• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. May 15, 2007; 104(20): 8478–8483.
Published online May 3, 2007. doi:  10.1073/pnas.0701821104
PMCID: PMC1895975
Microbiology

Synthesis of glycerol phosphate lipoteichoic acid in Staphylococcus aureus

Abstract

Lipoteichoic acid (LTA), a glycerol phosphate surface polymer, is a component of the envelope of Gram-positive bacteria. However, the molecular basis for its synthesis or function is not known. Here we report that Staphylococcus aureus LtaS synthesizes glycerol phosphate LTA. Construction of a mutant S. aureus strain with inducible ltaS expression revealed that LTA synthesis is required for bacterial growth and cell division. An ltaS homologue of Bacillus subtilis restored LTA synthesis and the growth of ltaS mutant staphylococci. Thus, LtaS inhibition can be used as a target to treat human infections caused by antibiotic-resistant S. aureus or other bacterial pathogens.

Keywords: cell division, ltaS, polyglycerol phosphate

Staphylococcus aureus is the leading cause of hospital- and community-acquired soft tissue infections, the therapy for which frequently fails because staphylococcal strains acquire resistance mechanisms for all known antibiotics (13). The development of novel antibiotics is urgently needed and will require the identification of new target genes that are required for bacterial growth (4). Cell wall teichoic acid (WTA) and lipoteichoic acid (LTA) are characteristic envelope components of Gram-positive bacteria (57). Several decades of research on WTA and LTA has revealed their chemical structure and modifications in many different Gram-positive microbes (810). Earlier work presumed that synthesis of these secondary wall polymers might be essential for bacterial growth and might therefore serve as a target for antibiotic development (11), similar to peptidoglycan, the primary wall polymer and target of penicillin (12). More recent work showed that, although WTA is dispensable for growth under laboratory conditions (1315), staphylococcal mutants unable to synthesize WTA display colonization and virulence defects in animal models of infection (15, 16). S. aureus LTA, a 1,3-linked glycerol phosphate polymer, is retained by a glycolipid anchor, diglucosyl diacylglycerol (Glc2-DAG), in bacterial membranes (Fig. 1A) (17, 18). Staphylococci produce polyglycerol phosphate polymers even in the absence of glycolipids, because mutant strains that cannot synthesize Glc2-DAG can still anchor LTA via diacylglycerol (19, 20). Mutations in the dlt operon abolish d-alanyl esterification of LTA without affecting the synthesis of polyglycerol phosphate (2124). Both dlt and glycolipid anchor mutants continue to multiply, thereby revealing that these nonessential genes are not ideal targets for antibiotic development (20, 23).

Fig. 1.
Expression of S. aureus LtaS in E. coli promotes synthesis of glycerol phosphate LTA. (A) Chemical structure of S. aureus LTA (26). NAG, N-acetylglucosamine (GlcNAc). (B) Analysis of LTA with polyglycerol phosphate-specific monoclonal antibody. Extracts ...

Here we report the identification of a polyglycerol phosphate synthase, LtaS, in S. aureus and demonstrate its requirement for LTA synthesis using staphylococcal and Bacillus subtilis ltaS homologues. Upon ltaS depletion, staphylococci were unable to synthesize LTA and ceased to grow, while displaying defects in cell division. These findings suggest that inhibition of LtaS can be explored as a target for antibiotic therapy of S. aureus infections.

Results

Identification of S. aureus ltaS Encoding Polyglycerol Phosphate LTA Synthase.

Although models proposed for the mechanism of LTA synthesis differ, it is commonly accepted that phosphatidyl glycerol (PG) is used as substrate for polyglycerol phosphate LTA synthesis (2527). Werner Fischer proposed a model whereby LTA is polymerized on the outer surface of bacterial membranes (26). If LTA synthesis were required for the envelope assembly and growth of Gram-positive bacteria, it would not be possible to isolate mutants with irreversibly inactivated LTA synthesis. We therefore asked whether expression of the presumed LTA synthase in Escherichia coli, a Gram-negative microbe that lacks polyglycerol phosphate but harbors PG membrane lipids, could promote LTA synthesis. A plasmid library of staphylococcal genomic DNA fragments was constructed in pOK12 (28). Plasmids were introduced into E. coli strain ANG471, and clones producing LTA were identified by SDS/PAGE and immunoblotting with monoclonal antibody specific for polyglycerol phosphate. Two plasmid clones, p10/10E and p36/5F, each conferred onto E. coli the ability to produce immune-reactive LTA. As a control, LTA was absent in samples from E. coli harboring only the empty vector pOK12 (Fig. 1B).

