• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of brjopthalBritish Journal of OphthalmologyCurrent TOCInstructions for authors
Br J Ophthalmol. Jan 2007; 91(1): 105–110.
Published online Aug 30, 2006. doi:  10.1136/bjo.2006.099192
PMCID: PMC1857594

Supplementation of CD4+CD25+ regulatory T cells suppresses experimental autoimmune uveoretinitis

Abstract

Aims

To investigate whether supplementation of natural CD4+CD25+ regulatory T cells ameliorates mouse experimental autoimmune uveoretinitis (EAU) induced by CD4+ T cell‐dependent interphotoreceptor retinoid‐binding protein (IRBP).

Methods

C57BL/6 mice were immunised with human interphotoreceptor retinoid‐binding protein peptide 1–20 (IRBP1–20), and IRBP1–20‐sensitised T cells were obtained. CD4+CD25+ T cells derived from naive mice were cocultured with IRBP1–20‐sensitised T cells, and their proliferation responses and cytokine production were measured. In addition, CD4+CD25+ T cells were transferred intravenously into mice 7 or 15 days after immunisation with IRBP1–20, and the severity of EAU and T cell proliferation responses were evaluated.

Results

CD4+CD25+ regulatory T cells effectively inhibited both the proliferation of, and interleukin (IL)2, IL5 and interferon (IFN)γ production by, IRBP1–20‐sensitised T cells. Adoptive transfer of CD4+CD25+ regulatory T cells to IRBP1–20‐immunised mice conferred considerable protection from EAU development and inhibition of T cell proliferation responses to IRBP1–20.

Conclusion

These findings show that natural CD4+CD25+ regulatory T cells possess the ability to inhibit activation of IRBP‐reactive T cells that have been already sensitised in vivo, and adoptive transfer of these cells ameliorates EAU even in the effector phase. Supplementation of natural CD4+CD25+ regulatory T cells may have therapeutic potential for effective treatment of uveitis.

CD4+CD25+ regulatory T cells play a major role in regulating autoimmune responses in mice, and these cells have also been identified in humans.1,2,3,4,5,6,7 CD4+CD25+ thymocytes possessing T cell receptors (TCRs) with high affinity for a self peptide are selected, and these cells mature into CD4+CD25+ regulatory T cells and migrate to the periphery from around day 3 of birth.8 In several autoimmune disease models, such as encephalomyelitis, gastritis and rheumatoid arthritis, the therapeutic potential of CD4+CD25+ regulatory T cells has been indicated.9,10,11,12 CD4+CD25+ regulatory T cells in normal mice are non‐responsive to antigen‐specific stimulation in vitro; however, on stimulation by TCR, these cells suppress the activation of other CD4+ T cells in an antigen‐non‐specific manner.4 The mechanism of action of CD4+CD25+ regulatory T cells is not completely elucidated, although it is known to involve cell–cell contact, and in some instances, immunoregulatory cytokines such as interleukin (IL)10 and transforming growth factor (TGF)β.13,14 Experimental autoimmune uveoretinitis (EAU), a model that shares many clinical and histological features with human uveitis such as Behçet's disease, Vogt–Koyanagi–Harada disease and sarcoidosis,15,16 is induced by immunisation with a retinal antigen (S‐antigen or interphotoreceptor retinoid‐binding protein (IRBP)) or by adoptive transfer of the retinal antigen‐specific T helper (Th)1 cells.17,18

In this study, we examined whether CD4+CD25+ regulatory T cells possess the ability to inhibit activation of retinal antigen‐specific T cells that have been already sensitised in vivo, and whether adoptive transfer of these cells is effective to ameliorate EAU even in the effector phase.

Materials and methods

Mice

Female C57BL/6 mice, 6–8 weeks old, were purchased from Japan CLEA (Shizuoka, Japan). All mice were treated in accordance with the Association for Research in Vision and Ophthalmology statement for the use of animals in ophthalmic and vision research.

Induction and scoring of EAU

Mice were immunised subcutaneously in the neck region with 200 μg of interphotoreceptor retinoid‐binding protein peptide (IRBP1–20; GPTHLFQPSLVLDMAKVLLD; TakaraBio, Shiga, Japan) emulsified in 0.2 ml of complete Freund's adjuvant (CFA; Difco, Detroit, Michigan, USA) containing 1 mg of Mycobacterium tuberculosis strain H37Ra (Difco), and given 100 ng of pertussis toxin (Sigma, St Louis, Missouri, USA) intraperitoneally as additional adjuvant.18 Funduscopic examination of mice was carried out on days 15, 18 and 21 after immunisation, and the clinical scores were graded 0–4 as described by Thurau et al.19 Histopathological assessment of EAU was conducted on day 21, and was scored on a scale of 0–4 in half‐point increments, according to a semiquantitative system described previously.16

