepared from the strain Tucson 14011-0121.4 which was obtained from the Drosophila Species Stock Center, Tuscon, Arizona (http://stockcenter.arl.arizona.edu/). Preparation of agarose embedded DNA from anonymous human blood samples has been described [9]. Construction of a sheared DNA library Four agarose blocks (~100 μg DNA) are each cut into 4 small pieces. The agarose blocks are transferred into a 15-ml conical screw-cap polypropylene tube (Corning 430790) and frozen & thawed four times by cycling between on dry ice for 3 minutes and room temperature for 10 minutes. The agarose-embedded DNA is treated with Mung Bean nuclease (40 units, New England Biolabs) in the commercially supplied buffer [50 mM sodium acetate (pH5.0), 30 mM NaCl, 1 mM ZnSO4] in 1.5 ml reaction mixture at 30°C for 2 hrs. The enzyme is inactivated by adding 3 μl of 20% SDS in the reaction mixture and maintaining the mixture at room temperature for 30 min. The agarose blocks are transferred into dialysis tubing (3/4 in. diameter, molecular weight exclusion limit of 12,000–14,000 daltons; Invitrogen). DNA is electro-eluted into 300 μl sterile 0.5 × TBE buffer at 3 V/cm for 3 hr [28, 30]. The DNA is dialyzed in TE [10 mM Tris-HCl (pH8.0), 1 mM EDTA] buffer at 4°C overnight. The DNA solution and agarose pieces are recovered and treated with 6 units of T4 DNA polymerase (New England Biolabs) in a 500 μl reaction mixture at 16°C for 1 hr. The reaction is stopped by adding 10 μl 0.5 M EDTA and 10 μl 10 mg/ml Proteinase K and incubating at 37°C for 1 hr. Proteinase K is inactivated by adding 10 μl 100 mM PMSF and incubating at room temperature for 1 hr. The solution is dialyzed against water on a floating dialysis membrane (47-mm diameter, 0.025-μm pore-size microdialysis filters: Millipore) for 3 hr. Alternatively, after freeze and thaw cycles the agarose embedded DNA is kept on ice with 105 units of T4 DNA polymerase (New England Biolabs) in 500 μl reaction mixture [50 mM NaCl, 10 mM Tris-HCl (pH7.9), 10 mM MgCl2, 1 mM dithithreitol, 50 μg/ml BSA, 100 μM of each dNTP] and incubated at 16°C for 20 min. The reaction buffer is removed and then the T4 DNA polymerase is inactivated by 300 μg proteinase K (Roche) in 1.5 ml TE50 [10 mM Tris-HCl (pH8.0), 50 mM EDTA] buffer at 37°C for 1 hr. Proteinase K is inactivated with 1.5 ml 2 mM PMSF in TE50 buffer at room temperature for 1 hr. DNA is electroeluted in the same manner. Lyophilized BstXI adaptor (18 μg) consisting of 5′-phosphorylated CTGGAAAG and CTTTCCAGCACA (Invitrogen Cat. No.N-408-18) is dissolved in 100 μl water at a concentration of 28 μM, stored at −20°C and thawed on ice prior to use. The dialysed genomic DNA (~750 μl) is transferred into a microcentrifuge tube and the DNA is ligated to 280 pmole of BstXI adaptor with 10 units T4 DNA ligase (Invitrogen) in a final volume of 1 ml [400 mM Tris-HCl (pH 7.6), 10 mM MgCl2, 1 mM ATP, 1 mM DTT, 5% (w/v) polyethylene glycol 8000]. The ligation mixture (1-ml) is loaded into a preparative well of a 1% agarose gel and separated in a contour-clamped homogeneous electrical field [CHEF [31]] unit as described [30]. Size-fractionated DNA electro-eluted from a gel slice is ligated to the BstXI sites of the pTARBAC6 vector and then used to transform E. coli DH10B (Invitrogen) by electroporation. Approximately 0.5 μg of sheared, adaptor-ligated and size-fractionated DNA is obtained from a single size fractionation on a single gel using 100 μg of agarose embedded DNA. The transformed cells were spread on 22 × 22 cm LB agar plates containing 5% sucrose and 20 μg/ml chloramphenicol and incubated at 37°C for 20 hr. Colonies were picked and arrayed into 48 384-well microtiter dishes containing LB media with 7.5% glycerol and 20 μg/ml chloramphenicol. The BAC vector and libraries are available from BACPAC Resources (http://bacpac.chori.org) at Children’s Hospital and Research Center at Oakland. Insert size analysis BACs from the CHORI-221 (192 clones), CHORI-222 (96 clones), CHORI-223 (192 clones) and CHORI-16 (422 clones) libraries were inoculated in 96-deep well blocks containing LB medium with 20 μg/ml chloramphenicol. BAC DNA was isolated using an automated plasmid isolation robot (AutoGen960, Autogen) and digested with PI-SceI (New England Biolabs) for the CHORI-221, -222, -223 and NotI (New