LtaS-Mediated Synthesis of LTA Occurs in the Inner Membrane of E. coli.

The identity of the S. aureus DNA fragments contained within plasmids p10/10E and p36/5F was determined by DNA sequencing. A single ORF encoding a previously uncharacterized protein (locus tag SAV0719 in S. aureus Mu50), was present in both clones. This gene was named ltaS for LTA synthase. ltaS was cloned with its native promoter into pOK12, generating plasmid pOK–ltaS. E. coli strains harboring pOK–ltaS produced glycerol phosphate polymers, demonstrating that expression of a single staphylococcal gene in E. coli, which encodes LtaS, is indeed sufficient for LTA synthesis (Fig. 1B).

In agreement with the Fischer model for polyglycerol phosphate synthesis on bacterial surfaces (26), LtaS is predicted to assemble as a polytopic membrane protein with a large C-terminal domain located on the outer surface of the bacterial membrane. The C-terminal domain (LtaS amino acids 245–604) presumably functions as a catalytic domain and is annotated in the Pfam database (www.sanger.ac.uk/Software/Pfam) as a sulfatase domain (Fig. 1C). Initial fractionation experiments suggested that a large fraction of glycerol phosphate polymer was present in the membranes of E. coli strains expressing ltaS (data not shown). Sucrose gradient centrifugation was used to separate bacterial inner and outer membranes (Fig. 1D). LTA floated to the same sucrose density as the inner membrane protein PpiD, but not to that of OmpF, an outer membrane protein (Fig. 1D). The glycerol phosphate polymer therefore seems to be located in the cytoplasmic (inner) membrane of E. coli ANG490 (pOK–ltaS).

ltaS Is Required for LTA Synthesis and Growth of S. aureus.

To test whether ltaS is also required for LTA glycerol phosphate synthesis in staphylococci, S. aureus ANG499, a strain with isopropyl β-d-thiogalactopyranoside (IPTG)-inducible expression of ltaS, was constructed. Strain ANG499 ceased to grow within 4 h of removing the ltaS inducer IPTG (Fig. 2A). Moreover, within 2 h of IPTG removal, immunoblot analysis failed to detect LTA in crude bacterial extracts of ltaS-depleted staphylococci (Fig. 2C). To examine whether the disappearance of LTA was caused by an arrest in bacterial growth or by a specific blockade in ltaS expression, we analyzed S. aureus ANG501, a strain that expresses murG, an essential gene in the peptidoglycan biosynthesis pathway (29), under control of a tetracycline-inducible promoter. Similar to strain ANG499, S. aureus strain ANG501 ceased to grow upon removal of the inducer anhydrotetracycline (Fig. 2B). In contrast to that in strain ANG499, anhydrotetracycline removal and depletion of murG in strain ANG501 did not abolish staphylococcal LTA synthesis (Fig. 2C). Thus, the observed block in LTA synthesis of strain ANG499 is likely caused by the depletion of ltaS.

Fig. 2.
S. aureus ltaS is required for LTA synthesis and bacterial growth. (A and B) S. aureus ANG499, with IPTG-inducible ltaS (A), and S. aureus ANG501, with anhydrotetracycline-inducible murG (B). Bacterial strains were grown overnight in the presence of appropriate ...

To examine further whether polyglycerol phosphate synthesis ceased upon ltaS depletion, LTA was purified from the ltaS-inducible S. aureus strain ANG513, which had been grown in the presence or absence of IPTG. Briefly, LTA was extracted from bacterial lysates, subjected to octyl Sepharose chromatography, and eluted with a linear gradient of 1-propanol [15–65% (vol/vol)] in 50 mM sodium citrate (pH 4.7) (3032). Large quantities of LTA could only be purified from S. aureus ANG513 cultures that had been grown in the presence of IPTG, but not from cultures grown without IPTG, as judged by immunoblot and phosphate determinations (Fig. 2 D and E). Together these data demonstrate that ltaS is not only required for staphylococcal growth but also for the synthesis of glycerol phosphate LTA.

