• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Cell Microbiol. Author manuscript; available in PMC May 1, 2008.
Published in final edited form as:
PMCID: PMC1867455
NIHMSID: NIHMS13987

Nod1 mediates cytoplasmic sensing of combinations of extracellular bacteria

Abstract

During mucosal colonization, epithelial cells are concurrently exposed to numerous microbial species. Epithelial cytokine production is an early component of innate immunity and contributes to mucosal defense. We have previously demonstrated a synergistic response of respiratory epithelial cells to costimulation by two human pathogens, Streptococcus pneumoniae and Haemophilus influenzae. Here we define a molecular mechanism for the synergistic activation of epithelial signaling during polymicrobial colonization. H. influenzae peptidoglycan synergizes with the pore-forming toxin pneumolysin from S. pneumoniae. Radiolabeled peptidoglycan enters epithelial cells more efficiently in the presence of pneumolysin, consistent with peptidoglycan gaining access to the cytoplasm via toxin pores. Other pore-forming toxins (including anthrolysin O from Bacillus anthracis and Staphylococcus aureus α-toxin) can substitute for pneumolysin in the generation of synergistic responses. Consistent with a requirement for pore formation, S. pneumoniae expressing pneumolysin but not an isogenic mutant expressing a non-pore-forming toxoid prime epithelial responses. Nod1, a host cytoplasmic peptidoglycan-recognition molecule, is crucial to the epithelial response. Taken together, these findings demonstrate a role for cytosolic recognition of peptidoglycan in the setting of polymicrobial epithelial stimulation. We conclude that combinations of extracellular organisms can activate innate immune pathways previously considered to be reserved for the detection of intracellular microorganisms.

Introduction

The epithelial cells that line mucosal spaces such as the nasopharynx are in constant contact with a wide variety of microbial products. As a result, they must balance two seemingly contradictory properties, the need to detect potential infectious threats and the control of local inflammation. Mucosal surfaces are integral parts of the innate immune system, acting as an “early warning system” by sensing microbial patterns and initiating immune responses, including local recruitment of neutrophils. However, it is important that immune responses to the normal colonizing flora be limited, in order to prevent a constant inflammatory state and resultant tissue injury. To some extent, epithelial cells accomplish this by sequestering pattern recognition receptors either at the basolateral surface or intracellularly (Hornef et al., 2003; Hornef et al., 2002; Gewirtz et al., 2001). It has been hypothesized that this strategy may allow epithelial cells to detect invasive organisms that gain access to these normally protected spaces without manifesting constant responses to colonizing bacteria in the mucosal lumen.

Nod1 and Nod2 are cytoplasmic proteins that respond to components of bacterial peptidoglycan and activate innate immune signaling via activation of NFκB. Nod1 responds to meso-diaminopimelic acid (mesoDAP)-containing peptides, which are present in peptidoglycan from gram-negative and a limited number of gram-positive organisms (Chamaillard et al., 2003; Girardin et al., 2003b). Nod2 detects muramyl dipeptide (MDP), a constituent of peptidoglycan from both gram-positive and gram-negative bacteria (Tanabe et al., 2004; Girardin et al., 2003a). These pattern recognition proteins have been shown to act in detection of a variety of organisms, such as Shigella, that enter the epithelial cytosol (Opitz et al., 2004; Girardin et al., 2001) as well as in defense against obligate intracellular pathogens such as Chlamydia (Welter-Stahl et al., 2006). In addition, Nod1 detects Helicobacter pylori peptidoglycan that is delivered into the cytosol via a type IV secretion apparatus (Viala et al., 2004). Mutations in the genes encoding Nod2 and, to a lesser extent, Nod1 are thought to predispose to inappropriate responses to lumenal organisms (Hugot et al., 2001; Ogura et al., 2001), but in the absence of dedicated mechanisms for transport of peptidoglycan from bacteria into the host cell cytosol (such as the type IV secretion system in H. pylori) it is unclear how these proteins might detect peptidoglycan from extracellular sources.

