Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. 2007 Jun 12; 104(24): 10205–10210.
Published online 2007 Jun 5. doi:  10.1073/pnas.0704000104
PMCID: PMC1891263
Microbiology

Involvement of host cellular multivesicular body functions in hepatitis B virus budding

Abstract

Hepatitis B virus (HBV) is a major human pathogen that chronically infects ≈350 million people, causing liver disease and liver cancer. HBV virions bud into an endoplasmic reticulum (ER)-associated intracellular compartment, but the mechanisms of HBV assembly, budding, and release remain poorly understood. Budding of retroviruses and some other enveloped RNA viruses from plasma membranes requires host functions involved in protein sorting into late endosomal multivesicular bodies (MVBs). To determine whether budding of DNA-containing HBV virions at intracellular membranes also involves MVB functions, we used immunofluorescence to show that, in human hepatoma cells, HBV envelope protein colocalizes with MVB proteins AIP1/ALIX and VPS4B. We also found that a dominant negative (DN) AIP1 mutant inhibited production and/or release of enveloped virions without significant effects on intracellular nucleocapsid formation, whereas DN VPS4B inhibited both nucleocapsid production and budding. By contrast, DN AIP1 and VPS4 had no effect on the efficiency of release of enveloped, nucleocapsid-lacking HBV subviral particles, which are produced in vast excess over virions, and dramatically increased the release of unenveloped, naked nucleocapsids by an apparently nonlytic route. Thus, host MVB functions are required for efficient budding and release of enveloped HBV virions and may be a valuable target for HBV control. Moreover, HBV enveloped virions, enveloped subviral particles, and unenveloped nucleocapsids are all released by distinct pathways with separate host factor requirements.

Keywords: antiviral control, hepadnavirus, vacuolar protein sorting, virus replication, virus–host interaction

Hepatitis B virus (HBV) chronically infects 350 million people worldwide (1). Approximately 15–40% of HBV carriers develop cirrhosis, liver failure, and/or hepatocellular carcinoma (1), making HBV one of the most important human tumor viruses. Infectious HBV virions, also called Dane particles, are double-shelled, 42-nm spheres containing a 3.2-kb, relaxed circular ds viral DNA inside an inner icosahedral nucleocapsid and an outer shell containing three viral envelope proteins (S, M, and L) and presumably lipid (24). In the nuclei of infected cells, HBV virion DNA is converted into covalently closed circular viral DNA and transcribed to produce a terminally redundant pregenomic RNA (pgRNA). HBV core protein encapsidates this pgRNA together with the viral DNA polymerase into nucleocapsids (NCs), within which pgRNA is reverse transcribed into dsDNA (5). Mature, DNA-containing NCs can then be enveloped by the viral surface proteins, yielding progeny virions (3).

HBV virion budding and release currently are poorly understood. Among other factors complicating study of these processes, HBV-infected cells or cells transfected with HBV genomic DNA produce, in addition to virions, a dramatic excess of subviral particles (SVPs), which are 20-nm diameter spherical and filamentous particles consisting only of lipid and HBV envelope proteins, predominantly S (3, 4, 6). SVPs can reach levels 10,000-fold higher than infectious virions in the serum of HBV carriers, where they may act as immunological decoys. HBV envelope proteins primarily accumulate at an endoplasmic reticulum (ER)–Golgi intermediate compartment, where SVPs apparently bud into the lumen and exit the cell by the general secretory pathway (7, 8). In the absence of more direct information, it is generally presumed that HBV virions bud into the same compartment and exit the cell by the same secretory pathway (3). However, the extent to which virion production parallels or is distinct from SVP production remains an unanswered question with crucial implications for the mechanisms and control of HBV infection. HBV envelope proteins have been reported to interact with several host proteins, including a homolog of clathrin-associated adapter proteins, suggesting that production of virions or subviral particles may involve host functions (9, 10). In addition to enveloped particles, unenveloped, naked NCs are released from cells replicating HBV, but their functional implications and pathways of release remain mysterious (1113).

Virion budding by some enveloped RNA viruses requires functions in the host vacuolar protein sorting (VPS) pathway, which acts at late endosomal membranes to cluster and then internalize monoubiquitinated cargo proteins by budding vesicles into the endosomal lumen to form multivesicular bodies (MVBs) (1416). MVB vesicle formation and cargo protein sorting depend on at least 17 class E VPS proteins (1416), most of which are components of endosomal sorting complexes required for transport (ESCRT)-I, -II, and -III (1719). Some class E proteins are binding partners for virion proteins of MVB-dependent viruses, suggesting that these viruses bind class E proteins to gain access to downstream machinery that catalyzes MVB vesicle budding. HIV-1 gag, e.g., interacts with class E proteins TSG101, an ESCRT-I component, and AIP1/ALIX (hereafter AIP1), an ESCRT-I and -III binding partner (2025). Depleting TSG101 by small interfering RNAs or expressing dominant negative (DN) AIP1 inhibits HIV-1 assembly and budding, resulting in the accumulation of partially budded virions that remain connected to the plasma membrane (21, 24). HIV-1 release is also inhibited by DN mutants of VPS4A and VPS4B, the closely related human paralogs of VPS4, an ATPase required for the VPS pathway (21, 2527). MVB functions have been similarly implicated in budding by other enveloped RNA viruses, including other retroviruses (2833), rhabdoviruses (34), filoviruses (22, 35, 36), arenaviruses (37, 38), paramyxoviruses (39, 40), and probably also orthomyxoviruses (41). Therefore, host MVB machinery may be widely exploited for viral budding.