Depletion of ltaS and LTA Results in Staphylococcal Envelope and Cell Division Defects.

To examine the physiological role of LTA during staphylococcal growth, S. aureus ANG499 cultures that had been grown in the presence or absence of IPTG were subjected to electron microscopy. Briefly, bacterial cells were sedimented by centrifugation, glutaraldehyde- and paraformaldehyde-fixed, stained, embedded, and thin-sectioned. When viewed at 300 kV through an electron microscope, S. aureus ANG499 grown in the presence of IPTG displayed the expected morphology of staphylococci: round cells with a thick cell wall envelope, central division septa, and perpendicularly positioned septa in adjacent cells that displayed subsequent division events (33, 34) (Fig. 3). Within 3 h of IPTG removal, S. aureus ANG499 that had been depleted of LTA displayed aberrant positioning of division septa, which were spaced very closely to the previous division plane (Fig. 3). Further, cells harbored parallel, but not perpendicular, division septa. Upon 6 h of LTA depletion, large numbers of aberrantly shaped cells with empty envelopes, lacking both cytoplasm and nucleic acid, could be observed. These results suggest that LTA synthesis and deposition of this secondary wall polymer within the envelope are essential for the proper positioning of cell wall septa and for cell division processes. Taken together, these experiments identify staphylococcal ltaS as being required for LTA synthesis, cell division, and staphylococcal growth.

Fig. 3.
LTA is required for proper cell envelope assembly. Electron microscopy of fixed and thin-sectioned samples of S. aureus ANG499 were grown in the presence or absence of IPTG (inducer of ltaS expression) for 3 and 6 h. Arrows indicate cell wall septa, whereas ...

LtaS Function Is Conserved in Gram-Positive Bacteria.

Glycerol phosphate LTA has been isolated from the cell wall envelope of many Gram-positive bacteria including B. subtilis, Bacillus anthracis, Bacillus cereus, Listeria monocytogenes, Streptococcus pyogenes (group A streptococci), and Streptococcus agalactiae (group B streptococci) (10, 18). By using BLAST database (www.ncbi.nlm.nih.gov/BLAST) searches of microbial genomes, one or more ltaS homologues were identified in the genome sequences of any one of the aforementioned bacterial species. For example, whereas S. aureus has one ltaS gene, B. subtilis 168 contains four ltaS homologues (yfnI, yflE, yqgS, and yvgJ with E (expectation) P values of <1e-100 and >40% identity) (35). In previous work, each of these genes could be deleted without abolishing the growth of bacilli (36), prompting the conclusion that any one of the four ltaS homologues of B. subtilis might not be required for bacterial replication. Nevertheless, the multiple, different ltaS homologues of B. subtilis may fulfill redundant or overlapping functions similar to those of S. aureus LtaS in synthesizing polyglycerol phosphate LTA. To address this question, B. subtilis yfnI, yflE, yqgS, and yvgJ or S. aureus ltaS was cloned under control of the tetracycline-inducible promoter in the integration vector pitet (20). Plasmids were integrated into the chromosome of S. aureus ANG499. Functional complementation of ltaS depletion was examined after removal of IPTG by adding anhydrotetracycline to the culture medium (Fig. 4). Anhydrotetracycline-inducible expression of staphylococcal ltaS or B. subtilis yflE restored both LTA glycerol phosphate synthesis and bacterial growth in medium lacking IPTG (Fig. 4 B, C, and G). B. subtilis yqgS or yvgJ did not restore staphylococcal growth and/or LTA synthesis (Fig. 4 E–G). In contrast, anhydrotetracycline-inducible expression of yfnI promoted LTA synthesis, although its polyglycerol phosphate product migrated with a different mobility on SDS/PAGE than LTA synthesized in ltaS- or yflE-expressing strains (Fig. 4G). Unlike that of yflE, expression of yfnI could not restore staphylococcal growth after ltaS depletion (Fig. 4D). These results suggest that B. subtilis yflE and yfnI both encode glycerol phosphate LTA synthases with at least partially overlapping functions, which may explain why these genes can be deleted without loss of viability in bacilli.

