• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Cell Metab. Author manuscript; available in PMC Feb 1, 2008.
Published in final edited form as:
PMCID: PMC1899170
NIHMSID: NIHMS18013

An afferent vagal nerve pathway links hepatic PPARα activation to glucocorticoid-induced insulin resistance and hypertension

Summary

Glucocorticoid excess causes insulin resistance and hypertension. Hepatic expression of PPARα (Ppara) is required for glucocorticoid-induced insulin resistance. Here we demonstrate that afferent fibers of the vagus nerve interface with hepatic Ppara expression to disrupt blood pressure and glucose homeostasis in response to glucocorticoids. Selective hepatic vagotomy decreased hyperglycemia, hyperinsulinemia, hepatic insulin resistance, Ppara expression and phosphoenolpyruvate carboxykinase (PEPCK) enzyme activity in dexamethasone-treated Ppara+/+ mice. Selective vagotomy also decreased blood pressure, adrenergic tone, renin activity, and urinary sodium retention in these mice. Hepatic reconstitution of Ppara in nondiabetic, normotensive dexamethasone-treated Ppara null mice increased glucose, insulin, hepatic PEPCK enzyme activity, blood pressure and renin activity in sham-operated but not hepatic-vagotomized animals. Disruption of vagal afferent fibers by chemical or surgical means prevented glucocorticoid-induced metabolic derangements. We conclude that a dynamic interaction between hepatic Ppara expression and a vagal afferent pathway is essential for glucocorticoid induction of diabetes and hypertension.

Introduction

Insulin resistance, a potentially lethal metabolic disorder associated with diabetes, hypertension, and vascular disease, is poorly understood. Glucocorticoid excess, whether caused by exogenous administration, endogenous overproduction associated with Cushing’s syndrome, or accelerated conversion of inactive to active glucocorticoids in tissues (Masuzaki et al. 2001; Paterson et al. 2004) alters lipid metabolism and produces insulin resistance. Given the phenotypic similarities between glucocorticoid excess and insulin resistance caused by diet-induced obesity, defining how glucocorticoids cause insulin resistance is likely to be relevant to common obesity-related diseases like diabetes and hypertension. In mice, the development of diabetes and hypertension following chronic glucocorticoid exposure requires expression of the lipid-activated transcription factor PPARα in liver (Bernal-Mizrachi et al., 2003).

A member of the nuclear receptor superfamily (Berger and Moller, 2002), PPARα orchestrates the adequate provision of substrates for critical tissues such as the central nervous system in response to prolonged fasting. PPARα activation promotes fatty acid oxidation (Reddy, 2001), ketogenesis (Rodriguez et al., 1994), and gluconeogenesis (Bernal-Mizrachi et al., 2003; Koo et al., 2004; Patsouris et al., 2004). Fasted mice that are deficient in PPARα develop hypoglycemia and fatty liver (Kersten et al., 1999). The same phenotype develops in PPARα wild type mice when deprived of dietary and synthesized fat (Chakravarthy et al., 2005), highlighting the role of lipid in activation of the receptor. Physiological responses mediated by PPARα, like those occurring with fasting in the short-term, may become pathophysiological in the setting of long-term stressors such as obesity and glucocorticoid exposure. Consistent with this notion, two independent groups have reported that PPARα deficiency prevents glucose intolerance caused by diet-induced obesity (Guerre-Millo et al., 2001; Tjordman et al., 2001).

Maladaptive PPARα signaling is not limited to effects on glucose metabolism. PPARα deficiency also protects mice from hypertension induced by either high fat feeding (Tjordman et al., 2001) or glucocorticoids (Bernal-Mizrachi et al., 2003), suggesting that chronic activation of PPARα in mice initiates a cascade of events resulting in several detrimental components of insulin resistance. Species differences between mice and humans in terms of PPARα biology could limit the relevance of these mouse studies to human disorders. However, recent data indicate that PPARα activation in normal humans increases blood pressure (Subramanian et al., 2006), results that complement mouse studies implicating PPARα in blood pressure control. Exactly how PPARα activation affects both blood pressure and glucose is unknown.

The central nervous system integrates signals from peripheral sites like the liver to modulate blood pressure and glucose. Infusion of long chain fatty acids into the portal vein, a major conduit to the liver, has effects that suggest involvement of the central nervous system including increases in circulating levels of epinephrine and norepinephrine, elevated blood pressure, and accelerated hepatic glucose production (Benthem et al., 2000; Grekin et al., 1995; Grekin et al., 1997). Hepatic signals are likely transmitted to the central nervous system by the vagus nerve since vagal activity is increased by portal or jejunal infusion of lipids (Randich et al., 2001). To test the hypothesis that the vagus nerve mediates PPARα-dependent metabolic dysfunction induced by glucocorticoids, we studied the effects of selective hepatic branch vagotomy in Ppara+/+ and Ppara−/− mice as well as the effects of selective disruption of vagal afferents following chronic dexamethasone therapy.

Results

Selective Hepatic Vagotomy Reverses Insulin Resistance

In a series of experiments, Ppara+/+ (n=37) and Ppara−/− (n=37) mice were treated with dexamethasone (Dex) (1mg/kg) by IP injection every other day for 5 months followed by selective hepatic vagal nerve sectioning in Dex-treated Ppara+/+ mice (n=20) and Dex-treated Ppara−/− mice (n=20). An intraoperative photograph demonstrating the isolation of the hepatic branch of the vagus nerve is shown in Figure 1A. As a control, sham surgery (isolation of the nerve without resection) was performed on Dex-treated Ppara+/+mice (n=17) and Dex-treated Ppara−/− mice (n=17). As an additional control, separate cohorts of Ppara+/+ (n=26) and Ppara−/− (n=20) animals were treated with normal saline instead of Dex. Saline-treated mice also underwent either selective hepatic vagotomy or the sham procedure. Interventions were performed in five sequential experiments each yielding the same results. Consistent with previous results (Bernal-Mizrachi et al., 2003), there was no effect of chronic Dex treatment on body weight in either genotype (Supplemental Figure 1A, B). Metabolic studies were performed 3 weeks after surgery when animals recovered their body weight (Figure 1B) and food intake had returned to normal (Supplemental Figure 1C). Serum levels of alanine aminotransferase, a marker of liver inflammation, were normal 3 weeks after surgery (not shown).