England Biolabs) for CHORI-16. The DNA was loaded in 1% agarose gel in 0.5 x TBE buffer, run in CHEF units and analyzed as described [30]. The size (10.6 kb) of the vector was subtracted from the size of the linearized DNA fragments for determining insert sizes for the CHORI-221, CHORI-222 and CHORI-223 libraries. Mapping of paired BAC end sequences The BAC-end sequencing procedure originally developed at The Institute for Genome Research (TIGR) was modified as described [10]. A total of 288 BACs were sequenced on an ABI-377 DNA machine using the following primers for the T7 and SP6 ends respectively: GCCGCTAATACGACTCACTATAGGGAGAG and GTTTTTTGCGATCTGCCGTTTC. Low quality sequences were trimmed from the 3′ raw sequence data when more than three Ns appeared in a set of 20 bases after 400th base read. Vector and adaptor (GGAAAG) sequences were trimmed from the 5′end. The trimming process was automated through use of a PERL script. The end sequences were matched against the Release 3 sequence assembly of the D. melanogaster genome [7] using BLASTN [32]. The alignment results provide accurate chromosomal map locations and a virtual insert size. A simple graphic interface program designated as “chrmapV11.pl” was designed using PERL/Gtk to visualize the mapping results for all BAC clones. Hybridization RPCI-98 [5], CHORI-221 and CHORI-223 libraries containing ~18,000 clones each were gridded in duplicate with a specific pattern on nylon membranes using an automated gridding robot (BioRobotics). The high-density replica filters were processed with alkaline solution, neutralization solution and Protease solution as described [10]. A total of 8 probes were labeled using random priming, and hybridized to the filters. The 18HT satellite, Doc2 and Mst77F DNA was isolated from the centromeric region of chromosome Y [33, 34]. The other 5 probes have been described elsewhere: 359, 356, 353 satellites [21, 35], Dodecasatellite [36] and Circe [37]. Acknowledgments The authors thank Dr. John Elliot for useful technical advice for developing the cloning procedure and Joseph W. Carlson for the assistance to align BAC end sequences to D. melanogaster genome sequences. The authors are grateful to Joseph Catanese, Susan Rhodes, Jeff Froula, and Barbara Swiatkiewicz for their technical advice and assistance. K.O. has been supported by a Postdoctoral Fellowship for Research Abroad from the Japan Society for the Promotion of Science (JSPS). The work was funded by grants from the US Department of Energy (DE-FG02-94ER61883) to Pieter de Jong and the Ministerio de Educación y Ciencia (BFU2005-07690-C02-01) to Alfredo Villasante. Funding for construction of the CHORI-222 and CHORI-223 BAC libraries was provided by Gerald M. Rubin from NIH grant HG00750. Footnotes Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. References 1. Gregory SG, et al. A physical map of the mouse genome. Nature. 2002;418:743–750. [PubMed] 2. McPherson JD, et al. A physical map of the human genome. Nature. 2001;409:934–941. [PubMed] 3. Lander ES, et al. Initial sequencing and analysis of the human genome. Nature. 2001;409:860–921. [PubMed] 4. Krzywinski M, et al. Integrated and sequence-ordered BAC- and YAC-based physical maps for the rat genome. Genome Res. 2004;14:766–779. [PubMed] 5. Hoskins RA, et al. A BAC-based physical map of the major autosomes of Drosophila melanogaster. Science. 2000;287:2271–2274. [PubMed] 6. Gibbs RA, et al. Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature. 2004;428:493–521. [PubMed] 7. Celniker SE, et al. Finishing a whole-genome shotgun: release 3 of the Drosophila melanogaster euchromatic genome sequence. Genome Biol. 2002;3:RESEARCH0079. [PubMed] 8. Kim UJ, et al. Construction and characterization of a human bacterial artificial chromosome library. Genomics. 1996;34:213–218. [PubMed] 9. Osoegawa K, et al. A bacterial artificial chromosome library for sequencing the complete human genome. Genome Res. 2001;11:483–496. [PubMed] 10. Osoegawa K, et al. Bacterial artificial chromosome libraries for mouse sequencing and functional analysis. Genome Res. 2000;10:116–128. [PubMed] 11. Osoegawa K, et al. BAC resources for the rat genome project. Genome Res. 2004;14:780–785. [PubMed] 12. Gardner MJ, et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 2002;419:498–511. [PubMed] 13. Eichinger L, et al. The genome of the social amoeba Dictyostelium discoideum. Nature. 