Logo of bmcpsBioMed Centralsearchsubmit a manuscriptregisterthis articleBMC Plant Biology
BMC Plant Biol. 2007; 7: 32.
Published online 2007 Jun 18. doi:  10.1186/1471-2229-7-32
PMCID: PMC1906783

Transcriptional activation and localization of expression of Brassica juncea putative metal transport protein BjMTP1



Metal hyperaccumulators, including various Thlaspi species, constitutively express the putative metal transporter MTP1 to high levels in shoots. Here we present data on the transcriptional regulation and localization of expression of the homologous gene BjMTP1 in Brassica juncea. Though B. juncea lacks the ability to hyperaccumulate metals, its relatively high biomass, rapid growth and relatedness to true metal hyperaccumulating plants makes it a promising starting point for the development of plants for phytoremediation. Our goal in this study is to determine the transcriptional regulation of MTP1 in order to start to better understanding the physiological role of MTP1 in B. juncea.


Steady-state mRNA levels of BjMTP1 were found to be enhanced 8.8, 5.9, and 1.6-fold in five-day-old B. juncea seedlings after exposure to Ni2+, Cd2+ or Zn2+, respectively. This was also reflected in enhanced GUS activity in B. juncea seedlings transformed with BjMTP1 promoter::GUSPlus after exposure to these metals over a similar range of toxicities from mild to severe. However, no increase in GUS activity was observed after exposure of seedlings to cold or heat stress, NaCl or hydrogen peroxide. GUS expression in Ni2+ treated seedlings was localized in roots, particularly in the root-shoot transition zone. In four- week- old transgenic plants BjMTP1 promoter activity also primarily increased in roots in response to Ni2+ or Cd2+ in plants transformed with either GUS or mRFP1 as reporter genes, and expression was localized to the secondary xylem parenchyma. In leaves, BjMTP1 promoter activity in response to Ni2+ or Cd2+ spiked after 24 h then decreased. In shoots GUS expression was prominently present in the vasculature of leaves, and floral parts.


Our studies establish that a 983 bp DNA fragment upstream of the BjMTP1 translational start site is sufficient for the specific activation by Ni2+ and Cd2+ of BjMTP1 expression primarily in roots. Activation of expression by both metals in roots is primarily localized to the xylem parenchyma cells. This study is the first to identify specific Ni2+ and Cd2+ transcriptional regulation and tissue localization of BjMTP1.


Plant Cation Diffusion Facilitator (CDF) family members have been suggested to be involved in metal ion transport, and implicated in metal resistance in plants [1]. However, the physiological role of these transporters is not well understood. AtMTP1 (ZAT) from Arabidopsis thaliana was the first member of the CDF family to be characterized in plants [2]. When ectopically over expressed in A. thaliana AtMTP1 confers enhanced resistance to Zn2+, and increased Zn2+ accumulation in roots [2]. Enhanced Zn2+ resistance and accumulation was attributed to increased vacuolar sequestration of Zn2+. More recent evidence has established that AtMTP1 is predominantly localized at the tonoplast membrane in both root and shoot tissue in A. thaliana [3,4]. Consistent with a role in Zn2+ transport into the vacuole, reduction in expression of AtMTP1 leads to increased sensitivity to Zn2+, but not Co2+, Cd2+, Ni2+ or Mn2+ [3,4]. Reduced expression of AtMTP1 also leads to decreased accumulation of Zn2+ in shoots [4]. Reconstruction of AtMTP1 in proteoliposomes, and expression of the AtMTP1 cDNA in Xenopus oocytes has provided direct evidence that AtMTP1 is competent to transport Zn2+ but not Cd2+ or Co2+ [4,5]. To date all studies have found that AtMTP1 expression is not modulated by exposure to elevated Zn2+, Cd2+, Co2+, Cu2+, Fe2+ or Mn2+ [2,4]. Expression of AtMTP1 in A. thaliana occurs throughout the plant, though transcript levels are higher in roots than shoots in young seedlings, and expression is higher in the inflorescences [4]. However, little is known about tissue-specific expression patterns of AtMTP1. Such information is critical if we are to integrate the currently available data into a model describing how MTP1 functions within the physiological context of the whole plant.

Homologues of AtMTP1 have been found in other plant species including the hyperaccumulators Thlaspi goesingense [6], Thlaspi caerulescens [7] and Arabidopsis halleri [8]. It has been suggested that the constitutively higher shoot expression of MTP1 in these hyperaccumulators is involved in metal hyperaccumulation [6,7], and recent genetic evidence supports this hypothesis [8]. However, the role of the MTP1 protein in hyperaccumulation is still unknown. In the Zn2+ hyperaccumulator A. halleri AhMTP1 appears to be localized at the tonoplast membrane when transiently expressed as an AhMTP1::GFP fusion in A. thaliana protoplasts [8]. Similar localization has also been observed for an MTP1 homologue from poplar [9]. However, in a similar experiment with TgMTP1 from the Zn2+/Ni2+ hyperaccumulator T. goesingense the GFP fusion protein was found to localize to the plasma membrane when transiently expressed in A. thaliana protoplasts derived from shoot tissue [10]. Resolution of this interesting difference awaits further comparative studies.

Brassica juncea is an amphidiploid plant, resulting from the hybridization of the crop Brassicas Brassica nigra and Brassica campestris (syn. Rapa; [11]). It contains the conserved genomes of both of its diploid parents [12], and is self compatible, unlike other crop Brassica species. Due to its rapid growth and large biomass B. juncea has been considered as a possible plant for use in the phytoextraction process, for the removal of pollutant metals from soils by their accumulation into harvestable above ground biomass [13]. The relatedness of B. juncea to numerous hyperaccumulators in the Brassicaceae family, and its ability to be self fertilized makes B. juncea a potentially good recipient organisms for the bioengineering of a practical phytoextraction plant using genetic material derived from natural hyperaccumulator species [14]. However, such promise has yet to be realized.

Brassica juncea have been shown to accumulate heavy metals, though B. juncea is not a hyperaccumulator [15-17]. However, there are no reports available that attribute a specific role of BjMTP1 in metal accumulation in B. juncea. Here we report that both Ni2+ and Cd2+ induce transcriptional activation of BjMTP1 in whole seedlings, as well as root and shoot tissue of mature plants, where as Zn2+ has very little effect on BjMTP1 expression. We establish that a 983 bp DNA fragment upstream of the BjMTP1 translational start site is sufficient for this regulation, and that expression in roots is specifically localized to the xylem parenchyma cells. This study is the first to identify transcriptional regulation and tissue localization of BjMTP1. However, further work is needed to understand the functional role of BjMTP1 in B. juncea's response to Ni2+ and Cd2+.


MTP1 sequences from B. juncea and its parents

Using AtMTP1 primers MTP1 homologues were amplified from B. juncea and its two parents B. nigra and B. campestris (GenBank accession numbers EF128447, EF128446 and Ef128445, respectively). All Brassica sequences showed 80% similarity to AtMTP1, and all were devoid of introns similar to AtMTP1. Brassica nigra and B. campestris MTP1 showed 97% and 95% similarity to the B. juncea MTP1 sequence, respectively. A phylogenetic analysis of plant MTP1 sequences revealed that all Brassica MTP1 sequences fall into a monophyletic clade, with MTP1 from B. juncea being equally related to MTP1 from both its parents [see Additional file 1]. Isolation of the DNA sequence 5' of BjMTP1 (see below) revealed that the next gene upstream of BjMTP1 is 88% similar to the A. thaliana gene locus At2g46790. At2g46790 is the next upstream gene to AtMTP1 in A. thaliana. Such results show that synteny is conserved within the region of MTP1 between B.juncea and A.thaliana, and provides further strong evidence that the MTP sequence identified in B. juncea is the B. juncea homologue of AtMTP1.