Figure 1
Selective hepatic vagotomy reverses glucocorticoid-induced insulin resistance. (A) Operative field for selective nerve interruption. The liver is visible in the left upper quadrant. The esophagus, ventral trunk of the vagus nerve, and the hepatic branch ...

As expected (Bernal-Mizrachi et al., 2003), fasting levels of glucose and insulin were higher in Dex-treated Ppara+/+ as compared to Dex-treated Ppara−/− mice (Supplemental Table 1). There were no differences between genotypes in cholesterol, NEFA, triglycerides, body weight, or body composition at baseline or with Dex (Supplemental Table 1). Dex-treated Ppara+/+ mice had higher glucose levels during glucose tolerance testing as compared to Dex-treated Ppara−/− mice (Figure 1C). This glucose intolerance in Dex-treated Ppara+/+ mice was abolished by selective hepatic vagotomy but not sham surgery (Figure 1D). Glucose tolerance was unaffected by either procedure in Dex-treated Ppara−/− animals (Figure 1E). Fasting insulin levels were lower in Ppara+/+ animals after vagotomy as compared to sham surgery, but there were no effects on serum chemistries, body composition, or glucagon levels (Supplemental Table 2). Insulin levels at 30 min during glucose tolerance testing were also lower in vagotomized as compared to sham-operated Dex-treated Ppara+/+ mice (0.33 ± 0.07 vs. 0.70 ± 0.09 ng/ml, P = 0.04). Dex-treated Ppara+/+ mice became less hypoglycemic than Dex-treated Ppara−/− animals during insulin tolerance testing, indicating insulin resistance (Figure 1F). Vagotomy resulted in greater insulin responsiveness during insulin tolerance testing in Dex-treated Ppara+/+ mice as compared to sham surgery (Figure 1G). These effects of enhanced insulin sensitivity following vagotomy persisted for at least three months after surgery (not shown). Vagotomy had no effect in Ppara−/− mice (Figure 1H). Chronic saline injections had no effect on fasting serum chemistries, and glucose or insulin tolerance testing in either genotype (not shown).

Vagotomy Effects on Glucose Production and Ppara Expression

In hyperinsulinemic-euglycemic clamp experiments performed six weeks after surgery, endogenous glucose production was suppressed to a greater degree by insulin in vagotomized as compared to sham-operated Dex-treated Ppara+/+ mice (Figure 2C, left bars). There was no effect of vagotomy on saline-treated Ppara+/+ mice (Figure 2C, right bars). There were no significant effects on peripheral insulin sensitivity as measured by the clamp-determined rate of glucose disposal (Figure 2B). Enzyme activity for PEPCK, a key enzyme in glucoconeogenesis, was 42% lower in the livers of vagotomized Dex-treated as compared to sham-operated mice (Supplemental Figure 2A). Taken together, these results suggest that interruption of vagal nerve signaling blocks Dex-induced glucose intolerance in part by decreasing gluconeogenesis.

Figure 2
Effects of vagotomy on insulin sensitivity, hepatic gene expression, and reconstitution of PPARα in Pppar−/− mice

Selective hepatic vagotomy decreased Ppara expression in the liver, providing a potential mechanism for observed effects on glucose metabolism. Hepatic Ppara expression was ~six-fold lower in vagotomized Dex-treated as compared to sham operated Ppara+/+ animals (Figure 2D). Messenger RNA levels for acyl-CoA oxidase (Acox) and medium-chain acyl-CoA dehydrogenase (Acadam), known PPARα target genes, were decreased in vagotomized as compared to sham operated mice (Figure 2E, F), but there was no effect on the expression of the coactivator PGC-1α (Ppargc1), another modulator of gluconeogenesis (not shown).

Reconstitution of Hepatic Ppara Expression

When Ppara expression was reconstituted in the livers of normoglycemic Dex-treated Ppara−/− mice subjected to either vagotomy or sham surgery (see metabolic characteristics of these mice in Figure 1E, H), sham-operated animals had greater glucose excursions than vagotomized mice during glucose tolerance tests (Figure 2G). At 30 min after glucose injection, insulin levels were three-fold higher in sham-operated as compared to vagotomized animals (0.9 ± 0.2 vs. 0.3 ± 0.06 ng/ml, P < 0.04). Enzyme activity for PEPCK was ~75% lower in vagotomized Dex-treated Ppara−/− mice reconstituted with AdPPARα as compared to sham operated animals treated with the same virus (Supplemental Figure 2B). There was no effect on the glycemic response (Figure 2H) or insulin levels (not shown) when Ppara expression was reconstituted in the livers of saline-treated mice. Treatment with control virus has no effect in this model (Bernal-Mizrachi et al., 2003). PPARα protein has been detected in the central nervous system (Moreno et al., 2004) raising the possibility that central activation of this receptor affects responses in our model. However, AdPPARα treatment of Dex-treated PPARα null mice produces glucose intolerance associated with Ppara expression in liver but not whole brain, brainstem, or hypothalamus (or other tissues, Figure 2I). These data suggest that hepatic expression of Ppara (but not central nervous system Ppara expression) and an intact hepatic vagus nerve are required for the development of glucocorticoid-induced insulin resistance.