Fig. 4.
Functional complementation of ltaS depletion in S. aureus ANG499 with B. subtilis ltaS homologues. (A) Schematic representation of chromosomal organization in ltaS complementation strains. (B–F) Bacterial cultures were grown overnight in the presence ...

Discussion

S. aureus LTA is a polymer of 1,3-linked glycerol phosphate subunits that are tethered to Glc2-DAG (Fig. 1A) (17, 18). This glycerol phosphate structure is conserved in many different Gram-positive bacteria including the human pathogens B. anthracis, Enterococcus faecalis, L. monocytogenes, S. agalactiae, and S. pyogenes (18, 37). Biosynthesis of LTA has been studied with in vitro experiments using isolated bacterial membranes or toluene-treated cells (38, 39). PG was demonstrated to function as substrate for LTA synthesis (39), whereas CDP glycerol, a sn-glycerol-3-phosphate and substrate for WTA assembly, cannot substitute during LTA synthesis (40). PG is comprised of sn-glycerol-1-phosphate linked to diacylated sn-3-glycerol isomer. Although sn-glycerol-1-phosphate is incorporated into LTA, its diacylglycerol byproduct is successively converted to phosphatidic acid, CDP diacylglycerol, phosphatidyl glycerophosphate, and PG, thereby completing the LTA biosynthetic cycle (41).

Pulse-labeling of staphylococci with [14C]acetate revealed that the label appeared successively in glucosyl diacylglycerol (Glc-DAG), Glc2-DAG, and eventually LTA (25). Pulse-labeling with [2-3H]glycerol demonstrated incorporation into PG and glycolipid-anchored LTA (25). Stepwise degradation of pulse-labeled LTA from the glycerol terminus with phosphodiesterase and phosphomonoesterase revealed that the polymer chain grew distal to the lipid anchor (42, 43). These observations were incorporated into a unifying hypothesis whereby transfer of glycerol-1-phosphate from PG to Glc2-DAG and subsequent stepwise addition of glycerol phosphate at the distal end of a polymerizing chain would lead to LTA assembly. If so, LTA synthesis would require an enzyme for polyglycerol phosphate synthesis and perhaps a second activity for transfer of glycerol-1-phosphate from PG to Glc2-DAG (26). Two other proteins are known to be involved in LTA biosynthesis: YpfP synthesizes Glc2-DAG, and LtaA is required for the attachment of glycolipid to LTA (19, 20). However, ltaA mutants continue to assemble LTA with DAG lipid anchor moieties, and there is yet no evidence that LtaA, in addition to its presumed role in glycolipid transport across the membrane, is also involved in transfer of glycerol-1-phosphate to Glc2-DAG (20). Herein we show that LTA synthase (LtaS) is necessary and sufficient for the polymerization of LTA polyglycerol phosphate, a reaction that presumably uses PG substrate and proceeds in the presence or absence of Glc2-DAG. Further studies are needed to unravel whether purified LtaS can indeed synthesize polyglycerol phosphate from PG precursor and/or assemble LTA on its Glc2-DAG membrane anchor.