Isolation and characterization of BjMTP1 promoter

A two-step genome walking technique was used to isolate DNA 5' of the B. juncea MTP1 translational start site. As a first step a 1,561 bp PCR product was amplified from the DraI genomic DNA library and cloned. To isolate additional upstream sequence further genome walking was performed using the PvuII genomic DNA library giving a new 1,721 bp PCR product. Sequence analysis of this 1,721 bp DNA fragment indicated it contains not only the remaining sequence 5' of BjMTP1 but also partial sequence of the next gene upstream of BjMTP1 which showed 88% similarity to the A. thaliana gene locus At2g46790 (unknown protein). The 1,561 bp and 1,721 bp DNA fragments were compared and a contiguous 1,786 bp fragment determined. The complete 5' upstream region (1,786 bp), as well as the 1,561 bp fragment, were amplified from the B. juncea genomic DNA and the PCR products used for all further analysis. A 983 bp DNA fragment 5' of BjMTP1 translational start site was predicted to contain the majority of the regulatory elements within the complete 1,786 bp upstream region, and was therefore also amplified and used for further experiments.

Transcriptional activation of BjMTP1 by various metal ions

Total RNA was isolated from dark grown seven-day-old B. juncea seedlings which had been treated with either 5 μM Cd2+, 25 μM Ni2+ or 75 μM Zn2+ for 48 h, treatments that also produced maximal GUS activity in transgenic plants expressing a GUS report gene (see below). These three metals were chosen for this study based on the fact that the hyper accumulators that are known to have constitutively elevated MTP1 expression hyperaccumulator Cd, Ni or Zn. BjMTP1 mRNA were quantified using real time quantitative RT-PCR (qRT-PCR) and normalized to BjACTIN2 as an internal control. Steady-state levels of BjMTP1 mRNA were found to be increased after exposure of seedlings to Cd2+ or Ni2+ when compared to the level of expression in the untreated control plants (Figure (Figure1).1). Cd2+ and Ni2+ treatment caused a 5.9 and 8.8 fold increase in BjMTP1 transcript levels, respectively, compared to untreated control seedlings. Conversely, Zn2+ treated seedlings showed only a minor 1.6-fold increase in BjMTP1 mRNA.

Figure 1
Metal regulation of steady-state levels of BjMTP1 mRNA. Steady-state levels of BjMTP1 mRNA in five-day-old dark grown B. juncea seedlings exposed to Ni2+ (25 μM), Cd2+ (5 μM) or Zn2+ (75 μM) for 48 h measured by qRT-PCR. Data are ...

Analysis of the transcriptional competency of the BjMTP1 promoter region

A 983 bp DNA fragment, originating upstream of the BjMTP1 translational start site, was constructed as a transcriptional fusion with the GUSPlus reporter gene [p(1.0)BjMTP1::GUSPlus]. Five-day-old dark grown seedlings stably transformed with p(1.0)BjMTP1::GUSPlus were treated with varying concentrations of Ni2+, Cd2+ and Zn2+ for 48 h and GUS activity measured (Figure (Figure2).2). GUS activity was observed to peak at 25 μM Ni2+, 5 μM Cd2+ and 75 μM Zn2+, with increases in GUS activity of 3.0, 2.3 and 1.3-fold, respectively (Figure 2A–C). The metal concentrations used in this assay spanned a range from moderately to severally toxic, with the highest concentrations of each metal causing complete loss of turger in the seedlings. To assess the level of toxicity at the end of this 48 h assay rates of K+ leakage from the seedlings were measured. All metal treatments caused an increase in K+ leakage peaking at 10 μM Cd2+, and 100 μM Ni2+ and Zn2+, after which leakage rates dropped and this was associated with a lose of both seedling turger and GUS activity (Figure 2A–C). Histochemical GUS staining of both Cd2+ and Ni2+ treated seedlings demonstrated that the GUS protein product of the p(1.0)BjMTP1::GUSPlus construct is localized mainly in the roots, showing strong expression at the root-shoot transition zone (Figure (Figure2D).2D). In the untreated transgenic seedlings, there was no observable GUS staining (Figure (Figure2D2D).

Figure 2
Metal regulated transcriptional activation of BjMTP1 by its 983 bp promoter. Five-day-old dark grown seedlings, transformed with p (1.0) BjMTP1::GUSPlus, were exposed to different concentrations of Ni2+ (A), Cd2+ (B) or Zn2+ (C) and both GUS activity ...

Plants stably transformed with p(1.0)BjMTP1::GUSPlus were also grown in hydroponic culture for four weeks and transferred to medium of the same composition with the addition of 50 μM Ni2+. Root and shoot samples were taken over a 96 h time course and both Ni2+ accumulation and GUS activity measured. Ni2+ accumulated in both roots and shoots almost linearly with time, with roots accumulating Ni2+ at approximately 10 times the rate of the shoots (Figure (Figure3A).3A). In root samples, GUS enzyme activity increased linearly as the Ni2+ exposure time increased, with a 3.2 fold increase in GUS activity after 48 h Ni2+ treatment compared to basal expression (0 h), or to untransformed control plants (Figure (Figure3B).3B). In shoots, the overall GUS activity was less than in the roots. Interestingly, in shoots GUS activity only transiently increased after 24 h exposure, compared to untransformed plants, after which GUS activity decreased to levels observed at 0 h exposure (Figure (Figure3B),3B), even though Ni2+ accumulation in shoots continued (Figure (Figure3A).3A). Similar results for both root and shoot expression were also obtained with plants stably transformed with p(1.0)BjMTP1::EYFP (yellow fluorescent protein) (data not shown), and p(1.0)BjMTP1::mRFP1 (red fluorescent protein) (Figure (Figure4).4). A comparison of total tissue Ni2+ accumulation and GUS activity revealed a strong positive correlation between the level of Ni2+ accumulation and GUS activity in roots (Figure (Figure3C).3C). In order to test whether the induction process is reversible, after 48 h Ni2+ treatment plants were transferred to nutrient solution lacking Ni2+. After a further 48 h recovery GUS activity in roots was observed to return to that observed at 0 h exposure (Figure (Figure3B).3B). Histochemical GUS analysis of roots from four-week old plants, after 48 h Ni2+ treatment, demonstrated clear GUS expression throughout the main root (Figure (Figure3D).3D). After 48 h Ni2+ treatment GUS expression was not detected in the stem. GUS expression was, however, observed in the vasculature of the leaves (Figure (Figure3E)3E) and in the vascular tissues of the anthers and the stigma (Figure (Figure3F)3F) after 24 hr Ni2+ exposure.

Figure 3
ICP-MS analysis of Ni, GUS enzyme activity and GUS staining of T2 transgenic plants containing p (1.0) BjMTP1::GUSPlus.(A) ICP-MS analysis of Ni in T2 transgenic plants containing p (1.0) BjMTP1::GUSPlus after exposure to 50 μM Ni2+ in 0.1× ...
Figure 4
Expression of mRFP driven by varying sized BjMTP1 promoter sequences in response to Ni2+, Cd2+ and Zn2+ treatment. 48 h metal treated T2 homozygous and null plants were transferred to 0.1× Hoagland's medium with out added metals (arrow) and the ...