Intact Vagus Nerve is Required for Dex-induced Hypertension

With Dex treatment, both systolic and diastolic blood pressures were ~20 mm Hg higher in Ppara+/+ as compared to Ppara−/− mice (Figure 3A, left panel). Selective hepatic vagotomy in Dex-treated Ppara+/+ mice decreased systolic blood pressure by 10 mm Hg (P < 0.001) and diastolic pressure by 9 mm Hg (P < 0.01) (Figure 3A, middle panel). These differences detected by tail cuff determinations were confirmed invasively in anesthetized mice (Supplemental Figure 3A). There was no effect of vagotomy on blood pressure in Dex-treated Ppara−/− mice (Figure 3A, right panel) or in saline-treated mice of either genotype (Figure 3B). Blood pressure measurements were made three weeks after surgery when there was no difference between vagotomized and sham operated mice in sodium intake, water intake or urine output (Supplemental Figure 1D, F, G). Plasma renin activity and urinary catecholamine levels, critical determinants of renal sodium handling and blood pressure, decreased by ~half in Dex-treated Ppara+/+ mice after vagotomy compared with sham-operated animals (Table 1). Urinary sodium excretion increased three fold after vagotomy in Dex-treated Ppara+/+ mice (Table 1), consistent with less activity of the sympathetic nervous system and renin-angiotensin-aldosterone axis after selective hepatic vagotomy. There were no effects on serum leptin.

Figure 3
Effects of vagotomy on blood pressure. Ppara+/+ and Ppara−/−mice were treated with Dex for 5 months (1 mg/kg IP every other day) then systolic (SBP) and diastolic (DBP) blood pressures were determined by tail cuff (left panel, n=13 for ...
Table 1
Effects of selective hepatic vagotomy versus sham surgery in Dex-treated Ppara+/+ and Ppara−/−mice.

Reconstitution of Hepatic Ppara Expression and Blood Pressure

Reconstitution of Ppara expression in the livers of normotensive Dex-treated Ppara−/− mice subjected to either vagotomy or sham surgery by infusion of a PPARα adenovirus increased systolic blood pressure by 25 mm Hg (P = 0.001) and diastolic blood pressure by 16 mm Hg (P = 0.04) in sham-operated compared to vagotomized animals (Figure 3C). Blood pressure effects were confirmed invasively (Supplemental Figure 3B). There was no effect on blood pressure in saline-treated mice (Figure 3D). Hepatic reconstitution of Ppara in sham-operated animals nearly doubled plasma renin activity (P = 0.04) and decreased urinary sodium (P = 0.04) as compared to vagotomized mice treated with the PPARα adenovirus (Supplemental Table 3). These data suggest that hepatic Ppara activation and the presence of an intact vagus nerve promote glucocorticoid-induced hypertension through a renin-dependent mechanism.

Selective Disruption of Vagal Afferent Fibers

Since both afferent (Uno et al., 2006) and efferent (Lam et al, 2005) fibers of the vagus have been implicated in systemic metabolic effects, vagal afferents were selectively disrupted using two independent techniques in animals treated with Dex. Hepatic vagal branch application of capsaicin, which is toxic to unmyelinated afferent fibers, disrupted vagal afferent fibers (Figure 4C and D, arrows) but did not affect myelinated fibers (Figure 4C and D, arrowheads) as demonstrated by electron microscopy 10 days following the procedure. Unmyelinated fibers from vehicle-treated vagus nerves were unaffected (Figure 4A, arrows) as were fibers in the posterior vagal trunk (which was untreated) of animals subjected to capsaicin treatment of the hepatic vagal branch (Figure 4B). The was no effect on food intake between capsaicin- and control-treated mice by 10 days after the procedure (Figure 4E) and no effect on weight (Figure 4F). Capsaicin-induced disruption of vagal afferent fibers reversed glucose intolerance (Figure 4G). To confirm this observation, vagal afferents were surgically interrupted at the brainstem. Representative views of the surgical approach are shown in Figure 5A, B, C, with the area denoted by the rectangle in Panel A expanded in Panel B, and the area denoted by the rectangle in Panel B expanded in Panel C. Body weights following the central afferent vagotomy and the sham procedure (in which the dura was opened and the field visualized without surgical resection) are shown in Figure 5D. Three weeks after the surgeries, central afferent vagotomy lowered blood pressure (Figure 5E) and improved glucose tolerance (Figure 5F) in Dex-treated mice.

Figure 4
Selective peripheral afferent vagal denervation reverses Dex-induced insulin resistance. Dex-treated Ppara+/+ mice underwent either capsaicin or vehicle application to the hepatic vagal branch. Electron microscopy (EM) of hepatic vagal nerve sections ...
Figure 5
Central afferent vagal nerve sectioning reverses Dex-induced hypertension and insulin resistance. Dex-treated Ppara+/+ mice were randomly assigned to either selective section of the vagal afferent fibers in the brainstem or a sham operation. Panels A-C ...

Discussion

Despite important anti-inflammatory properties, glucocorticoids are potentially dangerous due to side effects that include insulin resistance, diabetes and hypertension. Here we show that glucocorticoid-induced glucose intolerance and elevated blood pressure depend on an afferent vagal nerve pathway initiated by expression of the lipid-activated transcription factor PPARα in the liver.