To date, most viruses shown to use MVB functions for budding have been RNA viruses that bud through the plasma membrane. One such virus, HIV-1, had been proposed to bud into late endosomes in some cells (4244), but recent results imply that HIV-1 assembly and budding occur at the plasma membrane, with endosomal localization of virions occurring by internalization from the plasma membrane (45). Thus, it remains a significant question whether MVB functions are required for virion budding into internal compartments, as occurs for HBV, the SARS coronavirus, and some other viruses.

To address these issues and to better understand virus–host interactions in the late steps of HBV replication, here we examined whether HBV budding into an intracellular compartment depends on or is independent of MVB functions. We show by immunofluorescence that HBV envelope proteins significantly colocalize with two class E proteins, VPS4B and AIP1. We also find that a DN form of AIP1 inhibits production of extracellular enveloped HBV virions without significantly inhibiting intracellular NC assembly, revealing that HBV virion budding and/or release require MVB functions. DN VPS4B also inhibited budding, although often in combination with reduction of intracellular NC levels. Moreover, DN AIP1 and VPS4B had no effect on extracellular SVP release, establishing a significant distinction between the pathways producing enveloped HBV virions and SVPs. Finally, we show that blocking enveloped HBV virion release by DN AIP1 or VPS4B dramatically increases the levels of extracellular unenveloped NCs. Overall, the results advance understanding of HBV virion production, SVP production, and host interactions, as well as identify new targets for HBV control and provide precedents for other viruses that bud into intracellular compartments.

Results

HBV Envelope Proteins Colocalize with Human Class E Proteins.

To explore whether MVB functions may be involved in HBV replication and budding, we compared the intracellular distribution of HBV envelope proteins as key components of virion budding and the distribution of class E proteins AIP1 and VPS4B, as factors functioning in early and late steps, respectively, of the MVB pathway (15). Huh-7 human hepatoma cells were cotransfected with plasmids expressing a cloned, replication-competent HBV genome and FLAG-tagged AIP1 or VPS4B. After 3 days, the cells were visualized by fluorescence microscopy by using antibodies against HBV envelope protein surface antigen (HBsAg) and FLAG. As shown in Fig. 1, HBsAg immunofluorescence showed a punctate pattern having significant colocalization with AIP1 and VPS4B. On the basis of digital analysis of multiple cell images, 72% and 68% of HBsAg-labeled pixels colocalized with AIP1 and VPS4B, respectively.

Fig. 1.
HBV envelope protein colocalizes with class E proteins in Huh-7 cells. Huh-7 cells were cotransfected with plasmids expressing the HBV genome and FLAG-tagged class E proteins AIP1 or VPS4B. The cells were fixed 3 days after transfection, stained with ...

DN Class E Proteins Inhibit HBV Replication.

To test for functional involvement of the above class E proteins in HBV replication, we examined the effects of DN forms of AIP1 and VPS4B on the release of full, enveloped HBV virions. AIP1 contains N-terminal Bro1, central coiled-coil, and C-terminal proline-rich domains (46). A DN AIP1 derivative, AIP1DN, was constructed by deleting the C-terminal proline-rich domain and fusing the resulting junction to DsRed (23). VPS4BDN, kindly provided by Jiro Yasuda (Hokkaido University, Sapporo, Japan) contained the ATPase-inactivating mutation E235Q (25, 47). We first verified that these DN mutants inhibited MVB-dependent HIV-1 gag protein budding from human embryonic 293T cells cotransfected with plasmids expressing HIV-1 gag and AIP1DN or VPS4BDN (data not shown).

To examine the effects of DN mutants on HBV virion release, Huh-7 cells were cotransfected with plasmids expressing the WT HBV genome and AIP1DN or VPS4BDN. In addition to enveloped, infectious HBV virions, cells replicating HBV release enveloped, empty subviral particles lacking NCs and unenveloped, naked NCs (4, 1113). To distinguish complete HBV virions from such empty subviral particles and naked NCs, culture medium was harvested 4 days after transfection, and the levels of full, enveloped HBV virions were assayed by immunocapture with anti-HBsAg antibody followed by virion disruption and real-time PCR measurement of the number of HBV genomes. As shown in Fig. 2, the DsRed-fused AIP1DN mutant inhibited the release of full HBV virions by >70% in a dose-dependent manner, whereas cotransfecting a plasmid expressing DsRed alone reduced virion release by only 30%. Similarly, VPS4BDN reduced enveloped HBV virion release by >80%. Thus, class E MVB functions were necessary for normal production of extracellular HBV virions.

