• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of neoplasiaLink to Publisher's site
Neoplasia. May 2007; 9(5): 406–417.
PMCID: PMC1877982

Membrane-Type 1 Matrix Metalloproteinase Is Regulated by Sp1 through the Differential Activation of AKT, JNK, and ERK Pathways in Human Prostate Tumor Cells1

Abstract

We and other investigators have previously shown that membrane-type 1 matrix metalloproteinase (MT1-MMP) is overexpressed in invasive prostate cancer cells. However, the mechanism for this expression is not known. Here, we show that MT1-MMP is minimally expressed in nonmalignant primary prostate cells, moderately expressed in DU-145 cells, and highly expressed in invasive PC-3 and PC-3N cells. Using human MT1-MMP promoter reporter plasmids and mobility shift assays, we show that Sp1 regulates MT1-MMP expression in DU-145, PC-3, and PC-3N cells and in PC3-N cells using chromatin immunoprecipitation analysis and silencing RNA. Investigation of signaling pathway showed that DU-145 cells express constitutively phosphorylated extracellular stress-regulated kinase (ERK), whereas PC-3 and PC-3N cells express constitutively phosphorylated AKT/PKB and c-Jun NH2 terminal kinase (JNK). We show that MT1-MMP and Sp1 levels are decreased in PC-3 and PC-3N cells when phosphatidylinositol-3 kinase and JNK are inhibited, and that MT1-MMP levels are decreased in DU-145 cells when MEK is inhibited. Transient transfection of PC-3 and PC-3N cells with a dominant-negative JNK or p85, and of DU-145 cells with a dominant negative ERK, reduces MT1-MMP promoter activity. These results indicate differential signaling control of Sp1-mediated transcriptional regulation of MT1-MMP in prostate cancer cell lines.

Keywords: MT1-MMP, Sp1, AKT, MAP kinases, prostate cancer

Introduction

Prostate adenocarcinoma is the most commonly diagnosed noncutaneous cancer and second leading cause of cancer-related deaths in American men [1]. Death due to prostate cancer is attributed to metastatic disease in which primary tumors evade the prostate capsule and eventually metastasize. This presents a large problem considering that current diagnostic procedures do not readily determine whether an individual with indolent disease will develop aggressive metastatic disease. To reduce mortality due to prostate cancer, it is imperative to develop an in-depth understanding of molecular events that occur during prostate cancer progression and metastasis to identify key features and molecular alterations suitable for use as diagnostic markers or therapeutic targets.

Matrix metalloproteinases are a family of zinc-binding proteases that have been shown to contribute to prostate cancer metastasis through their ability to degrade extracellular matrix proteins [2,3]. Membrane type matrix metalloproteinases consist of MT1, MT2, MT3, MT4, MT5, and MT6 MMP, and are unique from other MMP family members in that they harbor a transmembrane domain [4]. Membrane-type 1 matrix metalloproteinase (MT1-MMP) is an MT-MMP family member involved in pericellular proteolysis associated with cell migration [5]. MT1-MMP is widely expressed in human tissues under normal and pathological conditions and is increased in numerous types of tumors. In prostate cancer tissues, MT1-MMP expression is enhanced [6–8], and the enzyme has a prominent role in increasing prostate cell migration through cleavage of basement membrane proteins laminin-511 [9] and laminin-332 [8,10]. Although MT1-MMP expression is increased in prostate cancer tumor tissues, evidence of elevated expression in prostate tumor cell lines is variable. We and others have previously shown that MT1-MMP becomes highly expressed in invasive prostate cell lines compared to normal prostate cells grown in culture [8,11,12]. However, other investigators have reported that MT1-MMP mRNA expression is not increased in prostate tumor cell lines [13]. In this study, we provide evidence that MT1-MMP expression is indeed constitutively elevated in prostate tumor cell lines and identify mechanisms of this increased expression.

The regulation of MT1-MMP is complex and occurs through both transcriptional and posttranscriptional mechanisms [5]. MT1-MMP transcriptional control is unique compared to other MMP family members due to differences in its promoter sequence. Unlike most MMP family members, MT1-MMP lacks the typical TATA box and contains a GC-rich sequence immediately upstream of four transcriptional start sites [14]. Lohi et al. [14] identified this GC-rich region as the putative binding sequence for the specificity protein-1 (Sp1) transcription factor. Constitutive MT1-MMP regulation through Sp1 binding to the human promoter of MT1-MMP has been identified in the context of HT-1080 fibrosarcoma cells [14] and with the murine MT1-MMP promoter in microvascular endothelial and rat glomerular mesangial cells [15,16].

Sp1 is a zinc finger transcription factor of the Sp/Kruppel-like factor family, which regulates constitutive levels of genes involved in various physiological processes, including apoptosis, angiogenesis, and cell cycle regulation in both normal and malignant tissues [17]. Sp1 is overexpressed in gastric [18] and pancreatic cancers [19], and has a prominent role in regulating genes involved in angiogenesis such as vascular endothelial growth factor (VEGF) [20,21]. Interestingly, Sp1 has also been shown to regulate genes involved in prostate cancer metastasis, including urokinase plasminogen activator (uPA), prostate-specific antigen (PSA), and the α6 integrin subunit [22–24]. Sp1 activity is modified through posttranslational modifications, including phosphorylation [25]. Phosphorylation of Sp1 in serine and threonine residues located throughout the entire length of the protein results in functional alterations that increase either DNA binding or transactivation activities. Although the precise Sp1 residues phosphorylated have been mapped for several kinases, including DNA-PK, cyclin D1, and extracellular signal-regulated kinase (ERK) 1/2 (as reviewed in Chu and Ferro [25]), numerous studies indicate that additional kinases also regulate Sp1. Kinase pathways, including the c-Jun NH2-terminal kinase (JNK) pathway and the phosphatidylinositol-3 kinase (PI3K) pathway, through AKT, have been shown to increase Sp1 phosphorylation and the transactivation of target genes [20-22].

Notably, the AKT, JNK, and ERK pathways have also been implicated in regulating MT1-MMP independently of Sp1 in various cell systems. AKT signaling has been shown to increase MT1-MMP expression through various stimuli in human pancreatic cancer and in a Lewis lung carcinoma subline [26,27]. Additionally, JNK and PI3K signaling increased MT1-MMP in endothelial cells, and JNK was specifically implicated in increasing MT1-MMP expression in endothelial cells [28]. Activated ERK signaling was also shown to regulate MT1-MMP in HT1080 [29] and in cervical cancer cells [30], and downregulation of constitutive ERK was shown to inhibit MT1-MMP in various types of tumor cell lines [31]. However, constitutive regulation of MT1-MMP through these pathways has not been investigated in prostate cancer cell lines.