Several lines of evidence implicate the autonomic nervous system in the regulation of hepatic metabolism, although results vary based on the experimental model. In dogs, chronic denervation of the liver has little effect on glucose metabolism (Wada et al., 1995), while acute disruption of the vagus decreases hepatic glucose production by inhibiting glycogenolysis (Cardin et al., 2002). In rats, both vagotomy (Xie and Lautt, 1996; Matsuhisa et al., 2000) and electrical stimulation of the vagus (Peitl et al., 2005) have been reported to induce insulin resistance. Also in rats, the hypothalamic infusion of fatty acids suppresses hepatic glucose production through mechanisms involving descending vagal input (Lam et al., 2005). Adenoviral expression of PPARγ2 in liver decreases peripheral adiposity in a process that depends on the afferent vagus (Uno et al., 2006). By extending selective hepatic vagotomy and disruption of the afferent vagus to mice with genetic manipulations of PPARα, there are three conclusions we can make about the role of the vagus nerve in metabolism.

First, an intact hepatic branch of the vagus in the presence of hepatic Ppara expression is required for the development of glucocorticoid-induced diabetes. Vagotomy reversed hyperglycemia in Ppara+/+ mice (Figure 1D) and reconstitution of Ppara expression in the livers of Dex-treated Ppara−/− mice induced hyperglycemia after sham surgery but not after vagotomy (Figure 2G). PPARα was not a passive participant in this process. Glucocorticoids are known to induce hepatic Ppara gene expression (Lemberger et al., 1994; Lemberger et al., 1996) and Ppara is an important mediator of gluconeogenesis (Bernal-Mizrachi et al., 2003; Koo et al., 2004). Surprisingly, selective hepatic vagotomy decreased hepatic Ppara expression and the expression of two PPARα target genes, Acox and Acadam (Figure 2D, E, F) without affecting expression of the coactivator Ppargc1. These findings, occurring in weight-stable mice with normal food intake and no evidence of hepatic dysfunction, suggest that vagal input is critical for the maintenance of glucocorticoid-induced transcriptional responses in the liver.

Rossetti and colleagues recently provided evidence for links between the central nervous system and hepatic glucose production (Obici et al., 2002) involving the hepatic branch of the vagus (Lam et al., 2005). Our data show that selective hepatic vagotomy has no effect on glucose production in saline-treated wild type mice (Figure 2). This procedure also had no effect on glucose production in saline-treated rats (Lam et al., 2005, see Supplementary Figure 3). Lam et al. showed that an Intralipid/heparin infusion decreases glucose production through vagal efferents. The current study shows that glucocorticoid treatment increases glucose production through vagal afferents. Collectively, the results indicate that the vagus can mediate increased or decreased hepatic glucose production through different fibers depending on the specific stimulus.

The second conclusion we can make is that an intact hepatic branch of the vagus in the presence of hepatic Ppara expression is required for the development of glucocorticoid-induced hypertension. Vagotomy reversed established blood pressure elevations in Ppara+/+ mice (Figure 3A) in concert with lower catecholamines, decreased renin activity, and less sodium retention (Table 1). Reconstitution of Ppara expression in the livers of Dex-treated Ppara−/− mice elevated blood pressure after sham surgery but not after vagotomy (Figure 3C). Consistent with the current results, glucocorticoid-induced hypertension is thought to be caused by increased sodium retention (Whitworth et al., 1979). The pathophysiology may also involve enhanced vascular reactivity to pressors (Walker et al., 1994) and altered vascular nitric oxide production (Wallerath et al., 1999). Our data point to a critical role of an intact vagus nerve responding to hepatic Ppara expression in mediating the blood pressure response to chronic glucocorticoid exposure.

Our third conclusion is that intact vagal afferent fibers are required for glucocorticoid-induced glucose intolerance and hypertension. In animals treated with Dex, disruption of the afferent vagus using topical application of the selective neurotoxin capsaicin (Figure 4) reversed glucose tolerance (Figure 4G). Surgical interruption of vagal afferents at the brainstem (Figure 5) reversed glucose intolerance (Figure 5F) and lowered blood pressure (Figure 5E). These surgical results should be interpreted with the caveat that, although physiological effects resembled those with capsaicin, neuroanatomical verification as presented in the rat model (Walls et al., 1995) was not performed in these mice. Hepatic expression of a different nuclear receptor, PPARγ2, also appears to require intact vagal afferents to produce systemic effects, but these effects are strikingly different from those induced by PPARα; induction of hepatic expression of PPARγ2 increases insulin sensitivity (Uno et al., 2006) while Dex induction of hepatic expression of PPARα in the current study decreases insulin sensitivity. The fact that afferent vagal fibers are involved in both suggests that metabolic signals sent by each nuclear receptor in the liver are distinct. While neuroanatomical data for the vagus in mice are limited, rat studies indicate that sensory vagal fibers do not appear to provide substantial direct innervation of hepatocytes, instead tracking with portal triads in proximity to branches of the hepatic artery, portal vein, and bile ducts (Berthoud and Neuhuber, 2000). It is plausible that metabolic responses involve a regulatory compartment of hepatocytes located near portal triads. Since there may be little direct innervation of hepatocytes by the vagus, induction of PPARα-dependent genes in these cells could increase extracellular metabolites in the portal triad, resulting in vagal afferent signals ultimately translated by the brain into peripheral effects that include glucose intolerance and hypertension. Clarifying the nature of these PPARα-dependent metabolites and the characteristics of the vagal afferent signals they generate could yield new approaches for treating insulin resistance.

The vagus nerve derives its name from the Latin word for “wanderer”, a reference to the meandering anatomic distribution of the nerve. Given recent discoveries that this nerve suppresses inflammation (Borovikova et al., 2000), inhibits seizure activity (Uthman et al., 2004) and depression (Nahas et al., 2005), modulates central nervous system responses to fatty acids (Lam et al., 2005), and establishes a circuit between the liver and central nervous system leading to either enhanced insulin sensitivity (Uno et al., 2006) or diabetes and hypertension (the current work), it appears that the full extent of the nomadic journey of the vagus is still not understood.