We have previously shown that simultaneous colonization of the upper airway of mice with the human pathogens Streptococcus pneumoniae and Haemophilus influenzae leads to synergistic production of chemokines at the mucosal surface (Ratner et al., 2005). This response culminates in a vigorous recruitment of neutrophils, which mediate the outcome of competition between these two bacterial species for establishment of colonization (Lysenko et al., 2005). By modeling this polymicrobial stimulation using cells in culture, we defined an essential role for host NFκB and for pneumolysin, the pore-forming toxin from S. pneumoniae, in the synergistic epithelial response. In this study, we define a molecular mechanism for the synergistic activation of epithelial cell signaling pathways during polymicrobial colonization. Fragments of H. influenzae peptidoglycan enter epithelial cells through pneumolysin pores, leading to Nod1-mediated signaling and activation of NFκB. These findings demonstrate a role for cytosolic recognition of peptidoglycan in the setting of polymicrobial stimulation at mucosal surfaces. Our findings also demonstrate a situation in which combinations of extracellular organisms can activate epithelial innate immune pathways otherwise thought to be relevant only for microbes that gain access to cytoplasmic spaces.

Results

H. influenzae peptidoglycan contributes to synergistic epithelial responses

In order to model the synergistic inflammatory response previously observed during in vivo cocolonization with H. influenzae and S. pneumoniae, we stimulated human embryonic kidney cells transfected with NFκB-luciferase reporter plasmid with sonicated H. influenzae in the presence or absence of purified S. pneumoniae pneumolysin. Costimulation of epithelial cells with pneumolysin and sonicated H. influenzae led to a synergistic induction of NFκB-mediated transcription (Fig. 1A). In order to identify factors from H. influenzae responsible for its contribution to this effect, we took a biochemical approach. Pretreatment of sonicated H. influenzae with proteinase K to remove proteins or with a combination of DNase and RNase to remove nucleic acids did not significantly alter NFκB activation. Purified lipopolysaccharide from H. influenzae or from E. coli did not stimulate IL-8 production or NFκB activation in the presence or absence of pneumolysin (data not shown). In contrast, pretreatment of sonicated bacteria with lysozyme significantly enhanced the response of the human cells to costimulation with H. influenzae and pneumolysin (Fig. 1A), suggesting that fragmentation of peptidoglycan contributes to increased epithelial stimulation. Similar results were obtained when we assessed production of the neutrophil-recruiting chemokine interleukin (IL)-8 from A549 respiratory epithelial cells during exposure to treated H. influenzae with or without pneumolysin (Fig. 1B).

Figure 1Figure 1
Biochemical analysis of H. influenzae components that induce synergistic proinflammatory signaling in combination with purified S. pneumoniae pneumolysin. (A) HEK 293T cells transfected with NFκB-luciferase reporter plasmids were exposed to media ...

We tested the ability of purified H. influenzae peptidoglycan to substitute for whole bacteria in epithelial stimulation. Purified peptidoglycan (10 μg/ml) in combination with pneumolysin, but not alone, was sufficient to induce IL-8 production from epithelial cells (Fig. 2). This effect was not due to an alteration of the pore-forming capacity of pneumolysin, as addition of H. influenzae peptidoglycan (100 μg/ml) had no effect on the ability of pneumolysin (1–100 ng/ml) to lyse erythrocytes (data not shown). Likewise, heat-killed whole H. influenzae but not S. pneumoniae in combination with pneumolysin led to synergistic induction of NFκB-mediated transcription (Fig. 3A). Costimulation of epithelial cells with pneumolysin and purified peptidoglycan (25 μg/ml) from the gram-positive organisms S. pneumoniae (Fig. 3B) or S. aureus (data not shown) was not sufficient to activate NFκB. However, peptidoglycan (0.25–2.5 μg/ml) from another gram-negative bacterium, E. coli, did synergize with pneumolysin (Fig. 3C).

Figure 2
Purified H. influenzae peptidoglycan induces synergistic IL-8 production in the presence of pneumolysin. HEK 293 cells were treated with purified H. influenzae peptidoglycan (0, 1, 10, 100 μg/ml) in the presence or absence of Ply (100 ng/ml). ...
Figure 3Figure 3
Products of H. influenzae but not S. pneumoniae lead to NFκB-dependent transcription in the presence of pneumolysin. HEK 293T cells with or without Ply (100 ng/ml) were treated with (A) heat-killed H. influenzae (Hi) or S. pneumoniae (Sp) (each ...