In this study, we document for the first time that MT1-MMP expression in prostate cancer is dependent on Sp1. We also show that levels of MT1-MMP vary in different prostate cancer cell lines and that these levels directly correlate with and are dependent on the differential expression of constitutive kinase signaling pathways in each cell line. Interestingly, cells expressing the highest levels of MT1-MMP express constitutive AKT and JNK, whereas cells expressing moderate levels of MT1-MMP express constitutive ERK. We show for the first time that inhibition of these pathways in prostate cancer decreases MT1-MMP expression. These results indicate that MT1-MMP regulation in prostate cancer cell lines is a complex process dependent on Sp1 regulation and on the constitutive activity of signaling pathways involved with tumor progression.

Materials and Methods

Reagents and Cell Culture

Human prostate cancer DU-145 and PC-3 cells (American Type Tissue Collection, Manassas, VA) and PC-3N cells (variant of PC-3 cells described previously) [32] were maintained in Iscove's modified Dulbecco's medium (IMDM; Invitrogen Life Technologies, Carlsbad, CA) supplemented with 100 mg/ml penicillin, 100 mg/ml streptomycin (Invitrogen Life Technologies), and 10% fetal bovine serum (FBS; Gemini Bioproducts, Woodland CA). Human prostate primary epithelial cells (PrEC) were obtained from Clonetics (Cambrex, East Rutherford, NJ) and maintained in Clonetics-recommended PreGM medium. All cells were maintained at 37°C in a humidified 5% CO2 incubator. The Western blot analysis antibody against MT1-MMP (AB815 polyclonal) was from Chemicon (Millipore, Billerica, MA), and Sp1 polyclonal was from Santa Cruz Biotechnologies (Santa Cruz, CA). Antibodies against phosphorylated and total ERK, AKT, and JNK were from Cell Signaling Technologies (Danvers, MA), and α-tubulin monoclonal antibody was from Calbiochem (San Diego, CA). Antibodies used for mobility shift assays and chromatin immunoprecipitation (ChIP) include Sp1 polyclonal and rabbit IgG from Santa Cruz Biotechnologies, and Sp3 polyclonal from Geneka (Montreal, Canada). The specific inhibitor for PI3K (LY294002) was obtained from LC Laboratories (Woburn, MA). Specific inhibitors for JNK (SP600125) and MEK (PD98059) were obtained from Calbiochem.

Plasmid Constructs

MT1-MMP luciferase reporter constructs (MT-LUC) used to study MT1-MMP expression have been described previously and were a kind gift from Dr. Jorma Keski-Oja (Department of Virology and Pathology, Haartman Institute of Helsinki, Helsinki, Finland). The parent vector for the MT-LUC expression vector pGL3 basic was obtained from Promega (Fitchburg, WI). Dominant-negative ERK and JNK constructs were kind gifts from Dr. Z. Dong (Hormel Institute, University of Minnesota, Austin, MN), and dominant-negative p85 and SR α control vectors were a kind gift from Dr. Q. Chen (Department of Pharmacology, College of Medicine, University of Arizona, Tuczon, AZ) and were originally described by Dr. M. Kasuga (Kobe University School of Medicine, Kobe, Japan). The control vectors for the dominant-negative ERK and JNK vectors were pcEP4 and pCMV5, respectively (Invitrogen Life Technologies).

Transient Transfection and Luciferase Analysis

PC-3N, PC-3, and DU-145 cells were grown to log phase by splitting 24 hours before trypsinization, counted using a Coulter Counter (Beckman Coulter, Fullerton, CA), and plated in varying densities in 0.5 ml of IMDM supplemented with 10% FBS in 24-well plates. On the following day, the cells were transfected with FUGENE 6 Reagent (Roche Applied Science, Indianapolis, IN), according to the manufacturer's instructions, using equimolar concentrations of all MT-LUC constructs (300 ng/well of a 7.2-kb construct and approximately 100 ng/well of 0.1-kb, 0.4-kb, 1.2-kb, and pGL3 basic) and 1 µl of FUGENE 6 per 0.5 ml of medium in each well of the 24-well plates. Renilla luciferase vector pRL-SV-40 (Promega) was used as transfection control at 1 ng/well. For studies using dominant-negative vectors, equimolar concentrations of dominant-negative JNK (DN-JNK) and a dominant-negative vector of PI3K p85 subunit (DN-p85), and a 1:2 molar ratio of MT-LUC to the dominant-negative ERK (DN-ERK) and pcEP4 vectors were added to FUGENE 6. Cells transfected with the DN-p85 and DN-ERK vectors were cotransfected with 10 ng/well pRK-TK Renilla control vector, and cells transfected with the DN-JNK vectors were cotransfected with 1 ng/well pRL-SV-40 Renilla (Promega). All transfection experiments were performed overnight in serum-free medium, which was replaced with 10% FBS medium for an additional 24 hours. Cells were then lysed and analyzed using the Dual Luciferase Reporter Assay System (Promega), according to the manufacturer's instructions. For each experiment, firefly luciferase activity was normalized to the activity of Renilla luciferase as an internal control. The results were expressed as fold induction, determined by normalizing each firefly luciferase value to the Renilla luciferase internal control and by dividing these normalized values with the mean normalized value of the corresponding reporter construct transfected with empty expression vectors. Values represent three independent experiments performed in triplicate, and data are expressed as mean ± SD. Statistical analysis was performed using Student's t test.

Preparation of Nuclear Extracts

Prostate cancer cells, grown to 80%confluency in 100-mm dishes, were lysed in 1 ml of ice-cold buffer A (10 mM HEPES pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM fresh DTT, and 0.1% Nonidet P-40) and transferred to 1.5-ml Eppendorf tubes. Samples were rocked on an inversion rocker for 1 hour at 4°C before centrifugation at 14,000 rpm for 15 minutes at 4°C. Supernatant was removed, and nuclear pellet was resuspended in 10 µl of buffer C (20 mM HEPES pH 7.9, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, and 0.5 mM phenylmethanesulphonylfluoride [PMSF]). Samples were incubated at 4°C on an inversion rocker and centrifuged at 14,000 rpm for 15 minutes. Supernatants were diluted 1:5 with buffer D (20 mM HEPES pH 7.9, 20% glycerol, 1.5 mM MgCl2, 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, and 0.5 mM PMSF) before protein quantitation using Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA).

Electrophoretic Mobility Shift Assay (EMSA)

The oligonucleotide corresponding to the sequence derived from the human MT1-MMP promoter containing a putative Sp1 site (5′-GGCACTGGGGCGGGGACGGAGG-3′ and 3′-CGTGACCCCGCCCCTGCCT-5′) was overhung labeled with 32P. Five micrograms of nuclear extracts isolated from prostate cancer cell lines was incubated on ice with 5× binding buffer (50 mM HEPES pH 7.9, 250 mM KCl, 0.5 mM EDTA, 12.5 mM DTT, 50% glycerol, and 0.25% Nonidet P-40), and ×50 or ×100 wild-type nonlabeled competitor or mutant nonlabeled competitor (5′-GGCACTGGTTCGGGGGACGGAGG-3′ and 3′-CGTGACCTTGCCCCTGCCT-5′) was incubated for 1 hour on ice. Samples containing nuclear extract and 5× binding buffer for supershift analysis were incubated with anti-Sp1 polyclonal antibody (Santa Cruz Biotechnologies) or anti-Sp3 polyclonal antibody (Geneka) for 1 hour on ice. Following a 1-hour incubation on ice, 50,000 cpm of labeled wild-type probe (1 µl) was added to each reaction and incubated for 20 minutes at 25°C. Samples were resolved on a nondenaturing 4% polyacrylamide gel in 0.25× Tris-borate-EDTA, dried, and visualized by phosphorimaging (Molecular Dynamics, Sunnyvale, CA).