Fig. 2.
DN class E proteins reduce the amount of virions produced from Huh-7 cells. Huh-7 cells were cotransfected with plasmids expressing the HBV genome (0.25 μg) and DN derivatives of VPS4B or AIP1 (0.25 or 0.5 μg). Because the AIP1 mutant ...

DN AIP1 Blocks HBV Virion Release but Not Intracellular NC Formation.

To determine which HBV replication steps were impeded by AIP1DN (Fig. 2), cells expressing the WT HBV genome and AIP1DN were assayed for HBV pgRNA and core protein by Northern and Western blotting, respectively. To define the effect of AIP1DN on production of intracellular NCs and extracellular virions, cell lysate or culture medium samples were precipitated with antibodies against HBV core antigen (HBcAg) or HBsAg, respectively. Viral genome DNA then was labeled with [32P]deoxynucleotides by using an endogenous viral polymerase reaction (EPR) (12) and detected by gel electrophoresis. By these assays (Fig. 3), AIP1DN had no significant effect on the levels of pgRNA, capsid protein, and intracellular NCs (Fig. 3A). In particular, AIP1DN diminished intracellular NC levels by only 20%, similar to the nonspecific reduction in cells cotransfected with a DsRed-expressing plasmid (Fig. 3A). By contrast, budding efficiency (calculated as the ratio of EPR-labeled HBV DNA in released virions relative to that in intracellular NCs) was reduced by almost 60% in the presence of AIP1DN, whereas DsRed caused only a 20% reduction (Fig. 3B). Thus, disrupting the function of MVB gene AIP1DN inhibits the production of extracellular HBV virions in the late stages of virion assembly and/or budding.

Fig. 3.
DN AIP1 inhibits HBV virion release. (A) Huh-7 cells were cotransfected with plasmids expressing the HBV genome (0.25 μg) and DN mutant AIP1DN (0.25 or 0.5 μg). Total RNA was extracted and analyzed by Northern blotting to examine the levels ...

DN AIP1 Does Not Inhibit Subviral Particle Production and Increases Naked NC Release.

Because HBV SVPs are released from cells by the constitutive secretion pathway (7, 8), HBV virions might exit by the same pathway. Therefore, the inhibition of HBV virion release by AIP1DN (Fig. 3) might reflect a general distortion of the cell secretory apparatus. To test this possibility, we examined the effects of AIP1DN on SVP production. Huh-7 cells were cotransfected with plasmids expressing HBV S envelope protein and AIP1DN or DsRed and were labeled with [35S]methionine, and culture medium and cell lysate samples were immunoprecipitated with anti-HBsAg antibody. Compared with the DsRed control, AIP1DN had no detectable effect on the levels of secreted SVP in culture medium or on intracelluar S protein expression in cell lysates (Fig. 4 A and B). Thus, unlike virion release, SVP production and egress do not require the function of MVB/VPS factor AIP1.

Fig. 4.
DN AIP1 protein has no effect on SVP secretion but stimulates release of unenveloped NC. Huh-7 cells were cotransfected with plasmids expressing the HBV genome (0.25 μg) and DN mutant AIP1DN (0.5 μg). (A) Transfected Huh-7 cells were labeled ...

Besides infectious complete virions and empty enveloped SVPs, hepatoma cells transfected with WT HBV genome DNA release unenveloped, naked HBV NCs (1113). To examine the effect of AIP1DN on naked NC release, Huh-7 cells were cotransfected with plasmids expressing the HBV genome and AIP1DN, and, after 4 days, culture medium was immunoprecipitated with anti-HBcAg antibody without disrupting viral envelopes and subjected to the EPR assay. As shown in Fig. 4C, cells expressing DsRed released low levels of naked NCs, which contained predominantly linear dsDNA. AIP1DN expression caused a striking 9-fold increase in naked NCs released into the culture medium, shifting the extracellular to intracellular ratio of HBV linear dsDNA in naked NCs from <0.1 for the vector-only control to >0.7 for AIP1DN. Therefore, the AIP1DN mutant had differing effects on all three extracellular products of HBV infection: having no effect on SVP yield, inhibiting the yield of enveloped virions, and increasing the yield of unenveloped NCs.

DN VPS4B Inhibits Production of Intracellular NCs and Extracellular HBV Virions.