Experimental Procedures

Animals

The Ppara+/+ and Ppara−/− mice used for these studies were produced by crossing Ppara−/− animals (a kind gift from Dr. Frank Gonzalez and developed at the NIH as described by Lee et al., 1995) with inbred C57BL/6 animals to the N6 generation. Littermate mice of both sexes were treated with either Dex (1 mg/kg IP) or an equal volume of normal saline every other day beginning at the age of 8 weeks. The same effects of interventions were seen in both sexes. Animals were housed in a specific pathogen-free barrier facility with free access to water and standard mouse chow (providing 6% calories as fat). The Washington University Animal Studies Committee approved these experiments and all procedures were performed as recommended by the NIH guidelines for the Care and Use of Laboratory Animals and the Laboratory Animal Welfare Act.

Selective Hepatic Vagotomy

Vagotomy was performed by modifying a procedure previously described in rats (Bellinger and Williams, 1981). Mice were anesthetized with pentobarbital (60 mg/kg). The abdominal wall was incised at midline, the stomach was pulled down and the ligaments attaching the liver to the stomach were severed. The anterior ligament and the membranous connection of the left lobe of the liver to the diaphragm were cut to give better visibility of the esophageal-hepatic attachments. This region contains a neurovascular bundle including the hepatic branch of the vagus nerve. This branch was selectively ligated by silk sutures and cauterized (Smith and Jerome, 1983). The tissue at the ligation site was resected and examined microscopically to ensure that the manipulated structure represented nerve. After experiments, animals were sacrificed and the adequacy of the procedure was assessed by demonstrating the absence of vagal nerve tissue between the silk sutures and by tracing the nerve remnant to its origin in the neck by dissection.

Selective Disruption of Vagal Afferents

Two independent techniques, topical application of capsaicin and surgical interruption of fibers at the brainstem, were used to disrupt vagal afferents.

Capsaicin (10 mg) was sonicated with 0.1 ml Tween 80 for 10 min and brought to 1 ml with olive oil. Following induction of pentobarbital anesthesia, the hepatic vagal nerve was exposed as noted above. Gauze soaked in capsaicin, isolated from surrounding tissues by paraffin paper, was wrapped around the nerve for 30 min with additional agent applied twice during that period to yield a total dose of 0.5 mg per mouse. Tween 80 in olive oil was applied to the nerve in control animals. Physiological evaluations were conducted 10 days after surgery.

Surgical interruption of the afferent fibers at the left side of the brainstem was performed using a dorsal-lateral approach. Unilateral sectioning was pursued due to the technically demanding nature of the procedure and because previous data in rats indicate that the hepatic vagus projects predominantly to the left side of the brainstem (Magni and Carobi, 1983; Berthoud et al., 1992). Following induction of anesthesia with ketamine (75 mg/kg) and medetomidine (1 mg/kg, IP), the head and dorsal surface of the upper thorax were shaved and swabbed with betadine, the eyes were protected with artificial tears, and the animal secured into a stereotaxic device. Temperature was maintained using a heating pad and a heat lamp attached to a temperature probe. Muscles attached to the occipital portion of the skull were resected to expose the foramen magnum. Fine-tipped forceps were used to cut through the ventro-lateral aspect of the skull rostrally to expose the brainstem. Care was necessary to avoid breeching the venous sinus near the rostral end of the brainstem. The brainstem was gently retracted to allow visualization of the vagus nerve between where it attaches to the brainstem and where it exits the skull through the posterior lacerated foramen. The dura was opened using iridectomy scissors to visualize the posterior cranial nerves. When the rootlets of the vagus were identified, the dorsal rootlets were avulsed from the brainstem using a dura hook inserted between the dorsal (afferent) and ventral (efferent) rootlets. After deafferentation, artificial dura (Duragen) was applied to the exposed area. Muscles were sutured back onto their insertion points on the skull and the skin closed. The animals were removed from the stereotaxic device, placed on a separate heating pad, and the anesthetic reversal agent atipamezole (1 mg/kg, SC), warm saline (2 cc, IP), enrofloxacin (2.5 mg/kg, SC) and buprenorphine (0.1 mg/kg, SC) were administered. Animals were closely monitored during recovery and when fully awake were placed in clean cages with water and nutritional supplements (Nutri-cal and Froot Loops) available on or near the cage floor so that access would require minimal neck movement. Saline, antibiotics and analgesia were continued for 3 days. Physiological evaluations were conducted three weeks after surgery.

Analytical Procedures

Glucose, insulin, cholesterol, triglycerides, nonesterified fatty acids and leptin were assayed as described (Bernal-Mizrachi et al., 2002). Glucose and insulin tolerance tests were performed as described in procedures separated by at least one week (Marshall et al., 1999). Body composition was determined by dual-energy X-ray absorptiometry. Twenty-four hour urine collections for urinary sodium and catecholamines were as described (Bernal-Mizrachi et al., 2003). Renin activity was measured in 500 μl aliquots of pooled plasma from 10 animals per condition by radioimmunoassay of in vitro generated angiotensin I using a kit from DiaSorin (Stillwater, MN). Electron microscopy was performed by the Cell Biology & Physiology Core with tissue prepared as described (Han et al., 2004).