2005;435:43–57. [PubMed] 14. Riethman HC, et al. Integration of telomere sequences with the draft human genome sequence. Nature. 2001;409:948–51. [PubMed] 15. Mefford HC, Trask BJ. The complex structure and dynamic evolution of human subtelomeres. Nat Rev Genet. 2002;3:91–102. [PubMed] 16. Riethman HC, Moyzis RK, Meyne J, Burke DT, Olson MV. Cloning human telomeric DNA fragments into Saccharomyces cerevisiae using a yeast-artificial-chromosome vector. Proc Natl Acad Sci USA. 1989;86:6240–6244. [PubMed] 17. Abad JP, et al. TAHRE, a novel telomeric retrotransposon from Drosophila melanogaster, reveals the origin of Drosophila telomeres. Mol Biol Evol. 2004;21:1620–1624. [PubMed] 18. Abad JP, et al. Genomic analysis of Drosophila melanogaster telomeres: full-length copies of HeT-A and TART elements at telomeres. Mol Biol Evol. 2004;21:1613–1619. [PubMed] 19. Klickstein LB. In: Ausubel FM, et al., editors. John Wiley & Sons, Inc; New York: 1991. 20. Saitoh T, et al. TWEAK induces NF-kappaB2 p100 processing and long lasting NF-kappaB activation. J Biol Chem. 2003;278:36005–36012. [PubMed] 21. Losada A, Villasante A. Autosomal location of a new subtype of 1.688 satellite DNA of Drosophila melanogaster. Chromosome Res. 1996;4:372–383. [PubMed] 22. Abad JP, et al. Pericentromeric regions containing 1.688 satellite DNA sequences show anti-kinetochore antibody staining in prometaphase chromosomes of Drosophila melanogaster. Mol Gen Genet. 2000;264:371–377. [PubMed] 23. Russell SR, Kaiser K. Drosophila melanogaster male germ line-specific transcripts with autosomal and Y-linked genes. Genetics. 1993;134:293–308. [PubMed] 24. Losada A, Abad JP, Agudo M, Villasante A. Long-range analysis of the centromeric region of Drosophila melanogaster chromosome 3. Chromosome Res. 1996;8:651–653. [PubMed] 25. Benos PV, et al. From first base: the sequence of the tip of the X chromosome of Drosophila melanogaster, a comparison of two sequencing strategies. Genome Res. 2001;11:710–730. [PubMed] 26. Hoskins RA, et al. Heterochromatic sequences in a Drosophila whole-genome shotgun assembly. Genome Biol. 2002;3:RESEARCH0085. [PubMed] 27. Zeng C, et al. Large-insert BAC/YAC libraries for selective re-isolation of genomic regions by homologous recombination in yeast. Genomics. 2001;77:27–34. [PubMed] 28. Strong SJ, Ohta Y, Litman GW, Amemiya CT. Marked improvement of PAC and BAC cloning is achieved using electroelution of pulsed-field gel-separated partial digests of genomic DNA. Nucleic Acids Res. 1997;25:3959–3961. [PubMed] 29. Brizuela BJ, Elfring L, Ballard J, Tamkun JW, Kennison JA. Genetic analysis of the brahma gene of Drosophila melanogaster and polytene chromosome subdivisions 72AB. Genetics. 1994;137:803–813. [PubMed] 30. Osoegawa K, et al. An improved approach for construction of bacterial artificial chromosome libraries. Genomics. 1998;52:1–8. [PubMed] 31. Chu G, Vollrath D, Davis RW. Separation of large DNA molecules by contour-clamped homogeneous electric fields. Science. 1986;234:1582–1585. [PubMed] 32. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. [PubMed] 33. Abad JP, et al. Genomic and cytological analysis of the Y chromosome of Drosophila melanogaster: telomere-derived sequences at internal regions. Chromosoma. 2004;113:295–304. [PubMed] 34. Agudo M, et al. Centromeres from telomeres? The centromeric region of the Y chromosome of Drosophila melanogaster contains a tandem array of telomeric HeT-A- and TART-related sequences. Nucleic Acids Res. 1999;27:3318–24. [PubMed] 35. Lohe AR, Brutlag DL. Multiplicity of satellite DNA sequences in Drosophila melanogaster. Proc Natl Acad Sci USA. 1986;83:696–700. [PubMed] 36. Abad JP, et al. Dodeca satellite: a conserved G+C-rich satellite from the centromeric heterochromatin of Drosophila melanogaster. Proc Natl Acad Sci USA. 1992;89:4663–4667. [PubMed] 37. Losada A, Abad JP, Agudo M, Villasante A. The analysis of Circe, an LTR retrotransposon of Drosophila melanogaster, suggests that an insertion of non-LTR retrotransposons into LTR elements can create chimeric retroelements. Mol Biol Evol. 1999;16:1341–1346. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||
Nature. 2002 Aug 15; 418(6899):743-50.