In contrast to AIP1DN, VPS4BDN inhibited HBV virion release by ≈90% but also reduced pgRNA and intracellular NC accumulation by ≈75% (Fig. 5). Some, if not most of the inhibition of pgRNA and intracellular NC accumulation was due to nonspecific effects of VPS4BDN on gene expression, because we found that VPS4BDN induced a 50–75% reduction of control non-HBV reporter genes in cotransfection experiments in the same Huh-7 cells. VPS4B mutants have similarly been reported to cause 50–70% reduction of HIV-1 Gag expression in 293T cells (25).

Fig. 5.
Effects of DN VPS4B on HBV replication. Huh-7 cells were cotransfected with plasmids expressing the HBV genome (0.25 μg) and DN mutant VPS4BDN (0.5 μg). Assays for pgRNA, 18S rRNA, intracellular and extracellular NCs, and extracellular ...

Nevertheless, some HBV-specific effects of VPS4BDN also were evident in Huh-7 cells. Like AIP1DN, VPS4BDN increased the release of nonenveloped NC to the medium by >10-fold (Fig. 5). The magnitude of this extracellular pool, which, as measured by HBV linear dsDNA, was 1.6-fold greater than the remaining residual intracellular pool, showed that as much as 50% of the reduced accumulation of intracellular NCs appears to represent diversion to envelope-independent extracellular release. As with AIP1DN-transfected cells, extracellular unenveloped NCs were enriched for those containing linear as opposed to relaxed circular dsDNA (Figs. 4C and and5),5), demonstrating, along with other results (see Discussion) that the extracellular NCs were produced by a selective pathway rather than by general release of the intracellular pool by, e.g., cell lysis.

Discussion

Requirement of Class E Proteins for HBV Virion Production.

Because of their small genome sizes, viruses use host cell machinery for many replication steps. Identifying these host functions is thus essential for understanding the mechanisms of virus replication and the full potential for virus control. For HBV replication, e.g., previous studies showed that chaperones Hsp90 and Hsp60 are required for HBV reverse transcriptase-mediated packaging of pgRNA into NCs (4850).

In this study, we found that HBV enveloped virion production and release require AIP1 and VPS4B, two class E MVB proteins involved in the host vacuolar protein-sorting pathway. Immunofluorescence revealed significant 68–72% colocalization of HBV envelope protein with AIP1 and VPS4B (Fig. 1). The remaining ≈30% of envelope protein that did not colocalize with these class E proteins may be involved in producing NC-lacking, enveloped subviral particles, which our results show to be MVB-independent (Fig. 4 A and B and discussion below). Moreover, coexpresssion studies demonstrated that DN forms of these proteins strongly blocked production of extracellular HBV virions (Figs. 2, ,3,3, and and55).

In particular, AIP1DN selectively inhibited HBV virion budding and/or release with only minor effects on the level of intracellular NCs (Figs. 2 and and3).3). As noted in the introduction, AIP1 has been implicated in the budding of some enveloped RNA viruses, although the precise mechanistic roles of this and other class E proteins in viral morphogenesis remain undefined (51, 52). AIP1 interacts with both ESCRT-I (TSG101) and ESCRT-III (CHMP4) components and thus may act as a bridge between these complexes to facilitate MVB sorting and vesicle formation (2325, 27, 53). AIP1 also is thought to have an important role in generating membrane curvature (52, 54). For some viruses, AIP1 provides primary or accessory access to the MVB machinery by serving as a binding target for viral late domains of the YPXL/LXXLF class (51, 55). Budding by the lentivirus equine infectious anemia virus (EIAV), e.g., strongly depends on interaction of its Gag subunit p9 with AIP1 (55). The p9 YPDL domain that binds AIP1 also binds the clathrin-associated AP2 adaptor complex that sorts cargo proteins into coated pits for endocytosis, and this interaction is important for EIAV budding (55). Interestingly, HBV envelope proteins S and L were recently reported to interact with, respectively, AP2 (10) and γ2-adaptin, a protein related to the large subunits of vesicle adaptor complexes such as AP2 (9, 56). Although the possible function of S–AP2 interaction is not known, L–γ2-adaptin interaction appears important for HBV virion production (56). Thus, like EIAV, HBV budding may use host functions not only in late endocytic/MVB pathways but also in early endocytic pathways.

Recently, Rost et al. (56) also found that HBV core protein interacts with ubiquitin ligase Nedd4 through a late domain-like PPAY motif and that a DN Nedd4 mutant reduced HBV virion production by 50%. Because Nedd4 family ubiquitin ligases facilitate budding of several retroviruses and RNA viruses by interaction with PPxY late domains in various viral proteins and appear linked to the MVB pathway (52), this further supports the involvement of MVB functions in HBV budding.