Hyperinsulinemic-euglycemic Clamps

Clamp experiments were performed essentially as described (Marshall et al.. 1999). 3-[3H]glucose was infused to steady state, regular human insulin was infused at 10 mU per kg per min, and 25% D-glucose was infused to maintain blood glucose at 120 mg/dl for at least 90 min. The 3-[3H]glucose infusion was continued during the clamp, with labeled glucose included in the 25% D-glucose infusion to match blood specific activity at steady state. The rate of appearance of glucose (Ra), equal to the rate of glucose utilization (Rd) at steady state, was determined by dividing the infusion rate of labeled glucose by the specific activity. Endogenous glucose production was calculated by subtracting the cold glucose infusion rate from the clamp Rd.

Adenovirus Treatment

AdPPARα (containing the mouse Ppara cDNA) was generated, and administered as described (Tordjman et al. 2002; Bernal-Mizrachi et. al 2003). Viruses were infused at a dose of 6x109 pfu in a total volume of 200 μl. Expression in tissues, almost exclusively limited to liver, was determined in a subset of animals sacrificed three days following infusion by RT-PCR using RNA from aorta, liver, kidney, heart, skeletal muscle, lung, and gonadal fat pad. The primers used were: Ppara forward, 5′-TCGGCCTGGCCTTCTAAACA-3′; Ppara reverse, 5′-GTTACACCCTCCAGAACAGT-3′; L32 forward, 5′-TAAGCGAAACTGGCGGAAAC-3′; L32 reverse, 5′-TCATTTTCTTCGCTGCGTAGC-3′.

Blood Pressure

Non-invasive determinations of systolic and diastolic blood pressures were made over several days in conscious mice using a Kent Scientific (Litchfield, CT) tail-cuff system as described (Bernal-Mizrachi et al., 2002). For mice treated with adenoviruses, measurements began four days following the injection. Non-invasive results were confirmed using an invasive monitoring PowerLab/8SP instrument (AD Instruments, Grand Junction, CO).

Semi-Quantitative RT-PCR based Gene Expression

Analyses were done in a GeneAmp 7700 Sequence Detector (Applied Biosystems) using the following oligonucleotides: Ppara forward, 5′-ACTACGGAGTTCACGCATGTG-3′, Ppara reverse, 5′-TTGTCGTACACCAGCTTCAGC-3′, probe, 5′-AGGCTGTAAGGGCTTCTTTCGGCG-3′; Ppargc1 forward, 5′-CGGAAAT CATATCCAACCAG-3′, Ppargc1 reverse, 5′-TGAGGACCGCTAGCAAGTTTG-3′, probe, 5′-TCATTCTCTTCATCTACTTTCTCAAATATGTTC-3′; Aco forward, 5′-GGATGGTAGTCCGGAGAACA-3′, Aco reverse, 5′-AGTCTGGATCGTTCAGAATCAAG-3′, probe, 5′-TCTCGATTTCTCGACGGCGCCG-3′; Mcad forward, 5′GGAAATGATCAACAAAAAAAGTATTT-3′, Mcad reverse, 5′-ATGGCCGCCACATCAGA-3′, probe, 5′-TGTCACACAGTAAGCACACATCATTGGCTG-3′ L32 forward, 5′- AAGCGAAACTGGCGGAAAC-3′, L32 reverse, 5′- GATCTGGCCCTTGAACCTTCT-3′ probe, 5′- CAGAGGCATTGACAACAGGGTGCG -3′. Results were normalized to the housekeeping gene L32. Its expression was unaffected by genotype or Dex treatment.

PEPCK Enzyme Activity

10% (w/v) liver homogenates were prepared at 0°C in 250 mmol/l sucrose, 5 mmol/l Hepes (pH 7.4) buffer and centrifuged at 3600 g for 10 min. Supernatant fractions were further centrifuged at 130,000 g for 30 min and PEPCK enzyme activity was assayed by following the consumption of NADH as previously described (Petrescu et al., 1979; Jamieson et al., 1999).