ChIP Assay

ChIP assay was performed using the EZCHIP Kit (Upstate Biotechnology, Lake Placid, NY) with slight modifications. PC-3N cells (2 × 107) were cross-linked with 1% formaldehyde in 10 ml of serum-free medium for 10 minutes at room temperature, followed by the addition of 1 ml of 10× glycine to quench unreacted formaldehyde. Cells were washed twice with ice-cold phosphate-buffered saline containing protease inhibitor cocktail II (Millipore) and then scraped and centrifuged at 700g at 4°C for 5 minutes. Pelleted cells were lysed with 1 ml of sodium dodecyl sulfate (SDS) lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris pH 8.1) supplemented with protease inhibitor cocktail and incubated on ice for 10 minutes. After sonication to produce genomic DNA with lengths of 0.2 to 1 kb (optimized at 10× 15-second pulses), samples were centrifuged at 13,000g for 10 minutes to remove insoluble materials. Lysates were diluted in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1, and 500 mM NaCl) and protease inhibitor cocktail. Dilutions of chromatin preparations were reserved as input and stored at -80°C. Chromatin solution was precleared with 100 µl of salmon sperm DNA/protein A agarose for 2 hours at 4°C with rotation. Anti-Sp1 polyclonal (Santa Cruz Biotechnologies) antibody was added to the precleared supernatant and incubated overnight at 4°C with rotation. On the following day, 60 µl of salmon sperm DNA/protein A agarose slurry was added to the chromatin solution for 1 hour with rotation at 4°C. Negative controls included a sample incubated without antibody and one incubated with rabbit IgG (Santa Cruz Biotechnologies) to determine whether interactions were not due to nonspecific IgG interactions. Bead complexes were washed first with low-salt immune complex wash buffer, followed by high-salt immune complex wash buffer and a final LiCl immune complex wash buffer for 5 minutes each on a rotating platform followed by brief centrifugation. Two final washes in 1× TE buffer were performed for 5 minutes each. After the final wash, DNA was extracted by incubating the beads twice for 15 minutes with 250 µl of freshly made elution buffer (1% SDS and 50 mM NaHCO3). Samples were then uncrosslinked in a 65°C water bath overnight, and DNA was purified using Qiagen Nucleotide Removal Kit (Qiagen, Valencia, CA). Polymerase chain reaction (PCR) primers used to amplify the MT1-MMP promoter region flanking the Sp1-binding site were as follows: CTGCGATCTAAGTAAGCTTGGC (forward) and GTTTGCTCTTCTCCTCTTTTCCG (reverse).

Sp1 Small Interfering RNA (siRNA)

The siGENOME silencing RNA smart pool targeting Sp1 and siCON nontargeting smart pool were purchased from Dharmacon Research (Lafayette, CO). Transfection was performed as suggested by Dharmacon Research, with slight modifications. Briefly, PC-3N cells were plated at 1 × 106 cells per T75 flask (BD/Falcon, Mississauga, Ontario, Canada) and then transfected on the following day with Sp1 siRNA or siCON oligonucleotide siRNA pools using Dharmafect reagent 2 (Dharmacon Research) for 24 hours in a serum-containing medium. On the following day, the medium was replaced with a fresh-serum-containing medium, and cells were harvested for examining the expression of Sp1 protein and MT1-MMP protein and mRNA levels. Each siRNA experiment was performed at least three times, and Western blot analysis indicates one representative experiment. Real-time reverse transcription (RT) PCR data include three separate experiments, and data are expressed as mean ± SD. Statistical analysis was performed using Student's t test.

Total Cellular Protein Extraction and Western Blot Analysis

Cells were lysed in 50 mM Tris-Cl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% sodium deoxycholate, 1% Triton X-100, 1 mg/ml aprotinin, 1 mg/ml leupeptin, 3 mM β-glycerol phosphate, 1 mM Na3VO4, 10 mM NaF, and 10 mM sodium pyrophosphate. Cells were scraped and centrifuged at 14,000 rpm for 10 minutes at 4°C. Bio-Rad Dc reagent (Bio-Rad Laboratories) was used to determine protein concentration. For Western blot analysis, 30 µg of protein was resolved on a 10% SDS polyacrylamide gel. The protein was then transferred to a polyvinylidene difluoride membrane (Millipore) for 1.5 hours using the Invitrogen Small Cell Transblot Apparatus (Invitrogen Life Technologies). Following transfer, the membranes were blocked in 5% nonfat milk in Tris-buffered saline Tween-20 (TBST) at room temperature for 1 hour. The primary antibodies for MT1-MMP (AB815; Chemicon) and Sp1 (Santa Cruz Biotechnologies) were used at 1:2000 and incubated overnight at 4°C in 5% nonfat dry milk/TBST. Membranes were incubated with appropriate horseradish peroxidase secondary antibody in 5% milk/TBST for 1 hour at room temperature. The primary antibody for α-tubulin (Calbiochem), which was used as a loading control, was used at 1:5000 and incubated at room temperature for 2 hours. Goat anti-mouse horseradish peroxidase secondary (Transduction Laboratories, Greenland, NH) was used at 1:2000 for the α-tubulin antibody, and anti-rabbit horseradish peroxidase (Cell Signaling, Beverly MA) was used at 1:2000 dilution for all other antibodies mentioned previously. Membranes were washed thrice for 10 minutes each in TBST between antibody incubations and were detected using ECL Western blot analysis detection reagents (Amersham Biosciences, Buckinghamshire, England, UK).

Real-Time PCR

Total RNA was isolated using the TRIZOL method (Invitrogen Life Technologies), and 1 µg of isolated RNA was reverse-transcribed using the High Capacity cDNA Kit (Applied Biosystems, Foster City, CA). TaqMan Gene Expression Assay probes were purchased for MT1-MMP (Applied Biosystems), and real-time PCR was performed using the TaqMan Universal PCR Master Mix and the ABI PRISM 7700 Sequence Detection System (Applied Biosystems). PCR conditions were as follows: 50°C for 20 minutes, 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Relative CT method was used to calculate mRNA levels of MT1-MMP normalized to GAPDH in each sample, as described by User Bulletin 2, ABI PRISM 7700 Sequence Detection System. Results include three separate experiments, and data are expressed as mean ± SD. Statistical analysis was performed using Student's t test.