In contrast to the selective effects of AIP1DN on HBV budding, DN VPS4BDN inhibited accumulation not only of extracellular virions but also intracellular NCs (Fig. 5). Similar inhibition of HBV NC assembly in Huh-7 cells by a VPS4 dominant mutant was just reported independently (57). Our control experiments with reporter genes imply that much of this effect is due to nonspecific effects of VPS4BDN on gene expression in Huh-7 cells. In keeping with our results, VPS4 also inhibits HIV-1 Gag expression as well as HIV-1 budding (25). VPS4 is an ATPase required to dissociate and recycle all three ESCRT complexes from the endosomal membrane for further use (14, 16). VPS4 mutants lock the ESCRT machinery on the endosomal surface, block general endosomal protein and lipid transport and recycling, derange endosomal membrane morphology, have particularly broad spectrum effects on budding by MVB-dependent viruses (52), and through such consequences may be prone to nonspecific effects. Nevertheless, as for HIV-1, VPS4BDN inhibited HBV budding to a greater extent than it inhibited HBV protein expression, and it also selectively stimulated release of unenveloped NC (see below). Further experiments are needed to separate specific and nonspecific effects of VPS4 on HBV replication.

Distinct Pathways for Release of Enveloped Subviral Particles and Unenveloped Naked NCs.

Notably, DN AIP1DN strongly interfered with production of enveloped HBV virions (Fig. 3) but had no detectable effect on SVP production (Fig. 4 A and B). Similarly, although VPS4BDN reduced HBV S expression, it did not inhibit SVP release (data not shown). Thus, the mechanisms of SVP production must be clearly distinct from those for enveloped HBV virions and likely independent of MVB functions. The lipids associated with SVPs have a highly restricted composition and are largely immobilized, in contrast to typical lipid mobility in membranes, leading to the proposal that SVP lipids are not organized in a normal bilayer (58). If SVPs lack a lipid bilayer, then their formation or extrusion from S protein-containing membranes would likely involve processes quite distinct from the bilayer vesicle budding associated with the MVB pathway and usual enveloped virion production. Thus, the membrane sites of SVP formation and virion budding might be the same, but their mechanisms must be highly distinct, indicating that any comparisons between the two must be approached with considerable caution.

In addition to virions and SVPs, extracellular, unenveloped NCs are often observed with HBV (11), but the mechanism of their release is not known. Cotransfection of AIP1DN or VPS4BDN dramatically increased release of naked NCs (Figs. 4C and and5).5). This striking increase is inconsistent with release by cell lysis, because the resulting level of extracellular naked NCs approached that of intracellular NCs, yet AIP1DN did not induce apparent cytotoxicity or significant inhibition of HBV expression (Figs. 3 and and4).4). Moreover, extracellular NCs did not simply mirror the intracellular pool but were enriched for linear DNA (Figs. 4C and and5),5), implying selective release. On the basis of varied observations, nonlytic release has been suggested for several nonenveloped viruses, with cellular autophagy and exocytosis proposed as one possible mechanism (59). Similar mechanisms could explain release of unenveloped HBV NCs and may have implications for normal NC trafficking. AIP1DN might stimulate naked NC release by blocking normal virion budding or because some cell factors function in both the VPS pathway and autophagy (60).

Current therapies for chronic HBV infection include IFN-α and HBV DNA polymerase inhibitors, but these treatments have significant side effects and limited efficacy due to the emergence of drug-resistant HBV variants (1). Therefore, new targets are needed for improved treatment of chronic HBV carriers. Identifying and characterizing host functions in HBV replication not only advance understanding of HBV replication mechanisms but also provide valuable new targets for such antiviral therapies. As shown here, the substantial inhibition of HBV replication on interfering with MVB functions AIP1 and VPS4 imply that these class E proteins may represent candidate targets for anti-HBV drugs.

Materials and Methods

Plasmids.

Plasmid pLJ144wt, which produces WT HBV subtype ayw (GenBank accession no. V01460) upon transfection into hepatoma cells, was derived from pLJ144 (kindly provided by Daniel Loeb, University of Wisconsin, Madison), a derivative of pLJ196 (61). pLJ144 expresses HBV pgRNA under the control of the cytomegalovirus immediate early promoter, and expresses HBV polymerase and core, but not HBV envelope proteins because of two mutations at the start codon of the S ORF (61). pLJ144wt was generated by restoring the envelope mutations in pLJ144 to WT, as verified by DNA sequencing. Expression plasmids for FLAG-tagged AIP1, VPS4B, and VPS4B mutant E235Q were kindly provided by Jiro Yasuda. DNA encoding AIP1 codons 1–702 were amplified by PCR and inserted into pDsRed2-N1 (Clontech, Mountain View, CA) to generate an AIP1DN expression plasmid.

Cell Culture, Transfection, and Harvest.