Pneumolysin treatment increases uptake of H. influenzae peptidoglycan with epithelial cells

In order to test the hypothesis that pneumolysin pores act as a portal of entry for H. influenzae peptidoglycan fragments to access the epithelial cytoplasm, we measured the relative uptake of radiolabeled, purified H. influenzae peptidoglycan by A549 respiratory cells in the presence or absence of pneumolysin. As shown in Fig. 4, there was a significant increase in cell-associated radioactivity in the wells that received peptidoglycan in combination with pneumolysin as compared to peptidoglycan alone.

Figure 4
Pneumolysin increases epithelial cell uptake of H. influenzae peptidoglycan. A549 cells were treated with 3H-Ala-labeled purified H. influenzae peptidoglycan (PGN) in the presence or absence of pneumolysin (Ply, 100 ng/ml) for 4 hrs. Cells were extensively ...

Nod1 mediated signaling is necessary and sufficient for the synergistic epithelial response to polymicrobial stimulation

Because peptidoglycan from gram-negative but not gram-positive organisms led to synergistic epithelial NFκB activation in the presence of pneumolysin, we hypothesized that Nod1, a cytoplasmic protein that is expressed in epithelial cells and specifically senses mesoDAP-containing peptidoglycan fragments (Girardin et al., 2003b), is an integral part of this epithelial innate immune pathway. We used FK156, a synthetic Nod1 agonist, to substitute for gram-negative peptidoglycan in our system. Treatment of HEK293 cells with FK156 (1 μg/ml) and pneumolysin together led to increased production of IL-8 (Fig. 5A) and activation of NFκB-mediated transcription (Fig. 5B). In contrast, FK156 was a poor stimulus of either IL-8 production or NFκB-mediated transcription in the absence of pneumolysin (Fig. 5A and 5B). This indicates that in these cells, the concurrent presence of a Nod1 agonist and the pore-forming toxin is necessary for the generation of a synergistic response.

Figure 5Figure 5Figure 5
Nod1 mediates cytosolic detection of peptidoglycan and is essential for synergistic epithelial responses. (A) A549 cells were treated with the synthetic Nod1 ligand FK156 (0, 1, 10 μg/ml) with or without pneumolysin (Ply, 100 ng/ml) for 18 hrs ...

Disruption of Nod1-mediated signaling in HEK 293T cells by overexpression of a dominant-negative form of Nod1 (Nod1ΔCARD; Fig. 5B) abolished the synergistic response to FK156 and pneumolysin. Likewise, Nod1ΔCARD inhibited the synergistic response to heat-killed H. influenzae or H. influenzae peptidoglycan in the presence of pneumolysin (Fig. 5D and 5E), as did Nod1 siRNA (Fig. 5C). Neither Nod1ΔCARD nor Nod1 siRNA constructs inhibited the NFκB or IL-8 response of cells to a control stimulus (TNF-α, 10 ng/ml, data not shown).

The pore-forming property of pneumolysin accounts for its contribution to synergistic epithelial responses

We tested PdB, a point mutant toxoid of pneumolysin (W433F) that is 1000-fold less efficient at forming pores (Paton et al., 1991), and found that wild-type pneumolysin, but not PdB, enhanced the response of HEK293 cells to the Nod1 agonist FK156 (Fig. 6A). Consistent with this finding, we noted that α-hemolysin from Staphylococcus aureus, a pore-forming toxin structurally unrelated to pneumolysin (Bhakdi and Tranum-Jensen, 1991), and anthrolysin O from Bacillus anthracis, which like pneumolysin is a cholesterol-dependent cytolysin (Shannon et al., 2003), also led to synergistic enhancement of FK156-induced NFκB activation (Fig. 6B).

Figure 6Figure 6
Toxin-mediated pore formation is essential for synergistic responses to Nod1 ligands. NFκB-dependent luciferase activity at 6 hrs was assayed in HEK 293T cells treated with (A) FK156 (1 μg/ml) and either Ply or the point-mutant toxoid ...

In order to demonstrate that the pore-forming activity of pneumolysin is the sole component from S. pneumoniae that primes epithelial responses to Nod1 ligands, we constructed a series of pneumococcal mutants. An unmarked, in-frame deletion of ply was constructed, as were isogenic strains expressing either intact pneumolysin or the PdB toxoid. The deletion strain and the PdB-expressing were defective in pore-forming capacity as assayed by hemolysis. We found that treatment of epithelial cells with pneumolysin-expressing S. pneumoniae and the Nod1 ligand FK156 led to enhancement of the IL-8 reponse. In contrast, a synergistic response was not seen with the toxoid-expressing strain or the strain with a complete deletion of ply (Fig. 6C). This finding confirms the indispensable nature of the pore-forming activity of pneumolysin in this system.