The regulatory competency of the 983 bp, 1,561 bp and 1,786 bp DNA sequences upstream of the BjMTP1 translations start site were compared to establish if further metal regulatory elements exist upstream of the 983 bp fragment. The transcriptional activity of these DNA fragments was assessed after construction and transformation of B. juncea with transcriptional fusions with the monomeric red fluorescent protein (mRFP1) as a reporter gene. Hydroponically grown four-week-old B. juncea plants transformed with the mRFP1 reporter constructs were exposed to either 5 μM Cd2+, 50 μM Ni2+ or 50 μM Zn2+ in aerated 0.1× Hoaglands solution. Root and shoot samples were collected over a 96 h time-course and mRFP1 expression quantified using a luminescence spectrometer. As a control for metal related effects on the in vivo stability of mRFP1 pCaMV35S:: mRFP1 transformed plants were also generated and treated in a similar manner. In roots isolated from Ni2+ treated plants, mRFP1 accumulation increased linearly with time of Ni2+ exposure, and the kinetics of mRFP1 accumulation were equivalent regardless of the size of the promoter construct used to drive mRFP1 expression (Figure (Figure4A).4A). All three promoter constructs produced higher mRFP1 accumulation after 48 h Ni2+ exposure than observed with the CaMV35S promoter. Plants were removed from the Ni2+ containing medium after 48 h exposure and allowed to recover for a further 48 h. During this recovery period, mRFP1 accumulation decreased linearly with time in a similar manner regardless of the size of the promoter region (Figure (Figure4A).4A). In leaves from Ni2+ exposed plants, all three promoter constructs drove a similar transient increase in mRFP1 accumulation that peaked at 24 h Ni2+ treatment, after which they declined at a similar rate to the response observed for the promoter GUS construct. mRFP1 expression in plants transformed with pCaMV35S::mRFP1 was constant at all time points and tissues after Ni2+ exposure.

Similar mRFP1 expression was also obtained when plants were exposed to 5 μM Cd2+ for 48 h and allowed to recover from Cd2+ exposure for a further 48 h. mRFP1 accumulated rapidly in roots after Cd2+ exposure to levels equivalent to expression driven by pCaMV35S (Figure (Figure4C).4C). Removal of plants from the Cd2+ containing nutrient solution caused a rapid drop in mRFP1 accumulation, with mRFP1 levels returning to those observed prior to Cd2+ exposure, after 48 h recovery (Figure (Figure4C).4C). Again, all three-promoter sizes gave similar responses. Cd2+ treatment also produced a transient accumulation of mRFP1 in shoots after 24 h exposure (Figure (Figure4D),4D), as observed during Ni2+ exposure (Figure (Figure4B).4B). Unlike Ni2+ and Cd2+ exposure, Zn2+ treatment produced no significant alteration in mRFP1 accumulation in either root or shoot tissue (Figure. (Figure.4E4E &4F). Elemental analysis of the nutrient solutions during the Ni2+, Cd2+ and Zn2+ experiments confirmed that concentrations of Ni2+, Cd2+ and Zn2+ did not vary significantly in the solution during the course of the experiments (data not shown).

Response of the 983 bp promoter element to other abiotic stresses

The 983 bp promoter region, which was found to be sufficient for expression in response to Cd2+ and Ni2+, was also tested for its ability to activate transcription when seedlings were exposed to other abiotic stresses including cold, heat, NaCl and H2O2. Five-day-old B. juncea seedlings stably transformed with p (1.0) BjMTP1::GUSPlus were exposed to a cold (4°C) or heat (37°C) shock, and also 100 mM NaCl, or H2O2 (5 μM, 10 μM, 100 μM 500 μM and 1 mM) after which GUS activity was assayed. There were no significant increases in GUS activity compared to the untreated seedlings for any of the treatments (Table (Table11).

Table 1
Different abiotic stress responses of 983 bp promoter element of BjMTP1

Putative regulatory elements in the BjMTP1 promoter region

A search for putative regulatory DNA elements within the 983 bp promoter region of BjMTP1 was performed using the PLACE [18] and PlantCARE databases [19] (Figure (Figure5).5). DNA regulatory motifs such as the CCAAT boxes, ABRE (Abscisic Acid Response Element), bZIP, G box, and several pathogen responsive elements such as W box, EIRE, SEBF motif, GCC box, G box coupler and MYB core elements were found. However, no known metal regulatory elements such as MREs which are known to mediate Zn2+ and Cd2+ specific transcriptional activation of metallothionine genes in mammals were found [20-22]. Considering that AtMTP1 appears not to be regulated by Cd2+ [4] and BjMTP1 is (Figure (Figure1,1, ,2,2, ,3,3, ,4),4), we compared the 983 bp BjMTP1 promoter region with a similar region of the A. thaliana AtMTP1 sequence upstream of the transcriptional start site (35715 bp to 36698 bp of A. thaliana chromosome 2 clone F19D11). Even though both promoter regions had many known regulatory elements in common, namely bZIP, G box, W box, EIRE box and MYB core element, the BjMTP1 promoter region also has several unique regulatory elements, namely ABRE and pathogen related SEBF motif, GCC box and G box coupler elements (Figure (Figure5).5). The core sequence of the metal regulatory element [MRE-TGCRCNC [22]] found in mammals (mouse), is present in the full 1786 bp upstream region of BjMTP1 with a single base pair difference (TGCACTG). However, because this motif is not present in the 983 bp promoter region sufficient for Cd2+ and Ni2+ regulation (Figure (Figure2,2, ,3,3, ,4),4), this MRE is unlikely to play a role in the Cd2+ and Ni2+ transcriptional regulation of BjMTP1.

Figure 5
Regulatory motif analysis of a 983 bp sequence upstream of the BjMTP1 translational start site was done region using PLACE and PlantCARE databases. Regulatory motif analysis was also done for similar sequences upstream of the transcriptional start sites ...

Localization of BjMTP1 expression to root xylem parenchyma

Our results demonstrate that a 983 bp region upstream of the translational start site of BjMTP1 is sufficient to drive strong root expression of GUS and mRFP1 in response to Cd2+ or Ni2+ treatment (Figure (Figure2,2, ,3,3, ,4).4). However, in order to help understand the function of BjMTP1, it is also important to identify which root tissues are expressing BjMTP1 during the response to Cd2+ or Ni2+ exposure. Sections from the main root and intact lateral roots of four-week-old B. juncea plants expressing mRFP1 in response to Ni2+ were analyzed by epifluorescence and light microscope (Figure (Figure6).6). Sections were taken from the top of the main root as well as 1.5 cm from the root tip, and the morphology of the roots examined (Figure. (Figure.6A6A &6B). The main root has clearly undergone secondary growth. The epidermis found in the primary roots has been replaced in 4-week-old roots by periderm produced by the cork cambium. Within the periderm lies the pericycle, and the cambial zone which gives rise to the secondary phloem and secondary xylem. The secondary xylem parenchyma, produced by vascular cambium, was observed surrounding the secondary xylem vessels. The presence of diarch xylem at the center of the root section is a characteristic of the Brassicaceae family (personal communication G. Myer, South Dakota State University). Sections taken 1.5 cm from the tip of the main root were observed to have similar root architecture to sections taken from the top of the root. After exposure to Ni2+ mRFP1 fluorescence was observed to be specifically localized in the secondary xylem parenchyma tissues that surround the secondary xylem (Figure. (Figure.6C6C &6D). Fluorescence from mRFP1 was also present in the periderm (Figure. (Figure.6C)6C) but no significant fluorescence was observed in other root tissues. In the lateral roots, mRFP1 fluorescence was clearly evident in the vascular region (Figure. (Figure.6E6E and and6F).6F). After Ni2+ exposure no fluorescence was observed in roots from plants identified as null segregants for the reporter construct even after longer (6 s) exposures, compared to the shorter (100 ms) exposure for Ni2+-treated transgenic plants [see Additional file 2]. Cd2+ treated roots gave an equivalent expression pattern to that of Ni2+ treated plants [see Additional file 2]. In both Ni2+ and Cd2+ treated roots there was no difference in the pattern of mRFP1 accumulation between sections taken from the top of the main root and its tip. Furthermore, mRFP1 expression was localized in the secondary xylem parenchyma tissues when expressed from the 983, 1,561 or 1,786 bp promoter regions. The strong accumulation of mRFP1 observed in the vascular tissue of intact lateral roots (Figure. (Figure.6E6E &6F) is also consistent with the secondary xylem parenchyma localization observed in the root cross-sections. Cross-sections of roots prepared from Ni2+ exposed plants transformed with the GUSplus reporter gene also revealed strong GUS expression in the secondary xylem parenchyma surrounding the secondary xylem (Figure. (Figure.6G),6G), similar to that observed for mRFP1 expression (Figure. (Figure.6C6C &6D). Secondary xylem parenchyma localization was also observed in plants expressing a EYFP reporter driven by the 983 bp promoter region [see Additional file 2].