Human hepatoma cell line Huh-7 was grown in DMEM-F12 medium supplemented with 10% FBS at 37°C in 5% CO2. To produce HBV virions, 0.25 μg of pLJ144wt, 0.5 μg of AIP1, or VPS4B effecter plasmid and 1.5 μl of TransIT LT-1 (Mirus, Madison, WI) were incubated at room temperature for 15 min and added to 3.5 × 105 Huh7 cells in DMEM-F12 with 10% FBS. Experiments using fluorescence analysis as in Fig. 1 showed that, in such cotransfections, >90% of cells expressing HBV also expressed the second cotransfected marker. As is typical in hepadnavirus experiments due to the relatively slow kinetics of viral replication and morphogenesis (62), cells and culture media were harvested for further analysis 4 days after transfection.

Confocal Immunofluorescence Microscopy.

Three days after transfection, cells were fixed with 3.7% formaldehyde (in PBS) for 20 min, permeabilized with 0.1% Triton X-100 for 10 min at room temperature, blocked with 1% normal horse serum in PBS, and incubated with primary antibodies for 1 h, followed by AlexaFluor-conjugated secondary antibodies. Images were acquired with a Bio-Rad (Hercules, CA) Radiance 2100 MP Rainbow confocal microscope at the W. M. Keck Laboratory for Biological Imaging of the University of Wisconsin, Madison. Signal colocalization was analyzed with the program Colocalizer Pro (Colocalization Research Software, Boise, ID).

Real-Time PCR Measurement of Genome Copy Number in HBV Virions.

The wells of a microtiter PCR plate were coated with monoclonal anti-HBsAg antibody (Hytest, Turku, Finland) at 1:2,000 dilution and blocked with 1% BSA in PBS. For each sample, 10 μl of LJ144wt-transfected Huh-7 cell culture supernatant was added to an individual well and incubated overnight at 4°C. Ten microliters of PCR mixture, containing AmpliTaq Gold (Applied Biosystems, Foster City, CA), 0.45 μM HBV primers (reverse primer: CCCCAATACCACATCATCCATATA; forward primer: CCTATGGGAGTGGGCCTCA), and 0.225 μM of HBV probe (5′ FAM- CACTGAACAAATGGCACTAGTAAACTGAGCCA-3′TAMRA) (63) was added into each reaction well. The number of HBV genome copies was measured by real-time PCR on an ABI Prism 7700.

Subviral Particle (SVP) Preparation, Western and Northern Blotting, and EPR.

To prepare 35S-labeled SVPs, transfected cells were labeled for 3 days with 150 μCi (1 Ci = 37 GBq) of [35S]methionine (15 mCi/ml; Amersham, Piscataway, NJ). For extracellular SVPs, the medium was clarified by spinning at 5,000 × g for 15 min at 4°C, layered over a 20% sucrose cushion, centrifuged at 4°C for 1 h at 45,000 rpm in a Beckman (Fullerton, CA) TLS55 rotor, and the pellet resuspended in lysis buffer [0.1 M NaCl/0.1 M Tris-Cl (pH 8.0)/10 mM EDTA/0.5% (vol/vol) Nonidet P-40/2 mM phenylmethylsulfonyl fluoride/2 μg/ml of leupeptin). For intracellular virions, cells were washed with ice-cold PBS, lysed with 750 μl of lysis buffer, and clarified by centrifuging at 12,000 rpm for 3 min at 4°C. Protein G agarose prebound to anti-HBsAg antibody was added to the cleared lysates or concentrated SVP, incubated overnight at 4°C with rotation, and washed three times with lysis buffer without proteinase inhibitors. Proteins were eluted from the beads by boiling in sample loading buffer and analyzed by electrophoresis in a 12.5% SDS-polyacrylamide gel that was dried for autoradiography.

Intra- or extracellular NC and extracellular virions were isolated by capsid- or envelope-specific immunoprecipitations, respectively, before detecting the encapsidated HBV progeny DNA by radioactive labeling with [α-32P]dCTP in an EPR incorporating nonionic detergent to permeabilize virion envelopes. For more details about EPR and Western and Northern blotting, see supporting information (SI) Materials and Methods.

Supplementary Material

Supporting Text:

Acknowledgments

We thank Dr. D. Loeb for multiple HBV expression plasmids and valuable comments; Dr. Jiro Yasuda for AIP1 and VPS4 plasmids; the W. M. Keck Laboratory for Biological Imaging for assistance with confocal microscopy; and members of our laboratory for comments and assistance. This work was supported by National Institutes of Health Grant CA22443. P.A. is an Investigator of the Howard Hughes Medical Institute. T.W. was supported in part by a Japan Society for the Promotion of Science Postdoctoral Fellowship for Research Abroad.

Abbreviations

DN
dominant negative
ER
endoplasmic reticulum
EPR
endogenous viral polymerase reaction
ESCRT
endosomal sorting complexes required for transport
HBcAg
HBV core antigen
HBsAg
HBV envelope protein surface antigen
HBV
hepatitis B virus
MVB
multivesicular body
NC
nucleocapsid
pgRNA
pregenomic RNA
SVP
subviral particle
VPS
vacuolar protein sorting.

Footnotes

The authors declare no conflict of interest.