Results

MT1-MMP Is Expressed in Prostate Tumor Cell Lines and Is Regulated By Sp1

Previous studies in our laboratory have shown that MT1-MMP expression is increased in highly invasive prostate tumor cell lines [8]. However, there has also been a report that MT1-MMP is not expressed in the prostate tumor cell lines used in this study [13]. To demonstrate that MT1-MMP expression is indeed increased in human prostate tumor cell lines, the normal human prostate cell strain PrEC and the human prostate tumor cell lines DU-145, PC-3, and PC-3N were grown to 80% confluency, and total RNA and protein were collected and analyzed by quantitative real-time RT-PCR or Western blot analysis, respectively. The results in Figure 1, A and B, indicate increased MT1-MMP mRNA and protein in DU-145, PC-3, and PC-3N cells compared to PrEC. The results indicate that PC-3N cells express the highest levels of both mRNA and protein. Previous studies have identified a GC-rich Sp1-binding region in the proximal promoter of MT1-MMP, and Sp1 binding to this putative site is a prominent mechanism of the transcriptional regulation of MT1-MMP expression in multiple cell lines [8,14–16]. To determine whether Sp1 transcriptionally regulates MT1-MMP in human prostate cells, DU-145, PC-3, and PC-3N cells were transiently transfected with a series of previously described firefly luciferase reporter plasmids containing 94, 385, 1246 bp, or approximately 7.2 kb of the 5′-flanking region and the entire 5′ untranslated sequence up to nucleotide +200 relative to the 3′ most major transcription start site [14]. The results in Figure 1C (shown as DU-145, PC-3, and PC-3N from left to right, respectively) indicate that the 94-bp 5′-flanking region (0.1 WT), which does not contain the putative Sp1 site (located -92 bp from the first transcriptional start site), shows slightly enhanced promoter activity compared to pGL3 basic. However, transfection with 385-bp (0.4 WT), 1246-bp (1.2 WT), and 7.2-kb (7.2 WT) constructs, which each contain the Sp1 site, significantly increased promoter activity for DU-145, PC-3, and PC-3N cell lines compared to pGL3 basic. The reduction in MT1-MMP promoter activity in the 1246-bp (1.2 WT) construct compared to the 385-bp construct has also been previously reported to occur in HT-1080 cells [14] and is suggestive of a negative regulatory element. To determine the role of Sp1 in regulating MT1-MMP, a series of constructs with the Sp1 site deleted (Sp1-MUT) was transfected into each cell line. Activity for each construct was significantly reduced when comparing wild-type vectors with mutant vectors of the same size. These results indicate that the putative Sp1 site in the proximal promoter of MT1-MMP plays a significant role in regulating the transcription of the enzyme in the three human prostate cell lines.

Figure 1
MT1-MMP is expressed in prostate cell lines and its promoter activity is dependent on Sp1. (A) Quantitative real-time RT-PCR analysis of MT1-MMP mRNA in PrEC p2 (passage 2), DU-145, PC-3, and PC-3N cells. Values represent the average of MT1-MMP normalized ...

Sp1 Binds to the MT1-MMP Promoter

To determine the ability of endogenous nuclear Sp1 to bind to the putative Sp1 site in the proximal promoter of MT1-MMP, nuclear extracts from PC-3N, PC-3, and DU-145 cells were used in an EMSA, as shown in Figure 2A. One distinct DNA-protein complex (lanes 2, 7, and 12) was formed from nuclear extracts of all three cell lines, as well as from multiple smaller bands due to nonspecific binding. The addition of excess unlabeled wild-type Sp1 oligonucleotides efficiently competed for DNA-protein complex formation in each cell line (lanes 3, 8, and 13), whereas mutant oligonucleotides did not inhibit complex formation (lanes 4, 9, and 14). To define Sp1 as the nuclear protein associating with putative Sp1 sequence, Sp1 antibody was added to binding reactions, which resulted in clearing of a specific band and a supershifted DNA-protein band (lanes 5, 10, and 15). It has previously been shown that the Sp1 family member Sp3 binds to the putative Sp1 sequence with similar affinity, but has negative regulatory functions on its target genes [17]. An anti-Sp3 antibody was added to the binding reactions to ensure that endogenous Sp3 was not formulating a shifted DNA-protein complex (lanes 6, 11, and 16). To ensure the specificity of supershift antibodies, a nontargeting antibody (anti-α-tubulin) was added to the binding reactions and did not result in a shift of the Sp1 DNA-protein complex (data not shown). These results indicate that endogenous Sp1 in DU-145, PC-3, and PC-3N cells binds to the putative Sp1 sequence in the proximal promoter of MT1-MMP in a cell-free system. To define Sp1 as the nuclear protein binding to the putative Sp1 site in the MT1-MMP promoter in live cells, PC-3N cells were used to perform a ChIP assay because they express the highest levels of MT1-MMP. Results from the ChIP assay in Figure 2B indicate that Sp1 does indeed bind to the MT1-MMP promoter in live cells, as shown by the 249-bp amplicon produced when an anti-Sp1 antibody was added to the immunoprecipitation reaction (lane 2). Lane 1 depicts a positive control and is a PCR amplicon from chromatin isolated before immunoprecipitation. Important negative controls to ensure the specificity of the anti-Sp1 antibody include rabbit IgG (lane 3), no antibody (lane 4), and no DNA control for PCR (lane 5). These results indicate that Sp1 binds to the MT1-MMP promoter in PC-3N cells.

Figure 2
Sp1 binds to the MT1-MMP promoter in human prostate tumor cell lines. (A) EMSA analysis with oligonucleotides corresponding to the Sp1 sequence in the proximal MT1-MMP promoter and nuclear extracts from PC-3N cells (lanes 2–6), PC-3 cells (lanes ...

Silencing RNA Targeting Sp1 Decreases MT1-MMP Expression

To evaluate the Sp1 regulation of MT1-MMP expression in vivo, we used silencing of RNA targeting Sp1 in PC-3N cells. Transfection of PC-3N cells with siRNA targeting Sp1 for 48 and 72 hours (data not shown) depleted the protein from the cells, as shown by Western blot analysis (Figure 3A). Depletion of Sp1 from PC-3N cells at 48 hours significantly reduced MT1-MMP mRNA levels detected by quantitative real-time RT-PCR (Figure 3B). Additionally, MT1-MMP protein levels were reduced at 48 hours (data not shown) and depleted at 72 hours, as assessed by Western blot analysis (Figure 3C). These data indicate that Sp1 is required for MT1-MMP expression in PC-3N cells.

Figure 3
Silencing RNA targeting Sp1 decreases MT1-MMP expression. PC-3N cells were transfected with either siCON (nonspecific targeting siRNA pool) or an Sp1 siRNA pool (Dharmacon Research) at 25 nM. (A) Western blot analysis of Sp1 in PC-3N cells transfected ...