Discussion

In this report, we have demonstrated a novel mechanism for enhancement of epithelial cell innate immune responses in the setting of simultaneous exposure to products from gram-positive and gram-negative bacteria. Sophisticated control mechanisms exist to prevent inappropriate inflammatory responses at multiply colonized mucosal surfaces, including sequestration of pattern-recognition molecules away from the apical surface of epithelial cells. We have previously shown in vivo that cocolonization of the murine nasopharynx with S. pneumoniae and H. influenzae leads to a synergistic inflammatory response that results in clearance of S. pneumoniae from that niche (Lysenko et al., 2005). Here we define a potential cellular mechanism for that response, entry of peptidoglycan from H. influenzae into the epithelial cytoplasm through pores induced by the protein toxin pneumolysin from S. pneumoniae. Once the mesoDAP-containing peptidoglycan fragments have entered this normally protected space, they stimulate Nod1-mediated innate immune responses, culminating in the activation of NFκB and production of proinflammatory cytokines.

We determined that the factor from H. influenzae that led to synergistic epithelial responses in the setting of pneumolysin was proteinase K-resistant, nuclease-resistant, and enhanced by the addition of lysozyme. After excluding LPS, this suggested peptidoglycan as a likely candidate. We were unable to directly show that peptidoglycan was the single, necessary component from H. influenzae by constructing a deletion mutant, as such mutants are non-viable. However, we demonstrated that purified peptidoglycan could substitute for whole H. influenzae bacteria in the induction of a synergistic epithelial response and that its association with epithelial cells increased in the setting of pneumolysin.

We were surprised to find that purified peptidoglycan from S. pneumoniae was a poor stimulus for epithelial responses, even with the addition of purified pneumolysin. This is consistent with our prior finding of limited inflammation in the setting of mono-colonization as compared to polymicrobial colonization (Ratner et al., 2005). It may be beneficial to the pneumococcus to limit the magnitude of the local inflammatory response generated to its own products during colonization. Because Nod1 specifically discriminates mesoDAP-containing peptidoglycan (such as that produced by H. influenzae) from other peptidoglycan species (such as from S. pneumoniae), we hypothesized that epithelial Nod1 might be important to the synergistic response to H. influenzae and S. pneumoniae. The Nod1 pathway is active in epithelial cells, though specific mechanisms allowing non-invasive organisms to initiate Nod1-dependent signaling are not well understood (Uehara et al., 2006; Uehara et al., 2005). Using a synthetic Nod1 agonist, FK156, and multiple means of inhibiting Nod1 signaling (including siRNA and overexpression of a dominant negative construct) we showed that this pathway is necessary and sufficient for synergistic responses to costimulation. Of note, HEK293 cells, which express both Nod1 and Nod2 (Girardin et al., 2003b), did not manifest an appreciable response to the combination of pneumolysin and the Nod2 agonist muramyl dipeptide (data not shown). Why is the response to gram-negative peptidoglycan enhanced in the setting of a pore-forming toxin while the response to gram-positive peptidoglycan or whole S. pneumoniae is substantially less? It is possible that peptidoglycan released during growth of gram-negative organisms is in a form that either passes through the pore more readily (i.e. has smaller-sized fragments) or that the meso-DAP ligand is more bioactive than the muramyl dipeptide ligand in peptidoglycan derived from bacteria. These hypotheses are the subject of ongoing work.

The mechanism defined in our study adds to a growing number of ways in which components of predominantly extracellular organisms may enter the cytosol of non-professional phagocytes. These include the delivery of peptidoglycan through a type IV secretion apparatus in H. pylori and streptolysin O-mediated protein translocation in Streptococcus pyogenes (Viala et al., 2004; Madden et al., 2001). In this report, we describe a novel means for a bacterial factor to gain access to the host cytoplasm, through pores formed by toxins from an unrelated bacterial species.