This article contains supporting information online at www.pnas.org/cgi/content/full/0704000104/DC1.

References

1. Lavanchy D. J Viral Hepat. 2004;11:97–107. [PubMed]
2. Dryden KA, Wieland SF, Whitten-Bauer C, Gerin JL, Chisari FV, Yeager M. Mol Cell. 2006;22:843–850. [PubMed]
3. Bruss V. World J Gastroenterol. 2007;13:65–73. [PMC free article] [PubMed]
4. Ganem D, Schneider R. In: Fields Virology. Knipe DM, Howley PM, editors. Philadelphia: Lippincott Williams & Wilkins; 2001. pp. 2923–2969.
5. Beck J, Nassal M. World J Gastroenterol. 2007;13:48–64. [PMC free article] [PubMed]
6. Gilbert RJ, Beales L, Blond D, Simon MN, Lin BY, Chisari FV, Stuart DI, Rowlands DJ. Proc Natl Acad Sci USA. 2005;102:14783–14788. [PMC free article] [PubMed]
7. Huovila AP, Eder AM, Fuller SD. J Cell Biol. 1992;118:1305–1320. [PMC free article] [PubMed]
8. Patzer EJ, Nakamura GR, Simonsen CC, Levinson AD, Brands R. J Virol. 1986;58:884–892. [PMC free article] [PubMed]
9. Hartmann-Stuhler C, Prange R. J Virol. 2001;75:5343–5351. [PMC free article] [PubMed]
10. Toh QC, Tan TL, Teo WQ, Ho CY, Parida S, Chen WN. Int J Med Sci. 2005;2:114–117. [PMC free article] [PubMed]
11. Gerelsaikhan T, Tavis JE, Bruss V. J Virol. 1996;70:4269–4274. [PMC free article] [PubMed]
12. Bruss V, Ganem D. Proc Natl Acad Sci USA. 1991;88:1059–1063. [PMC free article] [PubMed]
13. Sureau C, Romet-Lemonne JL, Mullins JI, Essex M. Cell. 1986;47:37–47. [PubMed]
14. Katzmann DJ, Odorizzi G, Emr SD. Nat Rev Mol Cell Biol. 2002;3:893–905. [PubMed]
15. Babst M. Traffic. 2005;6:2–9. [PubMed]
16. Raiborg C, Rusten TE, Stenmark H. Curr Opin Cell Biol. 2003;15:446–455. [PubMed]
17. Katzmann DJ, Babst M, Emr SD. Cell. 2001;106:145–155. [PubMed]
18. Babst M, Katzmann DJ, Estepa-Sabal EJ, Meerloo T, Emr SD. Dev Cell. 2002;3:271–282. [PubMed]
19. Babst M, Katzmann DJ, Snyder WB, Wendland B, Emr SD. Dev Cell. 2002;3:283–289. [PubMed]
20. Demirov DG, Ono A, Orenstein JM, Freed EO. Proc Natl Acad Sci USA. 2002;99:955–960. [PMC free article] [PubMed]
21. Garrus JE, von Schwedler UK, Pornillos OW, Morham SG, Zavitz KH, Wang HE, Wettstein DA, Stray KM, Cote M, Rich RL, et al. Cell. 2001;107:55–65. [PubMed]
22. Martin-Serrano J, Zang T, Bieniasz PD. Nat Med. 2001;7:1313–1319. [PubMed]
23. Martin-Serrano J, Yarovoy A, Perez-Caballero D, Bieniasz PD. Proc Natl Acad Sci USA. 2003;100:12414–12419. [PMC free article] [PubMed]
24. Strack B, Calistri A, Craig S, Popova E, Gottlinger HG. Cell. 2003;114:689–699. [PubMed]
25. von Schwedler UK, Stuchell M, Muller B, Ward DM, Chung HY, Morita E, Wang HE, Davis T, He GP, Cimbora DM, et al. Cell. 2003;114:701–713. [PubMed]
26. Scheuring S, Rohricht RA, Schoning-Burkhardt B, Beyer A, Muller S, Abts HF, Kohrer K. J Mol Biol. 2001;312:469–480. [PubMed]
27. Martin-Serrano J, Zang T, Bieniasz PD. J Virol. 2003;77:4794–4804. [PMC free article] [PubMed]
28. Le Blanc I, Prevost MC, Dokhelar MC, Rosenberg AR. J Virol. 2002;76:10024–10029. [PMC free article] [PubMed]
29. Puffer BA, Watkins SC, Montelaro RC. J Virol. 1998;72:10218–10221. [PMC free article] [PubMed]
30. Wang H, Norris KM, Mansky LM. J Virol. 2002;76:8485–8493. [PMC free article] [PubMed]
31. Wills JW, Cameron CE, Wilson CB, Xiang Y, Bennett RP, Leis J. J Virol. 1994;68:6605–6618. [PMC free article] [PubMed]
32. Yasuda J, Hunter E. J Virol. 1998;72:4095–4103. [PMC free article] [PubMed]