Figure 6
Microscopic analysis of roots from T2 homozygous transgenic plants (p BjMTP1::mRFP1 and GUSPlus) after exposure to 50 μM Ni2+ for 48 h. Images of cross sections taken from the top of the main root under bright field illumination, using diascopic ...


Here we establish that mRNA levels of BjMTP1 in B. juncea are transcriptionally regulated in response to Cd2+ and Ni2+, with maximal expression in the root xylem parenchyma cells. We identify a 983 bp DNA fragment, within the total 1,786 bp DNA sequence upstream of the BjMTP1 translational start site, which is sufficient for this transcriptional regulation, which appears specific to stress induced by Cd2+ and Ni2+. BjMTP1 promoter activity in response to Ni2+, Cd2+ and Zn2+ was assessed at concentrations that span a similar range of toxicities from mild to serve. Over these similar ranges of metal-induced stress only Ni2+ and Cd2+ were observed to elicit a transcriptional response from the BjMTP1 promoter, with Zn2+ induced stress having no significant effect. Other forms of abiotic stress including cold, heat or NaCl also produced no significant transcriptional response. Transcriptional activation of BjMTP1 promoter by Cd2+ and Ni2+ is also not an indirect response to oxidative stress, since this promoter region is not activated by direct exposure to H2O2.

Our results are consistent with the observation in A. thaliana that the homologue AtMTP1 is also not regulated by Zn2+ [2-4,8]. However, our observation that BjMTP1 expression is transcriptionally regulated by Cd2+ and Ni2+ is not consistent with that observed in A. thaliana, where AtMTP1 mRNA levels are unaffected by Cd2+ [4]. Our results suggests that rather than being a house-keeping gene involved in Zn2+ homeostasis as has been suggested in A. thaliana, in B. juncea BjMTP1 may be involved in the dynamic regulation of Zn homeostasis as part of the plant's response to Cd2+ and Ni2+ induced stress. We emphasize that our data does not suggest that the function of BjMTP1 is to transport Cd2+ or Ni2+, for which we have no evidence. However, increased expression of BjMTP1 under Cd2+ or Ni2+ stress may be required to adjust Zn homeostasis as a response to the stress imposed by exposure to Cd2+ or Ni2+. This is supported by our observation that expression of BjMTP1 promoter is dynamically regulated in response to these metals, rapidly increasing after exposure to Cd2+ and Ni2+, and rapidly returning back to basal levels after these metals are removed from the growth medium.

Though expression of the BjMTP1 promoter in response to Cd2+ and Ni2+ is highest in roots, expression was also observed in the vascular tissue of leaves, anthers and in the stigma. Expression of BjMTP1 in these tissues suggests that the BjMTP1 protein may also be involved in the plants response to Cd2+ and Ni2+ stress in leaves and inflorescences. Though transcriptional activation of the 983 bp promoter region in roots by Cd2+ or Ni2+ occurs nearly in a linear fashion with time of exposure and accumulation, shoot activation appears transient. After 24 h of metal exposure transcription of BjMTP1 reaches a maximum and then declines to baseline expression after 48 h. Such transient expression is intriguing considering that over the same time frame Ni2+ accumulates linearly in shoots. The different expression patterns of BjMTP1 promoter in roots and shoots imply that this protein plays different roles in the plant's coordinated response to Cd2+ and Ni2+ exposure, though what these roles are remain unclear at this time.

In five-day-old seedlings of B. juncea expression of BjMTP1 promoter in response to Cd2+ and Ni2+ occurs throughout the seedlings, though is especially localized to the root and shoot-root transition zone. Though the reasons for stronger expression BjMTP1 promoter in the shoot-root transition zone are not known, this type of expression pattern has been observed previously for several proteins, including naphthylphthalmic acid (NPA) associated amino peptidases, glutathione S-transferase ATGSTF2, the auxin transporter PIN2, and PGP4 an ABC type transporter [23-26].

When compared to A. thaliana, the unique elements present in the BjMTP1 promoter region, including ABRE, SEBF motif, GCC box and G box coupler elements all have known functions in ABA signaling [27] or pathogen related stress [28-30]. However, none of these promoter elements have been established to play a role in signaling Cd2+ or Ni2+ stress. The elements responsible for regulation of BjMTP1 expression in response to Cd2+ and Ni2+ remain to be identified. This study is the first to identify transcriptional regulation and tissue localization of BjMTP1. However, further work is needed to understand the functional role of BjMTP1 in B. juncea's response to Ni2+ and Cd2+.


Here we conclude that a 983 bp DNA fragment upstream of the BjMTP1 translational start site is sufficient for the specific activation by Ni2+ and Cd2+ of BjMTP1 expression primarily in roots. Activation of expression by both metals in roots is primarily localized to the xylem parenchyma cells. This study is the first to identify specific Ni2+ and Cd2+ transcriptional regulation and tissue localization of BjMTP1 and supports the conclusion that BjMTP1 is involved in the response of B. juncea to Ni2+ and Cd2+ exposure.


Plant material

Indian mustard (Brassica juncea) seeds (accession no. 426308) were obtained from the North central regional plant introduction station (Ames, IA) Brassica juncea seeds (30 seeds) were germinated and grown in 800 mL of continuously aerated distilled water as described in [16]. Seedlings were maintained in the dark at 21°C for 5 days, and the water changed on every third day. Brassica juncea plants were also grown hydroponically in 8 L of aerated 0.1× Hoagland's medium [31]., changed weekly, for four weeks with 16 h light (150 μmol m -2 s-1) at 25° C. All transgenic plants used in the study were homozygous for the transgene.

Cloning of MTP1 genomic DNA

Genomic DNA was isolated from 10-day-old B. juncea, B. nigra and B. campestris seedlings using a DNeasy plant mini kit (Qiagen, Valencia, CA). Taking advantage of the fact that AtMTP1 contains no introns, we isolated full length BjMTP1 cDNA by PCR using 5'-ATGGAGTCTTCAAGTCCCCA- 3'(forward primer) and 5'-TAGAGCGCTCGATTTGTAT-3' (reverse primer) primers based on the AtMTP1 sequences. After obtaining genomic sequences 5' of BjMTP1 by genome walking (see below) BjMTP1, BnMTP1 and BcMTP1 genomic DNAs were reamplified using forward primer 5'- ATGGCGTATTCAAGCCCCCAACG- 3' and reverse primer 5'- GCTCTAGAGCGCTCGATTTGTATGG -3' designed based on the sequence of BjMTP1. Conditions used in all the PCR reactions are as follows: initial denaturation 94°C followed by 30 cycles of 94° C 30 sec, 55° C 40 sec, 72° C 1 min and 30 sec and final extension at 72° C for 10 min. PCR products was cloned into the pGEM T-Easy vector system and sequenced using Big dye terminator v 3.0 method (Applied Biosystems Foster city, CA) with universal M13 primers.