A synthetic Nod1 agonist and an unrelated mesoDAP-containing peptidoglycan could substitute for H. influenzae peptidoglycan in epithelial stimulation. Both the related toxin ALO and α-hemolysin, a structurally unrelated toxin, induced synergistic responses in combination with Nod1 agonists. It is notable that while others have reported NFκB activation in the setting of sublethal PFT stimulation, we found no effect of PFT alone (Rose et al., 2002; Walev et al., 2002). This may be the result of dosage, target cell lines chosen, or other factors. Likewise, whole pneumococci expressing pneumolysin but not PdB toxoid enhanced the epithelial response to a Nod1 agonist. This implies that pneumolysin-mediated pore formation is the primary contribution of the pneumococcus to the synergistic epithelial response. From these observations, we suggest that enhancement of epithelial proinflammatory signaling in the setting of polymicrobial stimulation may be a general phenomenon. Pore-forming toxins are present in a variety of bacterial species, including many medically important pathogens (Tweten, 2005). By amplifying mucosal responses to nearby bacteria, these toxins may have effects on mucosal defense that have not been appreciated to date. Combinations of factors from various extracellular organisms may act in concert on epithelial cells, especially during polymicrobial colonization of mucosal surfaces, and the resulting responses may be quite different from stimulation with a single organism (Ratner et al., 2005). This finding has implications for our understanding of the responses of mucosal surfaces to their resident microbial populations. In this regard, we have previously demonstrated that local innate immune responses may dictate the outcome of competition between species occupying the same mucosal niche (Lysenko et al., 2005). We hypothesize that host organisms, including humans, may have evolved means of detecting combinations of colonizing organisms rather than simply single species and that mucosal responses may be tuned to respond to particular combinations of microbes in ways that are qualitatively and quantitatively different than the response to single species.

Materials and Methods

Bacterial strains and products

S. pneumoniae D39, an encapsulated type 2 strain (Avery et al., 1944), and H. influenzae H233, a non-typeable clinical isolate, were grown as previously described (Gould and Weiser, 2001). Where indicated, organisms were washed twice in PBS and then heat-killed at 70°C for 30 min and/or sonicated on ice three times for 15 sec each.

S. pneumoniae R6ΔPly::Janus, which has the bicistronic Janus cassette (Sung et al., 2001) inserted in the pneumolysin locus, was kindly provided by R. Malley. The pneumolysin::Janus construct was amplified by PCR using primers PlyR6(GAAAGTTTCAGCCAAGTTTGACAAAGTCAGCTC) and PlyF6 (AAAAAAGAAGCCGATAAGGAAAAGATGAGCG)and transformed into strain P1121, derived from human experimental colonization studies) (McCool et al., 2002). The full-length pneumolysin gene from P1121 was amplified by PCR using primers PlySpBamHIF2(TCGGATCCGAGAGGAGAATGCTTGCGACAAAAAGA) and PlySpBamHIR2 (TCGGATCCCTTCTACCTCCTAATAAGTTCCTGGA). Site-directed mutagenesis to construct the W433F substitution was performed by overlap extension PCR using primers PlyW433FF1 (TAGAGAGTGTACCGGGCTTGCCTTTGAATGGTGGCGTACGGTTTAT) and PlyW433FR1 (ATAAACCGTACGCCACCATTCAAAGGCAAGCCCGGTACACTCTCTA). The construct containing a complete deletion of the pneumolysin gene was made by digestion with BamHI to remove the coding sequence and religation. PCR products were transformed into P1121ΔPly::Janus, and colonies were screened for loss of sensitivity to streptomycin (200 μg/ml) corresponding to loss of the Janus cassette (Sung et al., 2001), as well as by PCR. Genotype was confirmed by sequencing of the entire pneumolysin gene. Lack of hemolysis by the deletion mutant and decreased hemolysis by the PdB-expressing strain were confirmed by horse erythrocyte lysis assay as previously described (Ratner et al., 2006). Equivalent expression of pneumolysin and PdB and absence of expression in the deletion strain was confirmed by Western blot using an antibody to pneumolysin (Novocastra, Newcastle upon Tyne, UK; data not shown).

Purified, recombinant anthrolysin O (ALO) was the gift of R. Rest and E. Mosser (Drexel University). Purified pneumolysin and PdB toxoid were the gift of J. Paton (University of Adelaide). α-hemolysin from S. aureus, muramyl dipeptide, human TNF-α, and lipopolysaccharide from E. coli were purchased from Sigma. Peptidoglycan from Staphylococcus aureus and E. coli were purchased from Invivogen (San Diego, CA).