We report here the identification of S. aureus LTA synthase (locus tag SAV0719 in the genome of the Mu50 strain), where ltaS is required for polyglycerol phosphate LTA synthesis and other cell envelope functions. Expression of ltaS in E. coli led to the formation of polyglycerol phosphate polymer (Fig. 1). After depletion of ltaS in staphylococci, only minimal amounts of the phosphate-containing LTA could be detected by either immunoblot or phosphate determination (Fig. 2 C–E). ltaS depletion also caused growth arrest of staphylococci (Fig. 3). Microscopic examination of ltaS-depleted cells revealed an increase in cell size, partially thickened cell walls, and aberrant placement of cell division sites (Fig. 3). A precise mechanism for the observed defects in envelope and cell division functions cannot yet be deduced from these data. Nevertheless, the proposed functions of LTA, which include scavenging of the Mg2+ ions required for enzyme function and the proper targeting of autolysins to the bacterial envelope (4446), are in agreement with the observed phenotype of ltaS depletion. A single ltaS gene was identified in the genome sequences of S. aureus, S. pyogenes, and S. agalactiae (data not shown). In contrast, multiple ltaS homologues were found in other Gram-positive bacteria, including four homologues (YfnI, YflE, YqgS, and YvgJ) in B. subtilis. Each of these genes apparently can be deleted without abolishing the growth of mutant bacilli (36), suggesting that any one ltaS homologue of B. subtilis may not be required for bacterial replication. Presumably, the different ltaS homologues fulfill redundant or overlapping functions in synthesizing polyglycerol phosphate LTA. In agreement with this conjecture, we observed that two homologues, yflE and yfnI, encode glycerol phosphate LTA synthases with at least partially overlapping function (Fig. 4).

The finding that ltaS depletion leads to bacterial growth arrest opens the possibility that targeted inhibition of LtaS may be used as an antibiotic therapy for S. aureus infections. LtaS displays the appropriate features of drug targets, because polyglycerol phosphate LTA is not present in eukaryotic cells, and specific inhibitors may abolish bacterial growth. The enzymatic domain of LtaS is thought to be displayed outside of bacterial membranes, obviating the need for inhibitory compounds to cross bacterial membranes. Previous work hypothesized that daptomycin, a compound in clinical use for treatment of drug-resistant S. aureus infections, may inhibit LTA synthesis (47), a claim that has been challenged by the finding of resistance mutations in staphylococcal genes that are not involved in LTA synthesis (48, 49). Identification of LTA synthase now permits further testing of this hypothesis as well as screening for inhibitors with therapeutic properties.

Materials and Methods

Bacterial Strains and Identification of Staphylococcal ltaS.

The strains used in this study are listed in Table 1. Chromosomal DNA of S. aureus SEJ1 (20) was digested with Sau3A, and 3- to 8-kb fragments were cloned into pOK12 cut with BamHI. Plasmids were electroporated into E. coli ANG471 (DH5α harboring pCL55–ypfP/ltaA), transformants were plated on X-Gal indicator agar, and white or light blue colonies were picked. E. coli cultures were grown in 96-well plates, aliquots of four cultures were pooled, and bacterial sediments were extracted with 2% (wt/vol) SDS containing protein sample buffer. Samples were separated on 15% (wt/vol) SDS/PAGE and subjected to immunoblotting with polyglycerol phosphate-specific monoclonal antibody (clone 55, HyCult Biotechnology, Uden, The Netherlands), and LTA expression was detected via chemiluminescence.

Table 1.
Bacterial strains used in this study

Inducible Expression of ltaS in Staphylococci.

To construct S. aureus ANG499 with IPTG-inducible ltaS expression, the first 471 bases of ltaS and its preceding ribosome binding site were PCR-amplified with the primers CCCAAGCTTCTAAATAACGGGGGAAAGAATCATGAGTTC and GGGGTACCGACAGGAACAAATTTCTTACTAAATGCTTTTG. The PCR product was cut with HindIII and KpnI and cloned under the IPTG-inducible spac promoter control in pMutin–HA (Bacillus Genetic Stock Center, Columbus, OH). pMutin–HA–ltaS was electroporated into S. aureus RN4220, and transformants were selected on tryptic soy agar supplemented with 10 μg/ml erythromycin and 0.5 mM IPTG. S. aureus ANG501 (murG under tetracycline-inducible promoter control) was obtained by transposon mutagenesis with pLTV1–iTET. Plasmid pLTV1–iTET was constructed by recombining the tetracycline-inducible promoter amplified from plasmid pitet (20), and the Gram-positive and Gram-negative kanamycin-resistance gene was amplified from plasmid pDL276 (50) onto plasmid pLTV1 (51) by using λ-red recombination technology. pLTV1–iTET was electroporated into S. aureus RN4220, and transposon mutants were selected at 44°C on tryptic soy agar plates supplemented with 100 μg/ml kanamycin and 150 ng/ml anhydrotetracycline. The transposon insertion site was 30 nucleotides upstream of murG. PCR and specifically designed primers were used to amplify ltaS from S. aureus RN4220 or yfnI, yflE, yqgS, and yvgJ from B. subtilis 168 DNA. PCR products were digested with AvrII and BglII and ligated with vector pitet that had been cut with the same enzymes. Recombinant plasmids were inserted into the staphylococcal chromosome (20), yielding S. aureus strains ANG513 (ANG499 pitet), ANG514 (ANG499 pitet–ltaS), ANG515 (ANG499 pitet–yfnI), ANG516 (ANG499 pitet–yflE), ANG517 (ANG499 pitet–yqgS), and ANG518 (ANG499 pitet–yvgJ).