Analysis of BjMTP1 mRNA expression in five day old seedlings

For metal treatment five-day-old dark grown seedlings were transferred to distilled water containing 25 μM Ni2+, 75 μM Zn2+ or 5 μM Cd2+ and incubated for a further 48 h in the dark with aeration. After metal treatment seedlings were washed in distilled water before proceeding to further analysis. Three independent replicate samples were used for all analyses. Metal concentrations were chosen based on the concentrations that produced the maximal increase in GUS activity in transgenic B. juncea containing a BjMTP1 promoter::GUS construct (see below).

Total RNA from metal exposed seedlings was isolated using the RNeasy mini kit (Qiagen, Valencia, CA) using the DNase digestion step to reduce DNA contamination. cDNA was reverse transcribed using 4 μg of total RNA and 200 U Superscript III reverse transcriptase (Invitrogen, CA) primed with 100 ng of random hexamers (Invitrogen life technologies, Carbsbad, CA), and the cDNA diluted to 2.6 ngμL-1. Real time quantitative PCR was done as previously described [32]. BjACTIN2 was used as a normalization control for the relative quantification of transcript levels. Since the B. juncea ACTIN2 gene sequence was not available A. thaliana ACTIN2 primers (forward primer-5'- AAGATCTGGCATCACACTTTC- 3', reverse primer-5'-TAGTCAACAGCAACAAAGGAG- 3') were used to amplify a 529 bp homolog from B. juncea. For qRT-PCR primers were designed to generate ~100 bp products using Primer Express v. 2.0 software (Applied Biosystems, Foster City, CA, USA). Primers used for qRT-PCR were as follows: BjACTIN2 forward primer-5'-GAGGATGGCATGTGGAAGAGA- 3', reverse primer- 5' -GTGCTGGATTCTGGTGATGGT- 3', BjMTP1 forward primer- 5'-TGCGGCTTCTCAGATCTCAA- 3' and reverse primer-5'-TGCGCATGGAGGCATTG- 3'. Quantitative RT- PCR was performed on an ABI Prism 7000 Sequence Detection System (Applied Biosystems Foster City, CA, USA), following the manufacturers recommendations, and optimized primer concentrations were selected based on denaturing curve analysis and the fewest cycles needed to cross the critical threshold (Ct). Four reactions were done per biological sample and three independent replicate samples per treatment were used. SYBR Green PCR Master Mix (Applied Biosystems) was used to detect cDNA amplification. Data was analyzed using the SDS software (Applied Biosystems version 1.0), following the method of Livak and Schmittgen [33]. Ct values were determined based on efficiency of amplification. The mean Ct values were normalized against the corresponding BjACTIN2 Ct values and calculated as (Ct BjMTP1- Ct BjACTIN2). The relative expression of BjMTP1 was calculated as fold induction from untreated seedlings using the 2-ΔΔCt method (ΔΔCt = (CtBjMTP1-CtBjACTIN2) metal treated – (CtBjMTP1 - CtBJACTIN2) untreated [33]). The data is presented as fold change in BjMTP1 gene expression (normalized to BjACTIN2) relative to the untreated control seedlings. For untreated control samples 2-ΔΔCt is one since ΔΔCt is zero. The final standard error was estimated by evaluating the 2-ΔΔCt term using ΔΔCt plus standard deviation and ΔΔCt minus the standard deviation [33].

BjMTP1 promoter::report gene construction

For the isolation of the 5' sequence upstream of the BjMTP1 translational start site we used a Universal Genome Walker kit (Clontech, Mountain View, CA) following the manufacturer's protocol. First round of DNA fragment amplification used BjMTP1 gene specific primers, GSP1 5'-GAAGAAAGCACGACAAGTCTGGCAAGTTTA-3' and GSP2 -5'- CGTGCTTTCTTCAACGGCTTTGCTGC- 3' (nested), located (+) 49 to (+) 78 bp and (+) 3 to (+) 31 bp relative to the translational start site. For second round amplification primers were 5'-CTGCTAGCTTCTTCCTGCAATCATAT-3' and 5'-ACCTGTAGTAATCAACCTCAGTTACC-3 (nested) located (-) 1302 to (-) 1328 bp and (-)1337 to (-) 1357 bp relative to translational start site. PCR amplified products were cloned into either pGEM T-Easy vector system (Promega Corporation, Madison, WI) or PCR-XL-TOPO vector (Invitrogen Life Technologies, Carbsbad, CA). Cloned constructs were transformed into chemically competent E. coli Top10 F- cells (Invitrogen Life Technologies, Carbsbad, CA). Positive clones were sequenced using Big dye terminator v 3.0 method (Applied Biosystems Foster city, CA) with universal M13 primers. DNA sequences were analyzed by BlastN [34] and known regulatory elements identified using PLACE [18] and PlantCARE [19]. Putative eukaryotic promoter analysis was done using BGDP, a neural network eukaryotic promoter prediction program [35]. BjMTP1 promoter sequence has been submitted to Genbank (#EF128447).

The GUSPlus gene was PCR amplified from pCambia 1305.1 binary vector using high fidelity Platinum TAQ DNA polymerase (Invitrogen life technologies, Carlsbad, CA) and gene specific primers complementary to the GUSPlus gene. The sense and antisense primers contained engineered EcoRI and BamHI sites, respectively. The GUSPlus primers used were: GUSPlus-BamHI-5'-CGGGATCCCATGGTAGATCTGAGGGTAAATTTCTAGT- 3', GUSPlus EcoRI -5'-CGGAATTCTCACACGTGATGGTGATGGTGATGGCTAGC- 3'. PCR products were cloned into pGEM T-Easy vector. The cloned PCR products were chemically transformed into E. coli DH5α, positive clones digested with BamHI and EcoRI and the released cDNAs cloned into the CaMV35S cassette-pUC19 [36] using the same restriction enzyme sites. The insertion of the cDNA product in the correct orientation was confirmed by PCR using promoter specific and 35S PolyA tail specific primers (5'-ATAAGAATGCGGCGATATCGATATCGATCTGGATTTTAGTA-3'), and further confirmed by sequencing. Using unique EcoRV sites the entire promoter cassettes were cloned into pGreen 0229 binary vector containing the bar gene as a selectable marker. mRFP1 [37] was directly isolated from the pRSET B vector and cloned into CaMV35S cassette using BamHI-EcoRI sites.

Based on the previously identified sequence information, different sizes of BjMTP1 promoter regions were PCR amplified using high fidelity platinum Taq DNA polymerase with 5' PstI- 3' BamHI promoter specific primers. The primers used were Bj 983 bp 5' PstI 5'-AACTGCAGAGTTTCCATTTTTGTTTTCGTGCTAAATAA-3', Bj1561 bp 5' PstI-5'-AACTGCAGTGCACTGATGAAGTTCCGGATGAAGAGGAA-3', Bj 1786 bp 5' PstI-5'-AACTGCAGACAGACAAAACCAGTTTCTTCAGTCCGGGA-3' and Bj rev BamHI-5'-CGGGATCCTCTGAAAAGAAAAAAATCAGAGAAAGTTCA-3'. The PCR amplified BjMTP1 promoter regions were cloned into PCR-XL-TOPO vector. Positive clones containing PCR-XL-TOPO: BjMTP1 promoter regions were digested with PstI and BamHI and the released DNA cloned into pGreen 0229 containing specific reporter gene cassettes outlined above, after removing the CaMV35S promoter from the vector by PstI-BamHI digestion. All the cloned promoter regions (983 bp, 1,561 bp and 1,786 bp) contained the respective 5' UTR of the BjMTP1 gene and all the constructs contained only the start codon from their respective reporter genes. The ligated constructs were transformed into E. coli DH5α. Positive clones were identified by PCR using a combination of promoter specific and reporter gene specific primers and further confirmed by sequencing. All the pGreen constructs were mixed with pSoup plasmid DNA and transformed into electro competent disarmed Agrobacterium tumefaciens GV3101. Positive clones were selected by colony PCR.