Treatment of sonicated organisms with proteinase K (Fisher, 100 μg/ml) or DNase/RNase (Promega, 100 U/ml) or lysozyme (Boehringer Mannheim, 20 μg/ml) was for 2 hr at 37°C.

Peptidoglycan purification

Peptidoglycan from H. influenzae H233 was purified as described (Burroughs et al., 1993; Glauner, 1988). Briefly, H233 was grown overnight in brain-heart infusion broth supplemented with NAD (2 μg/ml) and Fildes enrichment (Difco, 2% final concentration). Bacteria were washed in PBS, boiled in 5% SDS in water (30 min), and left at room temperature overnight. The SDS-insoluble fraction was collected by centrifugation at 100,000 × g (1 hr, RT). The pellet was washed with water and respun four times and then taken up in 5 ml of 10mM Tris-HCl (pH 7.5). Glycogen was removed by digestion with α-amylase (Fluka; 100 μg/ml, 37°C, 2 hrs), and proteins were removed by treatment with pronase (Sigma; 200 μg/ml, 60°C, 2 hr). Remaining enzyme was removed by re-boiling in 5% SDS and centrifugation as above. The pellet was washed in 8M LiCl2, 0.1M EDTA and acetone and then resuspended in sterile PBS. Where noted, the peptidoglycan was digested with mutanolysin (Sigma, 20 μg/ml) or lysozyme (Boehringer Mannheim, 20 μg/ml) prior to use. Peptidoglycan from S. pneumoniae was purified using a similar protocol with the following exceptions. Sodium layrilsarkolysin was added to a final concentration of 0.5% prior to boiling in 5% SDS. The preparation was treated with DNase and RNase, and trypsin was substituted for pronase. Teichoic acid was removed by treatment with hydrofluoric acid (49%) as described (Severin et al., 1997).

Epithelial cell lines and culture conditions

A549 (ATCC CCL-185), HEK 293 (ATCC CRL-1573), and HEK 293T (gift of R. Bushman) cells were grown as previously described (Ratner et al., 2005).

Plasmids, transfection, and luciferase assays

Transfection of HEK 293 or 293T cells in 24 well plates and NFκB-luciferase assays were performed as previously described (Ratner et al., 2005).

Construction of Nod1ΔCARD

A vector encoding human Nod1 cDNA was purchased from Invivogen. FLAG-tagged Nod1ΔCARD (Nod1 aa 117-953) was constructed by PCR using Nod1 cDNA vector as template and primers FLAG-Nod1ΔCARD-up (CACCATGGACTACAAGGACGACGATGACAAAAGCAAAGTCGTGGTCAAC) and Nod1ΔCARD-down (GAAACAGATAATCCGCTTCTCATCTTCATA) This PCR product was cloned using the pcDNA3.1/V5-6xHis-TOPO cloning kit (Invitrogen) according to the manufacturer’s instructions. Expression of Nod1ΔCARD was verified by probing lysates of transfected cells using an antibody to the C-terminal V5 tag (Invitrogen). Cells transfected with pcDNA3.1/LacZ vector (Invitrogen) were used as vector controls.

Nod1 siRNA

Vector-based siRNA targeting human Nod1 was purchased from Invivogen, as was a control scrambled siRNA vector. siRNA vectors (500 μg/well) were transfected using FuGENE6 (Roche) concurrently with plasmids for NFκB-luciferase assay, as above.

Stimulation of epithelial cells and IL-8 ELISA

Stimulation of epithelial cells and assay of supernatants for IL-8 by ELISA (OptEIA, BD Pharmingen) were performed as previously described (Ratner et al., 2005).

Radiolabeled peptidoglycan association with epithelial cells

H. influenzae was grown in a chemically defined medium based on RPMI 1640 medium as previously described (Coleman et al., 2003) in the presence of 5 uCi 3H-labeled Ala (Amersham). Peptidoglycan was purified as above, and serum-weaned A549 cells in 12-well plates were exposed to 6 × 106 cpm of labeled peptidoglycan in the presence or absence of purified pneumolysin (100 ng/ml final concentration) for 4 hrs at 37°C, 5% CO2. Cells were washed ten times with serum-free MEM and then lysed in 1% Triton X-100 for scintillation counting.

Statistical analysis

Statistical testing was performed using GraphPad Prism (GraphPad Software, version 4). Comparisons among groups were done using ANOVA with Tukey post-tests as appropriate. Statistical significance was defined as P < 0.05.