Phosphate Determination.

Phosphate determinations were performed essentially as described by Schnitger et al. (52) with some modifications. Briefly, 140 μl of collected FPLC fractions was transferred to 7-ml glass vials and dried for 3 h at 98°C. Compounds were hydrolyzed at 160°C in 400 μl of acid solution [139 ml of concentrated H2SO4 and 37.5 ml of 70% (vol/vol) HClO4 per liter] and subsequently cooled to room temperature. Samples were then cooled on ice, and 2 ml of a freshly prepared reduction solution (3.75 g of ammonium molybdate, 20.4 g of sodium acetate, and 10 g of ascorbic acid per liter) were added. After a 2-h incubation period at 37°C, A880 values were determined. For 5 mM glycerol phosphate and 1.25 mM standard solution, A880 readings of 3.04 ± 0.13 and 0.93 ± 0.06 were measured.

Electron Microscopy.

S. aureus ANG499 was grown overnight at 37°C in tryptic soy broth containing 10 μg/ml erythromycin and 1 mM IPTG. Staphylococci were sedimented by centrifugation (8,000 × g for 5 min), washed twice, and diluted 200-fold into prewarmed medium without or with 1 mM IPTG and appropriate antibiotic. Culture aliquots were removed 3 or 6 h after dilution, and bacteria (OD600 equivalent of ≈90) were sedimented by centrifugation (8,000 × g for 5 min), washed three times with 0.8 ml of 0.1 M sodium cacodylate (pH 7.4), and subsequently fixed for 15 min at room temperature and 2 h at 4°C with 2% (vol/vol) glutaraldehyde/4% (vol/vol) paraformaldehyde in 0.1 M sodium cacodylate. After fixation, bacteria were washed with 0.1 M sodium cacodylate, stained, dehydrated, and embedded for electron microscopy. Thin sections (90 nm) were examined at 300 kV by using a FEI (Hillsboro, OR) Tecnai F30 microscope, and images were captured with a Gatan (Pleasanton, CA) CCD digital camera.

Bacterial Strains, LTA Purification, and Analysis.

Detailed methods are described in the supporting information (SI) Materials and Methods.

Supplementary Material

Supporting Text:

Acknowledgments

We thank Dominique Missiakas (University of Chicago) for antibody reagents; Taeok Bae (Indiana University School of Medicine Northwest, Gary, IN) for the murG mutant; members of our laboratory for discussion; and the University of Chicago electron microscopy facility for experimental assistance. This work was supported by United States Public Health Service Grant AI38897 (to O.S.) from the Division of Microbiology and Infectious Diseases of the National Institute of Allergy and Infectious Diseases. O.S. is supported by the Great Lakes Regional Center of Excellence for Biodefense and Emerging Infectious Diseases Research under National Institute of Allergy and Infectious Diseases Award 1-U54-AI-057153.

Abbreviations

LTA
lipoteichoic acid
WTA
wall teichoic acid
Glc2-DAG
diglucosyl diacylglycerol
PG
phosphatidyl glycerol
IPTG
isopropyl β-d-thiogalactopyranoside.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/cgi/content/full/0701821104/DC1.