AKT, JNK, and ERK Are Differentially Phosphorylated in Three Prostate Cell Lines

The AKT and JNK pathways influence Sp1 phosphorylation [21,22], and ERK directly phosphorylates Sp1 to increase its transcriptional activity [22,33–36] and these pathways become overexpressed in prostate cancer [37–41]. Western blot analysis was performed to investigate possible constitutive signaling mechanisms involved in the differential expression of MT1-MMP in DU-145, PC-3, and PC-3N human prostate tumor cell lines grown in a medium supplemented with 10% FBS. Western blot analysis in Figure 4 indicates blots probed for phosphorylated AKT, ERK, and JNK, with total protein used as a loading control. The results show that PC-3 and PC-3N cells express constitutively phosphorylated AKT on serine 473 and phosphorylated JNK, whereas DU-145 cells do not express constitutive AKT or JNK. The constitutively active AKT observed in PC-3 and PC-3N cells coincides with previous reports on prostate cancer cell PTEN status and our unpublished data on PC-3N cells [42]. Additionally, the results in Figure 4 also show that DU-145 cells express constitutively phosphorylated ERK, whereas PC-3 and PC-3N cells do not. These data indicate differential constitutive signaling in DU-145, PC-3, and PC-3N prostate cell lines.

Figure 4
Constitutive AKT, JNK, and ERK signaling pathways in prostate cancer cell lines. DU-145, PC-3, and PC-3N cells were grown in 10% FBS and IMDM until approximately 80% confluent. Cells were lysed and analyzed by Western blot analysis using the indicated ...

MT1-MMP Expression Is Regulated through the PI3K and JNK Pathways in PC-3N and PC-3 Cells and through the ERK Pathway in DU-145 Cells

To investigate the possible role of constitutively active signaling pathways in the regulation of MT1-MMP, PC-3N and PC-3 cells were treated with the PI3K small molecule inhibitor (LY294002) and the JNK small molecule inhibitor (SP600125) at 30 µM for 48 hours. Western blot analysis for AKT phosphorylation in cells treated with LY294002 and for JNK phosphorylation in cells treated with SP600125 indicated a decrease in the phosphorylation of both kinases (data not shown). Western blot analysis was performed for MT1-MMP and Sp1 expression (Figure 5A), and the results indicate that treatment of PC-3N and PC-3 cells (data not shown) resulted in a decrease in both Sp1 and MT1-MMP protein levels. Using quantitative real-time RT-PCR, it was also determined that treatment with LY294002 and SP600125 decreased MT1-MMP mRNA levels at 48 hours (Figure 5B) in PC-3N and PC-3 cells (data not shown). To ensure specificity in inhibiting the PI3K and JNK pathways in PC-3N and PC-3 cells, transient cotransfection with dominant-negative p85 or JNK with the 385-bp MT1-MMP luciferase promoter construct was performed. The results in Figure 5C indicate a significant decrease in MT1-MMP promoter expression in cells transfected with either dominant-negative p85 or dominant-negative JNK1 compared to empty parent vector. To investigate the possible role of constitutive ERK activity in regulating MT1-MMP in DU-145 cells, the cells were treated with the MEK small molecule inhibitor (PD98059) to inhibit ERK phosphorylation (data not shown) at 10 and 20 µM for 48 hours. MT1-MMP expression was determined by Western blot analysis (Figure 5D), and the results indicate decreased MT1-MMP levels with increased drug concentration at 48 hours. Western blot analysis of Sp1 indicated no change in total protein levels on treatment with PD98059 (data not shown). Additionally, transient cotransfection of dominant-negative ERK with the 385-bp MT1-MMP luciferase reporter vector significantly reduced MT1-MMP promoter activity compared to the empty parent vector control. These results indicate that inhibition of constitutive AKT and JNK in PC-3N and PC-3 cells decreases MT1-MMP and Sp1 expression, and inhibition of the constitutive ERK pathway in DU-145 cells decreases MT1-MMP expression.

Figure 5
Involvement of PI3K, JNK, and ERK in regulating MT1-MMP expression in prostate cancer cells. (A) Western blot analysis for MT1-MMP and Sp1 expression. PC-3N cells were plated and allowed to adhere overnight. On the following day, the cells were treated ...

Discussion

This study was designed to characterize endogenous mechanisms regulating constitutive levels of MT1-MMP in prostate cancer cell lines. Previously, we have reported that MT1-MMP is highly expressed in the invasive prostate PC-3N cell line (a variant of PC-3 cells) and is slightly increased in the less invasive PC-3 and DU-145 cells [8]. Tran et al. have characterized the invasive characteristics of these cell lines and have established that PC-3N cells displayed an invasive phenotype in intraperitoneal injections into SCID mice, whereas DU-145 cells did not exhibit invasive characteristics. In contrast to our previous results depicting increased MT1-MMP expression in invasive prostate cell lines, it has been reported that there is no increased MT1-MMP expression in DU-145 or PC-3 cells [13]. In this study, we demonstrate that MT1-MMP is indeed significantly overexpressed in PC-3N cells, marginally overexpressed in PC-3 and DU-145 (PC-3 slightly higher than DU-145 cells), and absent in the PrEC (primary prostate cell strain).

Our group has published that fibroblast growth factor-1 induced MT1-MMP in LnCaP cells through transcriptional activation by STAT-3 [43]. In this study, we focused on the constitutive Sp1 regulation of MT1-MMP based on evidence from reports implicating the transcription factor in regulating MT1-MMP in other cell systems. Lohi et al. have previously characterized the MT1-MMP promoter and implicated Sp1 as the prominent transcriptional regulator of MT1-MMP in human fibroscarcoma HT-1080 cells. Additional groups also identified the constitutive Sp1 regulation of the murine MT1-MMP promoter in various cell lines [14–16]. Furthermore, Sp1 is a zinc finger transcription factor that regulates genes involved with angiogenesis and metastasis, including VEGF, uPA, PSA, and the α6 integrin subunit [20–24]. Therefore, we sought to determine whether Sp1 played a role in regulating MT1-MMP in prostate tumor cells [3]. Here, we show for the first time that MT1-MMP expression in three prostate cell lines is dependent on Sp1 transcriptional control. Our results indicate that Sp1 regulates the MT1-MMP promoter in cultured cells, as shown by transient transfection experiments. Additionally, nuclear Sp1 from all three prostate tumor cell lines bound to the MT1-MMP promoter in a cell-free system and in PC-3N cells through mobility shift assays and ChIP, respectively. Depletion of Sp1 from PC-3N cells by silencing RNA inhibited MT1-MMP expression, indicating the important role of the Sp1 transcriptional activity of the enzyme in PC-3N cells.