Plant transformation and regeneration

Transgenic B. juncea plants were obtained by tissue culture based on a previously established protocol (personal communication Thomas Leustek, Rutgers University). Briefly, petioles were excised from cotyledons of five-day-old in vitro grown seedlings on agar solidified half strength MS medium [38] and cultured in MS medium with 3 % (w/v) sucrose, 2.5 g L-1 Gelrite, 2 mg L -1 6-benzylaminopurine, and 0.1 mg L-1 naphthalene acetic acid under a 16 hour photoperiod (100 μmol m -2 s -1) at 25°C for 2 days. Petioles were transformed with A. tumefaciens GV3101 harboring pGreen 0229 containing BjMTP1 promoter reporter gene constructs.Agrobacterium tumefaciens strain GV3101 carrying the pGreen vectors were grown for 48 h in 30 mL liquid YEP medium containing 1 g L-1 yeast extract, 5 g L-1 beef extract, 5 g L-1 bacto-peptone, 5 g L-1 sucrose, 0.5 g L-1 MgSO4.7H2O and 100 mg L-1 kanamycin in a 28°C shaker at 250 rpm until the culture reached an OD600 of 0.7. Bacteria were harvested by centrifugation and the bacterial pellet resuspended in 30 mL MS liquid medium. Petioles were incubated with the A. tumefaciens suspension for 20 min, blotted dry using sterile filter paper and transferred to freshly prepared tobacco (BY2 cell line) feeder layer plates. After 48 h incubation in the dark, petioles were rinsed in medium containing MS salt, 3% (w/v) sucrose, and 500 mg L-1 carbencillin for 40 min. The petioles were cultured on MS medium containing 2 mg L-1 TDZ and 0.1 mg L-1 IAA with 500 mg L-1 carbenicillin for three to four weeks under 16 h photoperiod (100 μmol m -2 s -1). Roots were induced from regenerated shoots in solid MS medium containing 2 mg L-1 indole-3- butyric acid. Plantlets were later transferred to soil for further growth. Putative transformants were selected based on their ability to grow in regeneration medium containing 3 mg L-1 glufosinate ammonium (active ingredient of Basta). Transformants were also analyzed for the presence of the introduced DNA constructs using PCR. T2 and T3 homozygous lines were selected by spraying BASTA (8 mg L-1) on 15-day old plants with fully expanded first leaves (total of 4 applications on every third day), and further confirmed by PCR.

Analysis of BjMTP1 promoter activity

For analysis of metal regulated promoter activity five-day-old dark grown seedlings were treated with various concentrations of Ni2+, Cd2+ and Zn2+ in distilled water for 48 h in the dark. For heat shock similar seedlings were incubated at 37°C for 2 h as described in [39]. Cold shock was given at 4°C for 4 h following the method of [40]. For salt treatment seedlings were treated with 100 mM NaCl as described in [41] for 24 h in the dark with aeration. Seedlings were also exposed to H2O2 at 5 μM, 10 μM, 50 μM, 100 μM, 500 μM and 1 mM H2O2 for 24 h, changing solutions every 12 h. For metal treatment in mature B. juncea four-week-old hydroponically grown plants were transferred to aerated 0.1 × Hoagland's solution containing 50 μM Ni2+, 50 μM Zn2+ or 5 μM Cd2+. To maintain a constant Cd2+concentration throughout the experiment the hydroponic media was replaced at 12 h intervals. Because of the higher initial concentration of Ni2+ and Zn2+ their concentrations were found to not significantly change during the experiment, as analyzed by ICP-MS (data not shown). For recovery experiments plants were transferred to aerated 0.1 × Hoagland's solution lacking either Ni2+, Cd2+ or elevated Zn2+. Root and shoot samples were also analyzed for Ni2+ accumulation by ICP-MS. Three independent replicate samples were used for each analysis. For total GUS activity tissue samples were homogenized in liquid nitrogen and suspended in 200 μL of extraction buffer (50 mM NaHPO4 pH 7.0, 2 mM DTT, 10 mM Na2 EDTA, 0.1 % (w/v) sodium lauryl sarcosine and 0.1 % (v/v) Triton X- 100; [42]) and the soluble protein fraction collected after centrifugation at 10,000 × g. Quantitative fluorometric analysis of GUS enzymatic activity was carried out according to [42]. Fluorescence was measured using a luminescence spectrometer (PerkinElmer model # LS 55, Life and Analytical Sciences Boston, MA) after 60 min incubation with the GUS substrate. Each assay was performed using three independent replicate samples. Total protein content was determined using a BCA protein assay kit (Pierce Biotechnology, Rockford, IL). GUS activity data is expressed as nmoles of 4-methylumbelliferone(MU)min-1 mg-1 of extracted protein. Histochemical GUS analysis of B. juncea tissues was performed based on a standard protocol [43]. GUS localization was analyzed using an Olympus Vanox light microscope (Olympus America Inc. Melville, NY). For photography a SPOT-RT digital camera (Diagnostic instruments Sterling Heights, MI) attached to the microscope was used. For quantitative fluorometric assay of mRFP1 in tissue samples 100 mg fresh weight of tissue was homogenized in liquid nitrogen and suspended in 200 μL of the PBS buffer (10 mM potassium phosphate buffer, 140 mM NaCl, pH 7.4) containing 1 mM DTT, and the soluble protein fraction collected after centrifugation at 10,000 × g. The relative mRFP1 emission (607 nm) in the samples was measured using a luminescence spectrometer (model # LS 55 PerkinElmer Life and Analytical Sciences Boston, MA) after excitation at 584 nm. Each assay was performed using three independent replicate samples. For epifluorescence microscopy tissues were immediately incubated in PBS buffer and hand sections prepared for localization of mRFP1 expression. Epifluorescence was observed using Nikon E 800 compound microscope equipped with Rhodamine – Texas red (exciter λ 560 ± 20, dichroic λ Q 585 LP and emitter λ 610 LP) filter. For photography SPOT-RT digital camera attached to the microscope was used.

Metal Toxicity Measurements

Metal toxicity measurements were done using K+ leakage in five-day-old seedlings containing p(1.0)BjMTP1::GUSPlus, following a method adapted from [44]. After metal treatment seedlings (n = 5) were removed and placed in 10 mL of distilled water for 60 min, the solution filtered through a 0.2 μm filter and K+ measured using ICP-MS. Untreated seedlings were used as a control. Seedlings used for K+ efflux were dried at 68°C for 48 h and K+ leakage expressed on a dry weigh basis.

Inductively Coupled Plasma – Mass Spectroscopy

Plant tissue sample were washed once in 18 MΩ, dried overnight at 90°C weighed and digested in concentrated HNO3 acid (OmniTrace, EM) at 110°C for 4 h. Ni, Cd and Zn were quantified in the samples using an ICP-MS (Elan DRCe, PerkinElmer) following our published methods [45]. K concentration in K+-leakage assays were measured directly in the assay solution using ICP-MS (Elan DRCe, PerkinElmer).

Authors' contributions

DES conceived the work and guided the experiments; BM was primarily responsible for carrying them out with BY contributing to the cloning. All authors have read and approved the final manuscript

Supplementary Material

Additional file 1:

Dendrogram of plant MTP1 protein-coding DNA sequencealignments using Neighbor-Joining. A phylogenetic analysis showing the relationships between the plant MTP1 protein-coding DNA sequences.