References

1. Kaplan SL, Hulten KG, Gonzalez BE, Hammerman WA, Lamberth L, Versalovic J, Mason EO., Jr Clin Infect Dis. 2005;40:1785–1791. [PubMed]
2. Diekema DJ, Pfaller MA, Schmitz FJ, Smayevsky J, Bell J, Jones RN, Beach M. Clin Infect Dis. 2001;32:S114–S132. [PubMed]
3. Weigel LM, Clewell DB, Gill SR, Clark NC, McDougal LK, Flannagan SE, Kolonay JF, Shetty J, Killgore GE, Tenover FC. Science. 2003;302:1569–1571. [PubMed]
4. Projan SJ, Shlaes DM. Clin Microbiol Infect. 2004;10:18–22. [PubMed]
5. Armstrong JJ, Baddiley J, Buchanan JG, Davison AL, Kelemen MV, Neuhaus FC. Nature. 1959;184:247–249. [PubMed]
6. Armstrong JJ, Baddiley J, Buchanan JG, Carss B, Greenberg GR. J Chem Soc. 1958:4344–4354.
7. Archibald AR, Armstrong JJ, Baddiley J, Hay JB. Nature. 1961;191:570–572. [PubMed]
8. McCarty M. J Exp Med. 1959;109:361–378. [PMC free article] [PubMed]
9. Neuhaus FC, Baddiley J. Microbiol Mol Biol Rev. 2003;67:686–723. [PMC free article] [PubMed]
10. Fischer W. In: Handbook of Lipid Research. Hanahan DJ, editor. Vol 6. New York: Plenum; 1990. pp. 123–234.
11. Mauel C, Young M, Margot P, Karamata D. Mol Gen Genet. 1989;215:388–394. [PubMed]
12. Tipper DJ, Strominger JL. Proc Natl Acad Sci USA. 1965;54:1133–1141. [PMC free article] [PubMed]
13. D'Elia MA, Pereira MP, Chung YS, Zhao W, Chau A, Kenney TJ, Sulavik MC, Black TA, Brown ED. J Bacteriol. 2006;188:4183–4189. [PMC free article] [PubMed]
14. D'Elia MA, Millar KE, Beveridge TJ, Brown ED. J Bacteriol. 2006;188:8313–8316. [PMC free article] [PubMed]
15. Weidenmaier C, Kokai-Kun JF, Kristian SA, Chanturiya T, Kalbacher H, Gross M, Nicholson G, Neumeister B, Mond JJ, Peschel A. Nat Med. 2004;10:243–245. [PubMed]
16. Weidenmaier C, Peschel A, Xiong YQ, Kristian SA, Dietz K, Yeaman MR, Bayer AS. J Infect Dis. 2005;191:1771–1777. [PubMed]
17. Duckworth M, Archibald AR, Baddiley J. FEBS Lett. 1975;53:176–179. [PubMed]
18. Fischer W, Mannsfeld T, Hagen G. Biochem Cell Biol. 1990;68:33–43. [PubMed]
19. Kiriukhin MY, Debabov DV, Shinabarger DL, Neuhaus FC. J Bacteriol. 2001;183:3506–3514. [PMC free article] [PubMed]
20. Gründling A, Schneewind O. J Bacteriol. 2007;189:2521–2530. [PMC free article] [PubMed]
21. Heaton MP, Neuhaus FC. J Bacteriol. 1992;174:4707–4717. [PMC free article] [PubMed]
22. Heaton MP, Neuhaus FC. J Bacteriol. 1994;176:681–690. [PMC free article] [PubMed]
23. Peschel A, Otto M, Jack RW, Kalbacher H, Jung G, Götz F. J Biol Chem. 1999;274:8405–8410. [PubMed]
24. Peschel A, Vuong C, Otto M, Götz F. Antimicrob Agents Chemother. 2000;44:2845–2847. [PMC free article] [PubMed]
25. Koch HU, Haas R, Fischer W. Eur J Biochem. 1984;138:357–363. [PubMed]
26. Fischer W. Med Microbiol Immunol. 1994;183:61–76. [PubMed]
27. Chiu TH, Morimoto H, Baker JJ. Biochim Biophys Acta. 1993;1166:222–228. [PubMed]
28. Vieira J, Messing J. Gene. 1991;100:189–194. [PubMed]