Interestingly, levels of Sp1 (both total cell lysate or nuclear lysate) do not vary significantly between the prostate cell lines (data not shown), suggesting that posttranslational regulation of Sp1 alters its transcriptional activity in the MT1-MMP promoter in the three prostate cell lines. Increased Sp1 activity due to altered phosphorylation has been associated with direct phosphorylation by ERK and has been correlated with the PI3K and JNK pathways [20–22,35]. The PI3K pathway has been implicated in prostate cancer progression through loss of the PTEN tumor suppressor [37–39], and additional investigators have established a role for increased JNK in advanced prostate cancer [22,41]. However, reports of ERK activation in prostate cancer have been somewhat controversial. Gioeli et al. [44] concluded that ERK is increased in advanced prostate cancer, whereas Malik et al. [37] concluded that ERK expression is increased in prostatic intraepithelial neoplasia but is decreased in advanced disease. Our results indicate that the invasive PC-3N and PC-3 prostate cancer cell lines express constitutive AKTand JNK, whereas DU-145 cells are less invasive and express constitutive ERK. It has been shown that JNK activity has a negative effect on ERK activity [45], which suggests that, in DU-145 cells, ERK activity prevails due to inactivity of JNK. It is important to note that PC-3 cells have levels of MT1-MMP and an invasive phenotype that fall in between DU-145 and PC-3N cells, but they also express constitutive AKT and JNK. This suggests that invasive cells are more dependent on PTEN mutations, and we hypothesize that there is a switch in signaling mechanisms from active ERK to active AKTand JNK as cells become invasive. PC-3N cells have significantly higher levels of MT1-MMP and are highly invasive compared to PC-3 cells, and we speculate that PC-3N may have unique regulatory factors that influence or interact with Sp1 to enhance MT1-MMP expression, in addition to constitutive AKT and JNK.

Our results and model in Figure 6 indicate that pharmacological inhibition of PI3K and JNK decreases MT1-MMP and Sp1 levels in PC-3 and PC-3N cells. Although several studies have correlated the AKT-mediated and JNK-mediated phosphorylation of Sp1 with increased transcriptional activity, those studies have not definitively identified direct sites phosphorylated on Sp1 by these kinases. Evidence from this study demonstrates a novel finding in that constitutively active PI3K and JNK modulate Sp1 protein levels in two prostate cancer cell lines. This finding indicates alternative mechanisms of Sp1 regulation through the PI3K and JNK pathways than what has been previously reported. Based on our results, we speculate that the PI3K and JNK pathways could alter the transcription of the Sp1 gene through posttranslational modification of Sp1, as it has recently been shown that Sp1 regulates its own promoter [46]. We hypothesize that inhibition of PI3K and JNK may alter Sp1 activity in binding to its own promoter, therefore decreasing total Sp1 levels in the cell. In addition to transcriptional regulation, we also speculate that PI3K and JNK may be modulating Sp1 protein levels through mechanisms of protein degradation. It has been recently reported by Abdelrahim and Safe that COX-2 inhibitors in colon cancer cell lines decreased total Sp1 levels but did not affect Sp1 mRNA levels. The authors concluded that COX-2 inhibition enhanced proteosomal degradation of Sp1 [47]. This report did not delineate the exact mechanisms mediating Sp1 degradation, but it established proteosomal degradation of Sp1 as a possible regulatory mechanism for Sp1 expression.

Figure 6
Proposed signaling regulation of MT1-MMP and Sp1 in prostate cancer cell lines. (A) Invasive prostate cancer PC-3N and PC-3 cells express high levels of MT1-MMP, which is dependent on Sp1 transcriptional regulation. Inhibition of constitutively active ...

Treatment of DU-145 cells with the MEK inhibitor PD98059 resulted in a decrease in MT1-MMP levels but did not result in a decrease in Sp1 protein (data not shown). This suggests that ERK regulation of Sp1 may not influence its transcriptional activities for its own promoter or protein degradation but does influence the transcriptional regulation of MT1-MMP. In contrast to the lack of evidence of direct phosphorylation mediated by AKTand JNK, previous studies have determined the exact sites on Sp1 phosphorylated by ERK [33–35]. Additionally, these studies determined that ERK phosphorylation of Sp1 increases its transactivation activities. To investigate the role of ERK in directly phosphorylating Sp1 in DU-145 cells, we performed transient transfections using a previously described dominant-negative Sp1 [35] with mutated ERK phosphorylation residues and the wild-type MT1-MMP promoter in DU-145 cells. The results indicated that a mutant Sp1 harboring mutated threonine residues directly phosphorylated by ERK did not reduce the transcription of the MT1-MMP promoter in these cells (data not shown). Additionally, Western blot analysis of DU-145 cells treated with the MEK inhibitor PD98059 to inhibit ERK activity did not alter Sp1 phosphorylation (data not shown). Considering this evidence, we speculate that inhibiting ERK activity, as shown in Figure 5, D and E, in DU-145 cells decreases Sp1-mediated MT1-MMP transcription in an indirect manner. Results from this study indicate the prominent role of Sp1 in regulating the transcription of MT1-MMP in DU-145 cells (as shown in Figure 1B). We hypothesize that constitutive ERK in these cells may regulate a downstream kinase or cofactor involved with Sp1-mediated transcription.

In addition to the pharmacological treatment of the prostate cells, we performed transient transfections to ensure specificity in the inhibition of constitutive signaling pathways. Transient transfection of PC-3 and PC-3N cells with either dominant-negative JNK or p85 significantly decreased MT1-MMP promoter activity. Furthermore, transient transfection of DU-145 cells with dominant-negative ERK significantly decreased MT1-MMP promoter activity. Notably, PC-3N and PC-3 cells cotransfected with dominant-negative ERK, the MT1-MMP promoter and DU-145 cells cotransfected with dominant-negative p85 or JNK, and the MT1-MMP promoter did not reduce MT1-MMP promoter activity in these cells (data not shown). These experiments indicate that in PC-3 and PC-3N cells, PI3K and JNK play a role in regulating MT1-MMP, and in DU-145 cells, the ERK pathway plays a role in regulating MT1-MMP.

We speculate that multiple regulatory mechanisms mediated by these pathways could be occurring in PC-3 and PC-3N cells, as modeled in Figure 6. First, the pathways could converge on a downstream regulator, and inhibition of either pathway could negatively affect this unidentified regulator, therefore decreasing Sp1 activity. Second, each pathway may be required to phosphorylate Sp1 directly to achieve transcriptional control of MT1-MMP, and the absence of one pathway completely abrogates Sp1 activity. Third, there is a possibility of direct crosstalk between the PI3K and JNK signaling pathways, as shown by Logan et al. [48] in a study that indicated PI3K regulation of JNK activity. This hypothesis implies that JNK could be the dominant direct regulator of Sp1 in PC-3 and PC-3N cells, but its activity could be dependent on the constitutive signaling of PI3K. This hypothesis is also supported by a study indicating that, in PC-3 cells, JNK activity was constitutive and regulated Sp1-mediated transcriptional control of uPA [22].

In conclusion, we have identified several novel findings. We show for the first time that MT1-MMP expression in PC-3N, PC-3, and DU-145 prostate cancer cell lines is dependent on Sp1 transcriptional regulation. We also show that constitutive signaling pathways in PC-3 and PC-3N cells, namely, the PI3K and JNK pathways, play significant roles in regulating MT1-MMP and Sp1 levels. Additionally, we show that constitutive ERK in DU-145 cells plays a significant role in regulating MT1-MMP levels, although the levels are lower than those in PC-3 and PC-3N cells. This study exemplifies the heterogeneity in prostate cancer cell line signaling mechanisms and the differential effects these pathways have on the transcriptional control of MT1-MMP. Evidence presented here suggests that constitutive PI3K and JNK activities in prostate cancer cells influence invasive phenotype through increased transcription of MT1-MMP. This study also indicates that ERK plays a minor role in this process in a cell line that does not express PI3K and JNK pathways. This study enhances our understanding of complex mechanisms involved with MT1-MMP regulation and proposes that identifying trends in the aberrant expression of signaling cascades involved in prostate cancer progression may aid in determining future biomarkers or therapeutic targets.