Acknowledgments

This work was supported by grants from NIH (AI065450 to A.J.R. and AI054647 and AI1038446 to J.N.W.) and a PIDS-St. Jude Fellowship (to A.J.R.). We thank Richard Malley for S. pneumoniae R6ΔPly::Janus, J. Paton for pneumolysin and PdB, R. Rest and E. Mosser for ALO, Astellas Pharmaceuticals for FK156, and Suzanne Dawid for careful reading of the manuscript.

References

  • Avery OT, MacLeod CM, McCarty M. Studies on the chemical nature of the substance inducing transformation of pneumococcal types: induction of transformation by deoxyribonucleic acid fraction isolated from pneumococcus type III. J Exp Med. 1944;79:137–158. [PMC free article] [PubMed]
  • Bhakdi S, Tranum-Jensen J. Alpha-toxin of Staphylococcus aureus. Microbiol Rev. 1991;55:733–751. [PMC free article] [PubMed]
  • Burroughs M, Prasad S, Cabellos C, Mendelman PM, Tuomanen E. The biologic activities of peptidoglycan in experimental Haemophilus influenzae meningitis. J Infect Dis. 1993;167:464–468. [PubMed]
  • Chamaillard M, Hashimoto M, Horie Y, Masumoto J, Qiu S, Saab L, et al. An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid. Nat Immunol. 2003;4:702–707. [PubMed]
  • Coleman HN, Daines DA, Jarisch J, Smith AL. Chemically defined media for growth of Haemophilus influenzae strains. J Clin Microbiol. 2003;41:4408–4410. [PMC free article] [PubMed]
  • Gewirtz AT, Navas TA, Lyons S, Godowski PJ, Madara JL. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J Immunol. 2001;167:1882–1885. [PubMed]
  • Girardin SE, Boneca IG, Viala J, Chamaillard M, Labigne A, Thomas G, et al. Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J Biol Chem. 2003a;278:8869–8872. [PubMed]
  • Girardin SE, Tournebize R, Mavris M, Page AL, Li X, Stark GR, et al. CARD4/Nod1 mediates NF-kappaB and JNK activation by invasive Shigella flexneri. EMBO Rep. 2001;2:736–742. [PMC free article] [PubMed]
  • Girardin SE, Boneca IG, Carneiro LA, Antignac A, Jehanno M, Viala J, et al. Nod1 detects a unique muropeptide from gram-negative bacterial peptidoglycan. Science. 2003b;300:1584–1587. [PubMed]
  • Glauner B. Separation and quantification of muropeptides with high-performance liquid chromatography. Anal Biochem. 1988;172:451–464. [PubMed]
  • Gould JM, Weiser JN. Expression of C-reactive protein in the human respiratory tract. Infect Immun. 2001;69:1747–1754. [PMC free article] [PubMed]
  • Hornef MW, Normark BH, Vandewalle A, Normark S. Intracellular recognition of lipopolysaccharide by toll-like receptor 4 in intestinal epithelial cells. J Exp Med. 2003;198:1225–1235. [PMC free article] [PubMed]
  • Hornef MW, Frisan T, Vandewalle A, Normark S, Richter-Dahlfors A. Toll-like receptor 4 resides in the Golgi apparatus and colocalizes with internalized lipopolysaccharide in intestinal epithelial cells. J Exp Med. 2002;195:559–570. [PMC free article] [PubMed]
  • Hugot JP, Chamaillard M, Zouali H, Lesage S, Cezard JP, Belaiche J, et al. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease. Nature. 2001;411:599–603. [PubMed]
  • Lysenko ES, Ratner AJ, Nelson AL, Weiser JN. The role of innate immune responses in the outcome of interspecies competition for colonization of mucosal surfaces. PLoS Pathog. 2005;1:e1. [PMC free article] [PubMed]
  • Madden JC, Ruiz N, Caparon M. Cytolysin-mediated translocation (CMT): a functional equivalent of type III secretion in gram-positive bacteria. Cell. 2001;104:143–152. [PubMed]
  • McCool TL, Cate TR, Moy G, Weiser JN. The immune response to pneumococcal proteins during experimental human carriage. J Exp Med. 2002;195:359–365. [PMC free article] [PubMed]