Additional file 2:

Tissue localization of MTP1 expression in B. juncea. A microscopic analysis of root cross-sections and lateral roots from 4-week-old B. juncea transformed with p BjMTP1::mRFP1 or p BjMTP1::EYFP after exposure to 5 μM Cd2+ or 50 μM Ni2+ for 48 h.


This work was supported by the US Department of Energy (DE-FG02-01ER86135) and the Indiana 21st Century Research and Technology Fund. The authors wish to thank Brett Lahner for ICP-MS analysis and Thomas Leustek of Rutgers University for providing the regeneration/transformation protocol for B. juncea. The authors also wish to thank Gerald Myers of SDSU for his help in B. juncea root anatomy, Roger Tsien of UCSD for pRSETB (mRFP1) and Jeff Gustin, Thomas Sors and Elena Yakubova for their helpful advice. We would also like to thank Edenspace Systems Corporation for useful discussions.


  • Kramer U. MTP1 mops up excess zinc in Arabidopsis cells. Trends Plant Sci. 2005;10:313–315. doi: 10.1016/j.tplants.2005.05.008. [PubMed] [Cross Ref]
  • Van der Zaal BJ, Neuteboom LW, Pinas JE, Chardonnens AN, Schat H, Verkleij JAC, Hooykaas PJJ. Overexpression of a novel Arabidopsis gene related to putative zinc-transporter genes from animals can lead to enhanced zinc resistance and accumulation. Plant Physiol. 1999;119:1047–1056. doi: 10.1104/pp.119.3.1047. [PMC free article] [PubMed] [Cross Ref]
  • Kobae Y, Uemura T, Sato MH, Ohnishi M, Mimura T, Nakagawa T, Maeshima M. Zinc transporter of Arabidopsis thaliana AtMTP1 is localized to vacuolar membranes and implicated in zinc homeostasis. Plant Cell Physiol. 2004;45:1749–1758. doi: 10.1093/pcp/pci015. [PubMed] [Cross Ref]
  • Desbrosses-Fonrouge AG, Voigt K, Schroder A, Arrivault S, Thomine S, Kramer U. Arabidopsis thaliana MTP1 is a Zn transporter in the vacuolar membrane which mediates Zn detoxification and drives leaf Zn accumulation. FEBS letters. 2005;579:4165–4174. doi: 10.1016/j.febslet.2005.06.046. [PubMed] [Cross Ref]
  • Bloß T, Clemens S, Nies DH. Characterization of the ZAT1p zinc transporter from Arabidopsis thaliana in microbial model organisms and reconstituted proteoliposomes. Planta. 2002;214:783–791. doi: 10.1007/s00425-001-0677-1. [PubMed] [Cross Ref]
  • Persans MW, Nieman K, Salt DE. Functional activity and role of cation- efflux family members in Ni hyperaccumulation in Thlaspi goesingense. Proc Natl Acad Sci USA. 2001;98:9995–10000. doi: 10.1073/pnas.171039798. [PMC free article] [PubMed] [Cross Ref]
  • Assuncao AGL, Martins PD, De Folter S, Vooijs R, Schat H, Aarts MGM. Elevated expression of metal transporter genes in three accessions of the metal hyperaccumulator Thlaspi caerulescens. Plant Cell Environ. 2001;24:217–226. doi: 10.1111/j.1365-3040.2001.00666.x. [Cross Ref]
  • Drager DB, Desbrosses-Fonrouge AG, Krach C, Chardonnens AN, Meyer RC, Saumitou-Laprade P, Kramer U. Two genes encoding Arabidopsis halleri MTP1 metal transport proteins co-segregate with zinc tolerance and account for high MTP1 transcript levels. Plant J. 2004;39:425–439. doi: 10.1111/j.1365-313X.2004.02143.x. [PubMed] [Cross Ref]
  • Blaudez D, Kohler A, Martin F, Sanders D, Chalot M. Poplar metal tolerance protein 1 confers zinc tolerance and is an oligomeric vacuolar zinc transporter with an essential leucine zipper motif. Plant Cell. 2003;15:2911–2928. doi: 10.1105/tpc.017541. [PMC free article] [PubMed] [Cross Ref]
  • Kim D, Gustin JL, Lahner B, Persans MW, Baek D, Yun DJ, Salt DE. The plant CDF family member TgMTP1 from the Ni/Zn hyperaccumulator Thlaspi goesingense acts to enhance efflux of Zn at the plasma membrane when expressed in Saccharomyces cerevisiae. Plant J. 2004;39:237–251. doi: 10.1111/j.1365-313X.2004.02126.x. [PubMed] [Cross Ref]
  • Oost EH, Brandenburg WA, Reuling TM, Jarvis CE. Lectotypification of Brassica rapa L., B. campestris L. and neotypification of B.chinensis L. (Cruciferae) Taxon. 1987;36:625–634. doi: 10.2307/1221858. [Cross Ref]
  • Axelsson T, Bowman CM, Sharpe AG, Lydiate DJ, Lagercrantz U. Amphidiploid Brassica juncea (2000) Genome. 2000;43:679–688. doi: 10.1139/gen-43-4-679. [PubMed] [Cross Ref]
  • Kumar PBAN, Dushenkov V, Motto V, Raskin I. Phytoextraction: The use of plants to remove heavy metals from soils. Environ Sci Technol. 1995;25:1232–1238. doi: 10.1021/es00005a014. [PubMed] [Cross Ref]
  • Salt DE, Smith RD, Raskin I. Phytoremediation. Annu Rev Plant Physiol Plant Mol Biol. 1998;49:643–668. doi: 10.1146/annurev.arplant.49.1.643. [PubMed] [Cross Ref]
  • Salt DE, Prince RC, Pickering IJ, Raskin I. Mechanisms of cadmium mobility and accumulation in Indian mustard. Plant Physiol. 1995;109:1427–1433. [PMC free article] [PubMed]
  • Salt DE, Pickering IJ, Prince RC, Gleba D, Dushenkov S, Smith R, Raskin I. Metal accumulation by aquacultured seedlings on Indian mustard. Environ Sci Technol. 1997;31:1636–1644. doi: 10.1021/es960802n. [Cross Ref]
  • Ebbs SD, Lasat MM, Brady DJ, Cornish J, Gordon R, Kochian LV. Phytoextraction of cadmium and zinc from a contaminated soil. J Environ Qual. 1997;26:1424–1430.
  • Higo K, Ugawa Y, Iwamoto M, Korenaga T. Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res. 1999;27:297–300. doi: 10.1093/nar/27.1.297. [PMC free article] [PubMed] [Cross Ref]
  • Lescot M, Dehais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouze P, Rombauts S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002;30:325–327. doi: 10.1093/nar/30.1.325. [PMC free article] [PubMed] [Cross Ref]
  • Brugnera E, Georgiev O, Radtke F, Heuchel R, Baker E, Sutherland GR, Schaffner W. Cloning, chromosomal mapping and characterization of the human metal-regulatory transcription factor MTF-1. Nucleic Acids Res. 1994;22:3167–3173. doi: 10.1093/nar/22.15.3167. [PMC free article] [PubMed] [Cross Ref]
  • Koizumi S, Suzuki K, Ogra Y, Yamada H, Otsuka F. Transcriptional activity and regulatory protein binding of metal-responsive elements of the human metallothionein-IIA gene. Eur J Biochem. 1999;259:635–642. doi: 10.1046/j.1432-1327.1999.00069.x. [PubMed] [Cross Ref]
  • Larochelle O, Stewart G, Moffat P, Tremblay V, Seguin C. Characterization of the mouse metal-regulatory-element-binding proteins, metal element protein-1 and metal regulatory transcription factor-1. Biochem J. 2001;353:591–601. doi: 10.1042/0264-6021:3530591. [PMC free article] [PubMed] [Cross Ref]
  • Murphy A, Hoogner KR, Peer WA, Taiz L. Identification, purification and molecular cloning of N-1-Naphthylphthalmic acid-binding plasma membrane-associated aminopeptidases from Arabidopsis. Plant Physiol. 2002;128:935–950. doi: 10.1104/pp.010519. [PMC free article] [PubMed] [Cross Ref]