Footnotes

1This work was supported, in part, by Prostate PPG CA56666, Cancer Biology Training Grant CA09213, and AZCC Core Grant CA23074.

References

1. Jemal A, Siegel R, Ward E, Murray T, Xu J, Smigal C, Thun MJ. Cancer statistics, 2006. CA Cancer J Clin. 2006;56:106–130. [PubMed]
2. Deryugina EI, Quigley JP. Matrix metalloproteinases and tumor metastasis. Cancer Metastasis Rev. 2006;25:9–34. [PubMed]
3. Sounni NE, Noel A. Membrane type-matrix metalloproteinases and tumor progression. Biochimie. 2005;87:329–342. [PubMed]
4. Overall CM, Lopez-Otin C. Strategies for MMP inhibition in cancer: innovations for the post-trial era. Nat Rev Cancer. 2002;2:657–672. [PubMed]
5. Seiki M, Yana I. Roles of pericellular proteolysis by membrane type-1 matrix metalloproteinase in cancer invasion and angiogenesis. Cancer Sci. 2003;94:569–574. [PubMed]
6. Upadhyay J, Shekarriz B, Nemeth JA, Dong Z, Cummings GD, Fridman R, Sakr W, Grignon DJ, Cher ML. Membrane type 1-matrix metalloproteinase (MT1-MMP) and MMP-2 immunolocalization in human prostate: change in cellular localization associated with high-grade prostatic intraepithelial neoplasia. Clin Cancer Res. 1999;5:4105–4110. [PubMed]
7. Cardillo MR, Di Silverio F, Gentile V. Quantitative immunohistochemical and in situ hybridization analysis of metalloproteinases in prostate cancer. Anticancer Res. 2006;26:973–982. [PubMed]
8. Udayakumar TS, Chen ML, Bair EL, Von Bredow DC, Cress AE, Nagle RB, Bowden GT. Membrane type-1-matrix metalloproteinase expressed by prostate carcinoma cells cleaves human laminin-5 beta3 chain and induces cell migration. Cancer Res. 2003;63:2292–2299. [PubMed]
9. Bair EL, Chen ML, McDaniel K, Sekiguchi K, Cress AE, Nagle RB, Bowden GT. Membrane type 1 matrix metalloprotease cleaves laminin-10 and promotes prostate cancer cell migration. Neoplasia. 2005;7:380–389. [PMC free article] [PubMed]
10. Koshikawa N, Minegishi T, Sharabi A, Quaranta V, Seiki M. Membrane-type matrix metalloproteinase-1 (MT1-MMP) is a processing enzyme for human laminin gamma 2 chain. J Biol Chem. 2005;280:88–93. [PubMed]
11. Nagakawa O, Murakami K, Yamaura T, Fujiuchi Y, Murata J, Fuse H, Saiki I. Expression of membrane-type 1 matrix metalloproteinase (MT1-MMP) on prostate cancer cell lines. Cancer Lett. 2000;155:173–179. [PubMed]
12. Jung M, Romer A, Keyszer G, Lein M, Kristiansen G, Schnorr D, Loening SA, Jung K. mRNA expression of the five membrane-type matrix metalloproteinases MT1-MT5 in human prostatic cell lines and their down-regulation in human malignant prostatic tissue. Prostate. 2003;55:89–98. [PubMed]
13. Zhang J, Jung K, Lein M, Kristiansen G, Rudolph B, Hauptmann S, Schnorr D, Loening SA, Lichtinghagen R. Differential expression of matrix metalloproteinases and their tissue inhibitors in human primary cultured prostatic cells and malignant prostate cell lines. Prostate. 2002;50:38–45. [PubMed]
14. Lohi J, Lehti K, Valtanen H, Parks WC, Keski-Oja J. Structural analysis and promoter characterization of the human membrane-type matrix metalloproteinase-1 (MT1-MMP) gene. Gene. 2000;242:75–86. [PubMed]
15. Haas TL, Stitelman D, Davis SJ, Apte SS, Madri JA. Egr-1 mediates extracellular matrix-driven transcription of membrane type 1 matrix metalloproteinase in endothelium. J Biol Chem. 1999;274:22679–22685. [PubMed]
16. Alfonso-Jaume MA, Mahimkar R, Lovett DH. Co-operative interactions between NFAT (nuclear factor of activated T cells) c1 and the zinc finger transcription factors Sp1/Sp3 and Egr-1 regulate MT1-MMP (membrane type 1 matrix metalloproteinase) transcription by glomerular mesangial cells. Biochem J. 2004;380:735–747. [PMC free article] [PubMed]
17. Black AR, Black JD, Azizkhan-Clifford J. Sp1 and Kruppel-like factor family of transcription factors in cell growth regulation and cancer. J Cell Physiol. 2001;188:143–160. [PubMed]
18. Wang L, Wei D, Huang S, Peng Z, Le X, Wu TT, Yao J, Ajani J, Xie K. Transcription factor Sp1 expression is a significant predictor of survival in human gastric cancer. Clin Cancer Res. 2003;9:6371–6380. [PubMed]
19. Shi Q, Le X, Abbruzzese JL, Peng Z, Qian CN, Tang H, Xiong Q, Wang B, Li XC, Xie K. Constitutive Sp1 activity is essential for differential constitutive expression of vascular endothelial growth factor in human pancreatic adenocarcinoma. Cancer Res. 2001;61:4143–4154. [PubMed]
20. Pore N, Liu S, Shu HK, Li B, Haas-Kogan D, Stokoe D, Milanini-Mongiat J, Pages G, O'Rourke DM, Bernhard E, et al. Sp1 is involved in Akt-mediated induction of VEGF expression through an HIF-1-independent mechanism. Mol Biol Cell. 2004;15:4841–4853. [PMC free article] [PubMed]
21. Reisinger K, Kaufmann R, Gille J. Increased Sp1 phosphorylation as a mechanism of hepatocyte growth factor (HGF/SF)-induced vascular endothelial growth factor (VEGF/VPF) transcription. J Cell Sci. 2003;116:225–238. [PubMed]
22. Benasciutti E, Pages G, Kenzior O, Folk W, Blasi F, Crippa MP. MAPK and JNK transduction pathways can phosphorylate Sp1 to activate the uPA minimal promoter element and endogenous gene transcription. Blood. 2004;104:256–262. [PubMed]
23. Franco OE, Onishi T, Yamakawa K, Arima K, Yanagawa M, Sugimura Y, Kawamura J. Mitogen-activated protein kinase pathway is involved in androgen-independent PSA gene expression in LNCaP cells. Prostate. 2003;56:319–325. [PubMed]
24. Onishi T, Yamakawa K, Franco OE, Kawamura J, Watanabe M, Shiraishi T, Kitazawa S. Mitogen-activated protein kinase pathway is involved in alpha6 integrin gene expression in androgen-independent prostate cancer cells: role of proximal Sp1 consensus sequence. Biochim Biophys Acta. 2001;1538:218–227. [PubMed]