Supplementary Material

01

Acknowledgments

This work was supported by NIH grants P50 HL083762, HL58427, AG20091, Clinical Nutrition Research Unit DK56341, Diabetes Research and Training Center DK20579, and an American Diabetes Association Mentor-based Postdoctoral Fellowship. We thank Marilyn A. Levy for electron microscopy services.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Berger J, Moller DE. The mechanisms of action of PPARs. Annu Rev Med. 2002;53:409–435. [PubMed]
  • Bellinger LL, Williams FE. The effects of liver denervation on food and water intake in the rat. Physiol Behav. 1981;26:663–671. [PubMed]
  • Benthem L, Keizer K, Wiegman CH, de Boer SF, Strubbe JH, Steffens AB, Kuipers F, Scheurink AJ. Excess portal venous long-chain fatty acids induce syndrome X via HPA axis and sympathetic activation. Am J Physiol Endocrinol Metab. 2000;279:E1286–1293. [PubMed]
  • Bernal-Mizrachi C, Weng S, Feng C, Finck BN, Knutsen RH, Leone TC, Coleman T, Mecham RP, Kelly DP, Semenkovich CF. Dexamethasone induction of hypertension and diabetes is PPAR-alpha dependent in LDL receptor-null mice. Nat Med. 2003;9:1069–1075. [PubMed]
  • Bernal-Mizrachi C, Weng S, Li B, Nolte LA, Feng C, Coleman T, Holloszy JO, Semenkovich CF. Respiratory uncoupling lowers blood pressure through a leptin-dependent mechanism in genetically obese mice. Arterioscler Thromb Vasc Biol. 2002;22:961–968. [PubMed]
  • Berthoud HR, Kressel M, Neuhuber WL. An anterograde tracing study of the vagal innervation of rat liver, portal vein and biliary system. Anat Embryo. 1992;186:431–442. [PubMed]
  • Berthoud HR, Neuhuber WL. Functional and chemical anatomy of the afferent vagal system. Autonom Neurosci. 2000;85:1–17. [PubMed]
  • Borovikova LV, Ivanova S, Zhang M, Yang H, Botchkina GI, Watkins LR, Wang H, Abumrad N, Eaton JW, Tracey KJ. Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature. 2000;405:458–462. [PubMed]
  • Cardin S, Walmsley K, Neal DW, Williams PE, Cherrington AD. Involvement of the vagus nerves in the regulation of basal hepatic glucose production in conscious dogs. Am J Physiol Endocrinol Metab. 2002;283:E958–964. [PubMed]
  • Chakravarthy M, Pan Z, Zhu Y, Tordjman K, Schneider J, Coleman T, Turk J, Semenkovich CF. “New” hepatic fat activates PPARα to maintain glucose, lipid and cholesterol homeostasis. Cell Metabolism. 2005;1:309–322. [PubMed]
  • Grekin RJ, Dumont CJ, Vollmer AP, Watts SW, Webb RC. Mechanisms in the pressor effects of hepatic portal venous fatty acid infusion. Am J Physiol Regulatory Integrative Comp Physiol. 1997;273:R324–330. [PubMed]
  • Grekin RJ, Vollmer AP, Sider RS. Pressor effects of portal venous oleate infusion. A proposed mechanism for obesity hypertension. Hypertension. 1995;26:193–198. [PubMed]
  • Guerre-Millo M, Rouault C, Poulain P, Andre J, Poitout V, Peters JM, Gonzalez FJ, Fruchart JC, Reach G, Staels B. PPAR-alpha-null mice are protected from high-fat diet-induced insulin resistance. Diabetes. 2001;50:2809–2814. [PubMed]
  • Han DH, Nolte LA, Ju JS, Coleman T, Holloszy JO, Semenkovich CF. UCP-mediated energy depletion in skeletal muscle increases glucose transport despite lipid accumulation and mitochondrial dysfunction. Am J Physiol Endocrinol Metab. 2004;286:E347–E353. [PubMed]
  • Jamieson PM, Nyirenda MJ, Walker BR, Chapman KE, Seckl JR. Interactions between oestradiol and glucocorticoid regulatory effects on liver-specific glucocorticoid-inducible genes: possible evidence for a role of hepatic 11beta-hydroxysteroid dehydrogenase type 1. J Endocrinol. 1999;160:103–109. [PubMed]
  • Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, Wahli W. Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting. J Clin Invest. 1999;103:1489–1498. [PMC free article] [PubMed]
  • Koo SH, Satoh H, Herzig S, Lee CH, Hedrick S, Kulkarni R, Evans RM, Olefsky J, Montminy M. PGC-1 promotes insulin resistance in liver through PPAR-alpha-dependent induction of TRB-3. Nat Med. 2004;10:530–534. [PubMed]
  • Lam TK, Pocai A, Gutierrez-Juarez R, Obici S, Bryan J, Aguilar-Bryan L, Schwartz GJ, Rossetti L. Hypothalamic sensing of circulating fatty acids is required for glucose homeostasis. Nat Med. 2005;11:320–327. [PubMed]
  • Lee SS, Pineau T, Drago J, Lee EJ, Owens JW, Kroetz DL, Fernandez-Salguero PM, Westphal H, Gonzalez FJ. Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol Cell Biol. 1995;15:3012–3022. [PMC free article] [PubMed]
  • Lemberger T, Saladin R, Vazquez M, Assimacopoulos F, Staels B, Desvergne B, Wahli W, Auwerx J. Expression of the peroxisome proliferator-activated receptor alpha gene is stimulated by stress and follows a diurnal rhythm. J Biol Chem. 1996;271:1764–1769. [PubMed]
  • Lemberger T, Staels B, Saladin R, Desvergne B, Auwerx J, Wahli W. Regulation of the peroxisome proliferator-activated receptor alpha gene by glucocorticoids. J Biol Chem. 1994;269:24527–24530. [PubMed]
  • Magni F, Carobi C. The afferent and preganglionic parasympathetic innervation of the rat liver, demonstrated by the retrograde transport of horseradish peroxidase. J Auton Nerv Syst. 1983;8:237–260. [PubMed]
  • Marshall BA, Tordjman K, Host HH, Ensor NJ, Kwon G, Marshall CA, Coleman T, McDaniel ML, Semenkovich CF. Relative hypoglycemia and hyperinsulinemia in mice with heterozygous lipoprotein lipase (LPL) deficiency. Islet LPL regulates insulin secretion. J Biol Chem. 1999;274:27426–27432. [PubMed]
  • Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR, Flier JS. A transgenic model of visceral obesity and the metabolic syndrome. Science. 2001;294:2166–2170. [PubMed]
  • Matsuhisa M, Yamasaki Y, Shiba Y, Nakahara I, Kuroda A, Tomita T, Iida M, Ikeda M, Kajimoto Y, Kubota M, Hori M. Important role of the hepatic vagus nerve in glucose uptake and production by the liver. Metabolism. 2000;49:11–16. [PubMed]
  • Moreno S, Farioli-Vecchioli, Ceru MP. Immunolocalization of peroxisome proliferator-activated receptors and retinoid X receptors in the adult rat CNS. Neuroscience. 2004;123:131–145. [PubMed]
  • Nahas Z, Marangell LB, Husain MM, Rush AJ, Sackeim HA, Lisanby SH, Martinez JM, George MS. Two-year outcome of vagus nerve stimulation (VNS) for treatment of major depressive episodes. J Clin Psych. 2005;66:1097–1104. [PubMed]
  • Obici S, Zhang BB, Karkanias G, Rossetti L. Hypothalamic insulin signaling is required for inhibition of glucose production. Nat Med. 2002;12:1376–1382. [PubMed]
  • Paterson JM, Morton NM, Fievet C, Kenyon CJ, Holmes MC, Staels B, Seckl JR, Mullins JJ. Metabolic syndrome without obesity: Hepatic overexpression of 11beta-hydroxysteroid dehydrogenase type 1 in transgenic mice. Proc Natl Acad Sci USA. 2004;101:7088–7093. [PMC free article] [PubMed]
  • Patsouris D, Mandard S, Voshol PJ, Escher P, Tan NS, Havekes LM, Koenig W, Marz W, Tafuri S, Wahli W, et al. PPARalpha governs glycerol metabolism. J Clin Invest. 2004;114:94–103. [PMC free article] [PubMed]
  • Peitl B, Dobronte R, Nemeth J, Mezey G, Kovacs P, Paragh G, Szilvassy Z. The prandial insulin sensitivity-modifying effect of vagal stimulation in rats. Metabolism. 2005;54:579–583. [PubMed]
  • Petrescu I, Bojan O, Saied M, Bârzu O, Schmidt F, Kuhnle HF. Determination of phosphoenolpyruvate carboxykinase activity with deoxyguanosine 5′-diphosphate as nucleotide substrate. Anal Biochem. 1979;96:279–281. [PubMed]
  • Randich A, Spraggins DS, Cox JE, Meller ST, Kelm GR. Jejunal or portal vein infusions of lipids increase hepatic vagal afferent activity. Neuroreport. 2001;2001;12:3101–3105. [PubMed]
  • Reddy JK. Nonalcoholic steatosis and steatohepatitis. III Peroxisomal beta-oxidation, PPAR alpha, and steatohepatitis. Am J Physiol Gastrointest Liver Physiol. 2001;281:G1333–1339. [PubMed]
  • Rodriguez JC, Gil-Gomez G, Hegardt FG, Haro D. Peroxisome proliferator-activated receptor mediates induction of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene by fatty acids. J Biol Chem. 1994;269:18767–18772. [PubMed]
  • Smith GP, Jerome C. Effects of total and selective abdominal vagotomies on water intake in rats. J Auton Nerv Syst. 1983;9:259–271. [PubMed]
  • Subramanian S, DeRosa MA, Bernal-Mizrachi C, Laffely N, Cade WT, Yarasheski KE, Cryer PE, Semenkovich CF. PPARα activation elevates blood pressure and does not correct glucocorticoid-induced insulin resistance in humans. Am J Physiol Endocrinol Metab. 2006;291:E1365–E1371. [PubMed]
  • Tordjman K, Bernal-Mizrachi C, Zemany L, Weng S, Feng C, Zhang F, Leone TC, Coleman T, Kelly DP, Semenkovich CF. PPARα deficiency reduces insulin resistance and atherosclerosis in apoE-null mice. J Clin Invest. 2001;107:1025–1034. [PMC free article] [PubMed]
  • Tordjman K, Standley K, Bernal-Mizrachi C, Leone T, Coleman T, Kelly DP, Semenkovich CF. PPARα suppresses insulin secretion and induces UCP2 in insulinoma cells. J Lipid Res. 2002;43:936–943. [PubMed]
  • Uno K, Katagiri H, Yamada T, Ishigaki Y, Ogihara T, Imai J, Hasegawa Y, Gao J, Kaneko K, Iwasaki H, Ishihara H, Sasano H, Inukai K, Mizuguchi H, Asano T, Shiota M, Nakazato M, Oka Y. Neuronal pathway from the liver modulates energy expenditure and systemic insulin sensitivity. Science. 2006;312:1656–1659. [PubMed]
  • Uthman BM, Reichl AM, Dean JC, Eisenschenk S, Gilmore R, Reid S, Roper SN, Wilder BJ. Effectiveness of vagus nerve stimulation in epilepsy patients: a 12-year observation. Neurology. 2004;63:1124–1126. [PubMed]
  • Wada M, Connolly CC, Tarumi C, Neal DW, Cherrington AD. Hepatic denervation does not significantly change the response of the liver to glucagon in conscious dogs. Am J Physiol. 1995;268:E194–203. [PubMed]
  • Walker BR, Sang KS, Williams BC, Edwards CR. Direct and indirect effects of carbenoxolone on responses to glucocorticoids and noradrenaline in rat aorta. J Hypertens. 1994;12:33–39. [PubMed]
  • Wallerath T, Witte K, Schafer SC, Schwarz PM, Prellwitz W, Wohlfart P, Kleinert H, Lehr HA, Lemmer B, Forstermann U. Down-regulation of the expression of endothelial NO synthase is likely to contribute to glucocorticoid-mediated hypertension. Proc Natl Acad Sci USA. 1999;96:13357–13362. [PMC free article] [PubMed]
  • Walls EK, Wang FB, Holst MC, Phillips RJ, Voreis JS, Perkins AR, Pollard LE, Powley TL. Selective vagal rhizotomies: a new dorsal surgical approach used for intestinal deafferentations. Am J Physiol Regulatory Integrative Comp Physiol. 1995;269:1279–1288. [PubMed]
  • Whitworth JA, Coghlan JP, Denton DA, Graham WF, Humphery TJ, Scoggins BA. Comparison of the effects of ‘glucocorticoid’ and ‘mineralocortocoid’ infusions on blood pressure in sheep. Clin Exp Hypertens. 1979;1:649–663. [PubMed]
  • Xie H, Lautt WW. Insulin resistance caused by hepatic cholinergic interruption and reversed by acetylcholine administration. Am J Physiol. 1996;271:E587–592. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...