[Nature. 2002]Genome Biol. 2002; 3(12):RESEARCH0079.
[Genome Biol. 2002]Science. 2000 Mar 24; 287(5461):2271-4.
[Science. 2000]Genomics. 1996 Jun 1; 34(2):213-8.
[Genomics. 1996]Genome Res. 2004 Apr; 14(4):780-5.
[Genome Res. 2004]Genome Res. 2004 Apr; 14(4):780-5.
[Genome Res. 2004]J Biol Chem. 2003 Sep 19; 278(38):36005-12.
[J Biol Chem. 2003]Science. 2000 Mar 24; 287(5461):2271-4.
[Science. 2000]Science. 2000 Mar 24; 287(5461):2271-4.
[Science. 2000]Genome Res. 2001 Mar; 11(3):483-96.
[Genome Res. 2001]Genome Res. 2001 Mar; 11(3):483-96.
[Genome Res. 2001]Genome Res. 2004 Apr; 14(4):780-5.
[Genome Res. 2004]Genome Biol. 2002; 3(12):RESEARCH0079.
[Genome Biol. 2002]Science. 2000 Mar 24; 287(5461):2271-4.
[Science. 2000]Genome Res. 2001 Mar; 11(3):483-96.
[Genome Res. 2001]Chromosome Res. 1996 Aug; 4(5):372-83.
[Chromosome Res. 1996]Mol Gen Genet. 2000 Nov; 264(4):371-7.
[Mol Gen Genet. 2000]Genetics. 1993 May; 134(1):293-308.
[Genetics. 1993]Science. 2000 Mar 24; 287(5461):2271-4.
[Science. 2000]Genome Res. 2001 May; 11(5):710-30.
[Genome Res. 2001]Mol Biol Evol. 2004 Sep; 21(9):1613-9.
[Mol Biol Evol. 2004]Genome Biol. 2002; 3(12):RESEARCH0079.
[Genome Biol. 2002]Mol Biol Evol. 2004 Sep; 21(9):1620-4.
[Mol Biol Evol. 2004]Mol Biol Evol. 2004 Sep; 21(9):1613-9.
[Mol Biol Evol. 2004]Genome Biol. 2002; 3(12):RESEARCH0085.
[Genome Biol. 2002]Nature. 2001 Feb 15; 409(6822):948-51.
[Nature. 2001]Genomics. 2001 Sep; 77(1-2):27-34.
[Genomics. 2001]Genome Res. 2004 Apr; 14(4):780-5.
[Genome Res. 2004]Nucleic Acids Res. 1997 Oct 1; 25(19):3959-61.
[Nucleic Acids Res. 1997]Science. 2000 Mar 24; 287(5461):2271-4.
[Science. 2000]Genetics. 1994 Jul; 137(3):803-13.
[Genetics. 1994]Genome Res. 2001 Mar; 11(3):483-96.
[Genome Res. 2001]Nucleic Acids Res. 1997 Oct 1; 25(19):3959-61.
[Nucleic Acids Res. 1997]Genomics. 1998 Aug 15; 52(1):1-8.
[Genomics. 1998]Science. 1986 Dec 19; 234(4783):1582-5.
[Science. 1986]Genomics. 1998 Aug 15; 52(1):1-8.
[Genomics. 1998]Genome Res. 2000 Jan; 10(1):116-28.
[Genome Res. 2000]Genome Biol. 2002; 3(12):RESEARCH0079.
[Genome Biol. 2002]J Mol Biol. 1990 Oct 5; 215(3):403-10.
[J Mol Biol. 1990]Science. 2000 Mar 24; 287(5461):2271-4.
[Science. 2000]Genome Res. 2000 Jan; 10(1):116-28.
[Genome Res. 2000]Chromosoma. 2004 Dec; 113(6):295-304.
[Chromosoma. 2004]Nucleic Acids Res. 1999 Aug 15; 27(16):3318-24.
[Nucleic Acids Res. 1999]Chromosome Res. 1996 Aug; 4(5):372-83.
[Chromosome Res. 1996]