25. Chu S, Ferro TJ. Sp1: regulation of gene expression by phosphorylation. Gene. 2005;348:1–11. [PubMed]
26. Suzuki A, Lu J, Kusakai G, Kishimoto A, Ogura T, Esumi H. ARK5 is a tumor invasion-associated factor downstream of Akt signaling. Mol Cell Biol. 2004;24:3526–3535. [PMC free article] [PubMed]
27. Zhang D, Brodt P. Type 1 insulin-like growth factor regulates MT1-MMP synthesis and tumor invasion via PI 3-kinase/Akt signaling. Oncogene. 2003;22:974–982. [PubMed]
28. Wang BW, Chang H, Lin S, Kuan P, Shyu KG. Induction of matrix metalloproteinases-14 and -2 by cyclical mechanical stretch is mediated by tumor necrosis factor-alpha in cultured human umbilical vein endothelial cells. Cardiovasc Res. 2003;59:460–469. [PubMed]
29. Takino T, Miyamori H, Watanabe Y, Yoshioka K, Seiki M, Sato H. Membrane type 1 matrix metalloproteinase regulates collagen-dependent mitogen-activated protein/extracellular signal-related kinase activation and cell migration. Cancer Res. 2004;64:1044–1049. [PubMed]
30. Mitra A, Chakrabarti J, Banerji A, Das S, Chatterjee A. Culture of human cervical cancer cells, SiHa, in the presence of fibro-nectin activates MMP-2. J Cancer Res Clin Oncol. 2006;25:667–677. [PubMed]
31. Tanimura S, Asato K, Fujishiro SH, Kohno M. Specific blockade of the ERK pathway inhibits the invasiveness of tumor cells: down-regulation of matrix metalloproteinase-3/-9/-14 and CD44. Biochem Biophys Res Commun. 2003;304:801–806. [PubMed]
32. Tran NL, Nagle RB, Cress AE, Heimark RL. N-Cadherin expression in human prostate carcinoma cell lines. An epithelial-mesenchymal transformation mediating adhesion with stromal cells. Am J Pathol. 1999;155:787–798. [PMC free article] [PubMed]
33. Merchant JL, Du M, Todisco A. Sp1 phosphorylation by Erk 2 stimulates DNA binding. Biochem Biophys Res Commun. 1999;254:454–461. [PubMed]
34. Milanini J, Vinals F, Pouyssegur J, Pages G. p42/p44 MAP kinase module plays a key role in the transcriptional regulation of the vascular endothelial growth factor gene in fibroblasts. J Biol Chem. 1998;273:18165–18172. [PubMed]
35. Milanini-Mongiat J, Pouyssegur J, Pages G. Identification of two Sp1 phosphorylation sites for p42/p44 mitogen-activated protein kinases: their implication in vascular endothelial growth factor gene transcription. J Biol Chem. 2002;277:20631–20639. [PubMed]
36. Kuo L, Chang HC, Leu TH, Maa MC, Hung WC. Src oncogene activates MMP-2 expression via the ERK/Sp1 pathway. J Cell Physiol. 2006;207:729–734. [PubMed]
37. Malik SN, Brattain M, Ghosh PM, Troyer DA, Prihoda T, Bedolla R, Kreisberg JI. Immunohistochemical demonstration of phospho-Akt in high Gleason grade prostate cancer. Clin Cancer Res. 2002;8:1168–1171. [PubMed]
38. Paweletz CP, Charboneau L, Bichsel VE, Simone NL, Chen T, Gillespie JW, Emmert-Buck MR, Roth MJ, Petricoin IE, Liotta LA. Reverse phase protein microarrays which capture disease progression show activation of pro-survival pathways at the cancer invasion front. Oncogene. 2001;20:1981–1989. [PubMed]
39. Whang YE, Wu X, Suzuki H, Reiter RE, Tran C, Vessella RL, Said WB, Isaacs WB, Sawyers CL. Inactivation of the tumor suppressor PTEN/MMAC1 in advanced human prostate cancer through loss of expression. Proc Natl Acad Sci USA. 1998;95:5246–5250. [PMC free article] [PubMed]
40. Uzgare AR, Kaplan PJ, Greenberg NM. Differential expression and/or activation of P38MAPK, erk1/2, and jnk during the initiation and progression of prostate cancer. Prostate. 2003;55:128–139. [PubMed]
41. Yang YM, Bos F, Charbono W, Dean N, McKay R, Rhim JS, Depatie C, Mercola D. c-Jun NH(2)-terminal kinase mediates proliferation and tumor growth of human prostate carcinoma. Clin Cancer Res. 2003;9:391–401. [PubMed]
42. Grunwald V, DeGraffenried L, Russe D, Friedrichs WE, Ray RB, Hidalgo M. Inhibitors of mTOR reverse doxorubicin resistance conferred by PTEN status in prostate cancer cells. Cancer Res. 2002;62:6141–6145. [PubMed]
43. Udayakumar TS, Nagle RB, Bowden GT. Fibroblast growth factor-1 transcriptionally induces membrane type-1 matrix metalloproteinase expression in prostate carcinoma cell line. Prostate. 2004;58:66–75. [PubMed]
44. Gioeli D, Mandell JW, Petroni GR, Frierson HF, Jr, Weber MJ. Activation of mitogen-activated protein kinase associated with prostate cancer progression. Cancer Res. 1999;59:279–284. [PubMed]
45. Shen YH, Godlewski J, Zhu J, Sathyanarayana P, Leaner V, Birrer MJ, Rana A, Tzivion G. Cross-talk between JNK/SAPK and ERK/MAPK pathways: sustained activation of JNK blocks ERK activation by mitogenic factors. J Biol Chem. 2003;278:26715–26721. [PubMed]
46. Nicolas M, Noe V, Ciudad CJ. Transcriptional regulation of the human Sp1 gene promoter by the specificity protein (Sp) family members nuclear factor Y (NF-Y) and E2F. Biochem J. 2003;371:265–275. [PMC free article] [PubMed]
47. Abdelrahim M, Safe S. Cyclooxygenase-2 inhibitors decrease vascular endothelial growth factor expression in colon cancer cells by enhanced degradation of Sp1 and Sp4 proteins. Mol Pharmacol. 2005;68:317–329. [PubMed]
48. Logan SK, Falasca M, Hu P, Schlessinger J. Phosphatidylinositol 3-kinase mediates epidermal growth factor-induced activation of the c-Jun N-terminal kinase signaling pathway. Mol Cell Biol. 1997;17:5784–5790. [PMC free article] [PubMed]

Articles from Neoplasia (New York, N.Y.) are provided here courtesy of Neoplasia Press
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...