  • Smith AP, Neurizadeh SD, Peer WA, Xu JH, Bandyopadhyay A, Murphy AS, Goldsbrough PB. Arabidopsis ATGSTF2 is regulated by ethylene and auxin, and encodes a glutathione S-transferase that interacts with flavanoids. Plant J. 2003;36:433–442. doi: 10.1046/j.1365-313X.2003.01890.x. [PubMed] [Cross Ref]
  • Peer WA, Bandyopadhyay A, Blakeslee JJ, Makam SN, Chen RJ, Masson PH, Murphy AS. Variation in expression and protein localization of the PIN family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin transport in Arabidopsis thaliana. Plant Cell. 2004;16:1898–1911. doi: 10.1105/tpc.021501. [PMC free article] [PubMed] [Cross Ref]
  • Terasaka K, Blakeslee JJ, Titapiwatanakun B, Peer WA, Bandyopadhyay A, Makam SN, Lee OR, Richards EL, Murphy AS, Sato F, Yazaki K. PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin transport in Arabidopsis thaliana roots. Plant Cell. 2005;17:2922–2939. doi: 10.1105/tpc.105.035816. [PMC free article] [PubMed] [Cross Ref]
  • Choi HI, Park HJ, Park JH, Kim S, Im MY, Seo HH, Kim YW, Hwang I, Kim SY. Arabidopsis Calcium-Dependent Protein Kinase AtCPK32 Interacts with ABF4, a Transcriptional Regulator of Abscisic Acid-Responsive Gene Expression, and Modulates Its Activity. Plant Physiol. 2005;139:1750–1761. doi: 10.1104/pp.105.069757. [PMC free article] [PubMed] [Cross Ref]
  • Hwang YS, Karrer EE, Thomas BR, Chen L, Rodriguez RL. Three cis-elements required for rice alpha-amylase Amy3D expression during sugar starvation. Plant Mol Biol. 1998;36:331–341. doi: 10.1023/A:1005956104636. [PubMed] [Cross Ref]
  • Boyle B, Brisson N. Repression of the defense gene PR-10a by the single-stranded DNA binding protein SEBF. Plant Cell. 2001;13:2525–2537. doi: 10.1105/tpc.13.11.2525. [PMC free article] [PubMed] [Cross Ref]
  • Chakravarthy S, Tuori RP, Dascenzo MD, Fobert PR, Despres C, Martin GB. The tomato transcription factor Pti4 regulates defense-related gene expression via GCC box and non-GCC box cis elements. Plant Cell. 2003;15:3033–3050. doi: 10.1105/tpc.017574. [PMC free article] [PubMed] [Cross Ref]
  • Hoagland DR, Arnon DI. The water-culture method for growing plants without soil. Calif Agric Exp Sta Circ. 1950;347:1–32.
  • Rider SD, Henderson JT, Jerome RE, Edenberg HJ, Romero-Severson J, Ogas J. Coordinate repression of regulators of embryonic identity by PICKLE during germination in Arabidopsis. Plant J. 2003;35:33–43. doi: 10.1046/j.1365-313X.2003.01783.x. [PMC free article] [PubMed] [Cross Ref]
  • Livak JL, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [PubMed] [Cross Ref]
  • Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search program. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [PMC free article] [PubMed] [Cross Ref]
  • Reese MG. Application of a time-delay neural network to promoter annotation in the Drosophila melanogaster genome. Comput Chem. 2001;26:51–56. doi: 10.1016/S0097-8485(01)00099-7. [PubMed] [Cross Ref]
  • Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM. pGreen: A versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol. 2000;42:819–832. doi: 10.1023/A:1006496308160. [PubMed] [Cross Ref]
  • Campbell RE, Tour O, Palmer AE, Steinbach PA, Baird GS, Zacharias DA, Tsien RY. A monomeric red fluorescent protein. Proc Natl Acad Sci USA. 2000;99:7877–7882. doi: 10.1073/pnas.082243699. [PMC free article] [PubMed] [Cross Ref]
  • Murashige T, Skoog F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant. 1962;15:473–497. doi: 10.1111/j.1399-3054.1962.tb08052.x. [Cross Ref]
  • Matsuhara S, Jingu F, Takahashi T, Komeda Y. Heat- shock tagging: a simple method for expression of plant genome DNA flanked by T-DNA insertions. Plant J. 2000;22:79–86. doi: 10.1046/j.1365-313x.2000.00716.x. [PubMed] [Cross Ref]
  • Fowler S, Thomashow MF. Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell. 2002;14:1675–1690. doi: 10.1105/tpc.003483. [PMC free article] [PubMed] [Cross Ref]
  • Shi H, Quintero FJ, Pardo JM, Zhu JK. The putative plasma membrane Na+/H+ antiporter SOS1 controls long-distance Na+ transport in plants. Plant cell. 2002;14:465–477. doi: 10.1105/tpc.010371. [PMC free article] [PubMed] [Cross Ref]
  • Gallagher SR. Quantitation of GUS activity by fluorometry. In: Gallagher SR, editor. GUS Protocols. San Diego: Academic Press; 1992. pp. 47–60.
  • Rodrigues-Pousada RA, Rycke RD, Dedonder AW, Caeneghem VG, Almeida-Engler J, Van Montagu M, Straeten DVD. The Arabidopsis 1- Aminocyclopropane-1-Carboxylate Synthase Gene1 is Expressed during Early Development. Plant Cell. 1993;5:897–911. doi: 10.1105/tpc.5.8.897. [PMC free article] [PubMed] [Cross Ref]
  • Murphy AS, Eisinger WR, Shaff JE, Kochian LV, Taiz L. Early Copper-Induced Leakage of K+ from Arabidopsis Seedlings Is Mediated by Ion Channels and Coupled to Citrate Efflux. Plant Physiol. 1999;121:1375–1382. doi: 10.1104/pp.121.4.1375. [PMC free article] [PubMed] [Cross Ref]
  • Lahner B, Gong J, Mahmoudian M, Smith EL, Abid KB, Rogers EE, Guerinot ML, Harper JF, Ward JM, et al. Genomic scale profiling of nutrient and trace elements in Arabidopsis thaliana. Nat Biotechnol. 2003;21:1215–1221. doi: 10.1038/nbt865. [PubMed] [Cross Ref]

Articles from BMC Plant Biology are provided here courtesy of BioMed Central
PubReader format: click here to try


Save items

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...


  • Compound
    PubChem chemical compound records that cite the current articles. These references are taken from those provided on submitted PubChem chemical substance records. Multiple substance records may contribute to the PubChem compound record.
  • MedGen
    Related information in MedGen
  • Nucleotide
    Primary database (GenBank) nucleotide records reported in the current articles as well as Reference Sequences (RefSeqs) that include the articles as references.
  • Protein
    Protein translation features of primary database (GenBank) nucleotide records reported in the current articles as well as Reference Sequences (RefSeqs) that include the articles as references.
  • PubMed
    PubMed citations for these articles
  • Substance
    PubChem chemical substance records that cite the current articles. These references are taken from those provided on submitted PubChem chemical substance records.
  • Taxonomy
    Taxonomy records associated with the current articles through taxonomic information on related molecular database records (Nucleotide, Protein, Gene, SNP, Structure).
  • Taxonomy Tree
    Taxonomy Tree

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...