29. Mengin-Lecreulx D, Texier L, Rousseau M, van Heijenoort J. J Bacteriol. 1991;173:4625–4636. [PMC free article] [PubMed]
30. Morath S, von Aulock S, Hartung T. J Endotoxin Res. 2005;11:348–356. [PubMed]
31. Hashimoto M, Tawaratsumida K, Kariya H, Kiyohara A, Suda Y, Krikae F, Kirikae T, Götz F. J Immunol. 2006;177:3162–3169. [PubMed]
32. Fischer W, Koch HU, Haas R. Eur J Biochem. 1983;133:523–530. [PubMed]
33. Giesbrecht P, Kersten T, Maidhof H, Wecke J. Microbiol Mol Biol Rev. 1998;62:1371–1414. [PMC free article] [PubMed]
34. Tzagoloff H, Novick R. J Bacteriol. 1977;129:343–350. [PMC free article] [PubMed]
35. Kunst F, Ogasawara N, Moszer I, Albertini AM, Alloni G, Azevedo V, Bertero MG, Bessieres P, Bolotin A, Borchert S, et al. Nature. 1997;390:249–256. [PubMed]
36. Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, et al. Proc Natl Acad Sci USA. 2003;100:4678–4683. [PMC free article] [PubMed]
37. McCarty M, Morse SI. Adv Immunol. 1964;4:249–286. [PubMed]
38. Emdur L, Chiu T. FEBS Lett. 1975;55:216–219. [PubMed]
39. Childs WC, III, Neuhaus FC. J Bacteriol. 1980;143:293–301. [PMC free article] [PubMed]
40. Ganfield MC, Pieringer RA. J Biol Chem. 1980;255:5164–5169. [PubMed]
41. Fischer W. Adv Microb Physiol. 1988;29:233–302. [PubMed]
42. Cabacungan E, Pieringer RA. J Bacteriol. 1981;147:75–79. [PMC free article] [PubMed]
43. Taron DJ, Childs WC, III, Neuhaus FC. J Bacteriol. 1983;154:1110–1116. [PMC free article] [PubMed]
44. Fischer W, Rösel P, Koch HU. J Bacteriol. 1981;146:467–475. [PMC free article] [PubMed]
45. Cleveland RF, Höltje JV, Wicken AJ, Tomasz A, Daneo-Moore L, Shockman GD. Biochem Biophys Res Commun. 1975;67:1128–1135. [PubMed]
46. Lambert PA, Hancock IC, Baddiley J. Biochim Biophys Acta. 1977;472:1–12. [PubMed]
47. Canepari P, Boaretti M, Lleo MM, Satta G. Antimicrob Agents Chemother. 1990;34:1220–1226. [PMC free article] [PubMed]
48. Laganas V, Alder J, Silverman JA. Antimicrob Agents Chemother. 2003;47:2682–2684. [PMC free article] [PubMed]
49. Friedman L, Alder JD, Silverman JA. Antimicrob Agents Chemother. 2006;50:2137–2145. [PMC free article] [PubMed]
50. Dunny GM, Lee LN, LeBlanc D. Appl Environ Microbiol. 1991;57:1194–1201. [PMC free article] [PubMed]
51. Camilli A, Portnoy A, Youngman P. J Bacteriol. 1990;172:3738–3744. [PMC free article] [PubMed]
52. Schnitger H, Papenberg K, Ganse E, Czok R, Buecher T, Adam H. Biochem Z. 1959;332:167–185. [PubMed]
53. Hanahan D. J Mol Biol. 1983;166:557–572. [PubMed]
54. Yu D, Ellis HM, Lee EC, Jenkins NA, Copeland NG, Court DL. Proc Natl Acad Sci USA. 2000;97:5978–5983. [PMC free article] [PubMed]
55. Lee CY, Buranen SL, Ye Z-H. Gene. 1991;103:101–105. [PubMed]
56. Kreiswirth BN, Lofdahl S, Betley MJ, O'Reilly M, Schlievert PM, Bergdoll MS, Novick RP. Nature. 1983;305:709–712. [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...