33. Yuan B, Campbell S, Bacharach E, Rein A, Goff SP. J Virol. 2000;74:7250–7260. [PMC free article] [PubMed]
34. Craven RC, Harty RN, Paragas J, Palese P, Wills JW. J Virol. 1999;73:3359–3365. [PMC free article] [PubMed]
35. Harty RN, Brown ME, Wang G, Huibregtse J, Hayes FP. Proc Natl Acad Sci USA. 2000;97:13871–13876. [PMC free article] [PubMed]
36. Kolesnikova L, Berghofer B, Bamberg S, Becker S. J Virol. 2004;78:12277–12287. [PMC free article] [PubMed]
37. Strecker T, Eichler R, Meulen J, Weissenhorn W, Dieter Klenk H, Garten W, Lenz O. J Virol. 2003;77:10700–10705. [PMC free article] [PubMed]
38. Perez M, Craven RC, de la Torre JC. Proc Natl Acad Sci USA. 2003;100:12978–12983. [PMC free article] [PubMed]
39. Schmitt AP, Leser GP, Morita E, Sundquist WI, Lamb RA. J Virol. 2005;79:2988–2997. [PMC free article] [PubMed]
40. Sakaguchi T, Kato A, Sugahara F, Shimazu Y, Inoue M, Kiyotani K, Nagai Y, Yoshida T. J Virol. 2005;79:8933–8941. [PMC free article] [PubMed]
41. Hui EK, Barman S, Yang TY, Nayak DP. J Virol. 2003;77:7078–7092. [PMC free article] [PubMed]
42. Pelchen-Matthews A, Kramer B, Marsh M. J Cell Biol. 2003;162:443–455. [PMC free article] [PubMed]
43. Nguyen DG, Booth A, Gould SJ, Hildreth JE. J Biol Chem. 2003;278:52347–52354. [PubMed]
44. Ono A, Freed EO. J Virol. 2004;78:1552–1563. [PMC free article] [PubMed]
45. Jouvenet N, Neil SJ, Bess C, Johnson MC, Virgen CA, Simon SM, Bieniasz PD. PLoS Biol. 2006;4:e435. [PMC free article] [PubMed]
46. Sadoul R. Biol Cell. 2006;98:69–77. [PubMed]
47. Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S, Himeno M. J Cell Sci. 2003;116:401–414. [PubMed]
48. Hu J, Seeger C. Proc Natl Acad Sci USA. 1996;93:1060–1064. [PMC free article] [PubMed]
49. Park SG, Jung G. J Virol. 2001;75:6962–6968. [PMC free article] [PubMed]
50. Hu J, Toft DO, Seeger C. EMBO J. 1997;16:59–68. [PMC free article] [PubMed]
51. Fisher RD, Chung HY, Zhai Q, Robinson H, Sundquist WI, Hill CP. Cell. 2007;128:841–852. [PubMed]
52. Morita E, Sundquist WI. Annu Rev Cell Dev Biol. 2004;20:395–425. [PubMed]
53. Katoh K, Shibata H, Suzuki H, Nara A, Ishidoh K, Kominami E, Yoshimori T, Maki M. J Biol Chem. 2003;278:39104–39113. [PubMed]
54. Matsuo H, Chevallier J, Mayran N, Le Blanc I, Ferguson C, Faure J, Blanc NS, Matile S, Dubochet J, Sadoul R, et al. Science. 2004;303:531–534. [PubMed]
55. Chen C, Vincent O, Jin J, Weisz OA, Montelaro RC. J Biol Chem. 2005;280:40474–40480. [PubMed]
56. Rost M, Mann S, Lambert C, Doring T, Thome N, Prange R. J Biol Chem. 2006;281:29297–29308. [PubMed]
57. Kian Chua P, Lin MH, Shih C. Virology. 2006;354:1–6. [PubMed]
58. Satoh O, Imai H, Yoneyama T, Miyamura T, Utsumi H, Inoue K, Umeda M. J Biochem (Tokyo) 2000;127:543–550. [PubMed]
59. Jackson WT, Giddings TH, Jr, Taylor MP, Mulinyawe S, Rabinovitch M, Kopito RR, Kirkegaard K. PLoS Biol. 2005;3:e156. [PMC free article] [PubMed]
60. Wang CW, Klionsky DJ. Mol Med. 2003;9:65–76. [PMC free article] [PubMed]
61. Liu N, Ji L, Maguire ML, Loeb DD. J Virol. 2004;78:642–649. [PMC free article] [PubMed]
62. Perlman D, Hu J. J Virol. 2003;77:2287–2294. [PMC free article] [PubMed]
63. Zanella I, Rossini A, Domenighini D, Albertini A, Cariani E. Eur J Clin Microbiol Infect Dis. 2002;21:22–26. [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...