  • Ogura Y, Bonen DK, Inohara N, Nicolae DL, Chen FF, Ramos R, et al. A frameshift mutation in NOD2 associated with susceptibility to Crohn's disease. Nature. 2001;411:603–606. [PubMed]
  • Opitz B, Puschel A, Schmeck B, Hocke AC, Rosseau S, Hammerschmidt S, et al. Nucleotide-binding oligomerization domain proteins are innate immune receptors for internalized Streptococcus pneumoniae. J Biol Chem. 2004;279:36426–36432. [PubMed]
  • Paton JC, Lock RA, Lee CJ, Li JP, Berry AM, Mitchell TJ, et al. Purification and immunogenicity of genetically obtained pneumolysin toxoids and their conjugation to Streptococcus pneumoniae type 19F polysaccharide. Infect Immun. 1991;59:2297–2304. [PMC free article] [PubMed]
  • Ratner AJ, Lysenko ES, Paul MN, Weiser JN. Synergistic proinflammatory responses induced by polymicrobial colonization of epithelial surfaces. Proc Natl Acad Sci U S A. 2005;102:3429–3434. [PMC free article] [PubMed]
  • Ratner AJ, Hippe KR, Aguilar JL, Bender MH, Nelson AL, Weiser JN. Epithelial Cells Are Sensitive Detectors of Bacterial Pore-forming Toxins. J Biol Chem. 2006;281:12994–12998. [PMC free article] [PubMed]
  • Rose F, Dahlem G, Guthmann B, Grimminger F, Maus U, Hanze J, et al. Mediator generation and signaling events in alveolar epithelial cells attacked by S. aureus alpha-toxin. Am J Physiol Lung Cell Mol Physiol. 2002;282:L207–214. [PubMed]
  • Severin A, Horne D, Tomasz A. Autolysis and cell wall degradation in a choline-independent strain of Streptococcus pneumoniae. Microb Drug Resist. 1997;3:391–400. [PubMed]
  • Shannon JG, Ross CL, Koehler TM, Rest RF. Characterization of anthrolysin O, the Bacillus anthracis cholesterol-dependent cytolysin. Infect Immun. 2003;71:3183–3189. [PMC free article] [PubMed]
  • Sung CK, Li H, Claverys JP, Morrison DA. An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl Environ Microbiol. 2001;67:5190–5196. [PMC free article] [PubMed]
  • Tanabe T, Chamaillard M, Ogura Y, Zhu L, Qiu S, Masumoto J, et al. Regulatory regions and critical residues of NOD2 involved in muramyl dipeptide recognition. Embo J. 2004;23:1587–1597. [PMC free article] [PubMed]
  • Tweten RK. Cholesterol-dependent cytolysins, a family of versatile pore-forming toxins. Infect Immun. 2005;73:6199–6209. [PMC free article] [PubMed]
  • Uehara A, Fujimoto Y, Kawasaki A, Kusumoto S, Fukase K, Takada H. Meso-diaminopimelic acid and meso-lanthionine, amino acids specific to bacterial peptidoglycans, activate human epithelial cells through NOD1. J Immunol. 2006;177:1796–1804. [PubMed]
  • Uehara A, Sugawara Y, Kurata S, Fujimoto Y, Fukase K, Kusumoto S, et al. Chemically synthesized pathogen-associated molecular patterns increase the expression of peptidoglycan recognition proteins via toll-like receptors, NOD1 and NOD2 in human oral epithelial cells. Cell Microbiol. 2005;7:675–686. [PubMed]
  • Viala J, Chaput C, Boneca IG, Cardona A, Girardin SE, Moran AP, et al. Nod1 responds to peptidoglycan delivered by the Helicobacter pylori cag pathogenicity island. Nat Immunol. 2004;5:1166–1174. [PubMed]
  • Walev I, Hombach M, Bobkiewicz W, Fenske D, Bhakdi S, Husmann M. Resealing of large transmembrane pores produced by streptolysin O in nucleated cells is accompanied by NF-kappaB activation and downstream events. Faseb J. 2002;16:237–239. [PubMed]
  • Welter-Stahl L, Ojcius DM, Viala J, Girardin S, Liu W, Delarbre C, et al. Stimulation of the cytosolic receptor for peptidoglycan, Nod1, by infection with Chlamydia trachomatis or Chlamydia muridarum. Cell Microbiol. 2006;8:1047–1057. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links