Preparation of CD25+/− T regulator cells for adoptive transfer experiments

Splenic T cells were enriched on T cell columns (R&D, Minneapolis, Minnesota, USA), and were further purified by immunomagnetic depletion using anti‐CD8a, anti‐CD11b, anti‐B220, anti‐DX5 and anti‐Ter‐119 antibodies (Miltenyi Biotec, Gladbach, Germany). The purity of CD4+ cells was >80%, as assayed by flow cytometry. CD4+ T cells were sorted into CD25− and CD25+ populations using anti‐CD25 antibodies (7D4), anti‐rat κ microbeads (Miltenyi Biotec, Auburn, California, USA) and an AutoMACS (Miltenyi Biotec). The purity of the resulting CD4+CD25− cell population was >95%, and that of CD4+CD25+ cells was 95%, as assessed by flow cytometry (fig 11).). For adoptive transfer experiments, CD4+CD25− T cells (2.5×106) or CD4+CD25+ T cells (2.5×106) were injected intravenously into mice at 7 or 15 days after immunisation with IRBP1–20.

figure bj99192.f1
Figure 1 The extent of enrichment of CD25+ and CD25− cell subpopulations. CD4+CD25+ and CD4+CD25− T cells were isolated from the spleens of naive mice. Flow cytometry analyses, before enrichment ...

In vitro proliferation and cytokine assay

Cervical lymph node cells obtained from mice immunised with IRBP1–20 in the neck 14 days previously (responders 3×105/well) were cultured with CD4+CD25+ or CD4+CD25− T cells isolated from naive mice (regulators 3×105/well) in 0.2 ml RPMI 1640 buffer (Sigma Aldrich) containing 10 mM HEPES (2‐(4‐2 Hydroxyethye)‐(‐piperadinyl) ethanesulphonic acid, 0.1 mM non‐essential amino acid) 1 mM sodium pyruvate, 100 U/ml penicillin, 100 μg/ml streptomycin (all from Invitrogen Life Technologies, Carlsbad, California, USA), 1×10−5 M 2‐mercaptoethanol (Sigma Aldrich), 10% fetal calf serum and 10 μg/ml (IRBP1–20). For the cytokine assay, supernatants were collected after 48 h and analysed for interferon (IFN)γ, IL2, IL5 and IL10 by quantitative capture ELISA using OptEIA kits (BD PharMingen, San Diego, California, USA) and mouse IFNγ ELISA Ready‐SET‐Go kit (eBioscience, San Diego, California, USA). For the proliferation assay, the cells were cultured for 72 h, pulsed with 0.5 μCi (3H)‐thymidine 8 h before termination, and then harvested onto glass filters using an automated cell harvester. Radioactivity was assessed by liquid scintillation spectrometry, and the result expressed in counts per minute. In addition, proliferation responses of cervical lymph node cells and spleen cells from IRBP1–20‐immunised mice that had CD4+CD25+ or CD4+CD25− T cells adoptively transferred 7 days after immunisation were assayed 14 days after immunisation.

Reverse transcriptase–polymerase chain reaction of Foxp3

Total RNA was extracted from CD4+CD25− and CD4+CD25+ T cells freshly isolated from naive mice using an Isogen RNA isolation kit (Nippon Gene, Tokyo, Japan). First‐strand cDNAs were synthesised from 1 μg of total RNA in a 20‐μl reaction mixture containing oligo(dT) primer and avian myeloblastosis virus reverse transcriptase, by incubating at 42°C for 60 h. For polymerase chain reaction (PCR) amplification, cDNAs were amplified using primers as follows: GAPDH, 5′‐GGTGAAGGTCGGTGTGAACGGA‐3′ and 5′‐TGTTAGTGGGGTCTCGCTCCTG‐3′ (yielding an amplification product of 245 bp); and Foxp3, 5′‐CAGCTGCCTACAGTGCCCCTAG‐3′ and 5′‐CATTTGCCAGCAGTGGGTAG‐3′ (yielding an amplification product of 382 bp).20 PCR was carried out in a 50‐μl amplification mixture containing 1× polymerase buffer, 1.5 mM magnesium chloride, 0.2 mM of each dNTP, 1 μM of forward and reverse primers, and 1.25 U Taq polymerase (Promega, Madison, Wisconsin, USA). PCR cycling conditions were 94°C for 60 s, 57°C for 60 s and 72°C for 60 s for 30 cycles. The PCR products were separated by electrophoresis in 1% agarose gel containing 0.5 μg/ml ethidium bromide. The bands were analysed by densitometry, and gene expression was expressed as a ratio of the gene of interest to the GAPDH gene.

Statistical analysis

Results of experiments were analysed using the Mann–Whitney U test and Student's t test. Means were considered to be significantly different when p<0.05.

Results

Expression of Foxp3 in natural CD4+ T regulators from naive mice

Foxp3 is a transcriptional factor and is related to the regulatory functions of CD4+CD25+ regulator T cells.20 We investigated whether purified CD4+CD25+ T cells derived from spleens of naive mice expressed the Foxp3 gene. As predicted, Foxp3 gene was expressed in purified CD4+CD25+ T cells, and not in CD4+CD25− T cells (fig 22).). From these results, the CD4+CD25+ T cells harvested from spleens of naive mice are identified as natural CD4+CD25+ regulatory T cells, and these cells were used in subsequent experiments.

figure bj99192.f2
Figure 2 Expression of Foxp3 in CD4+ T regulatory cells derived from naive mice. (A) Foxp3 expression was determined by semiquantitative reverse transcriptase‐polymerase chain reaction (RT‐PCR) using cDNA samples obtained ...

CD4+CD25+ T cells inhibit the proliferation of, and Th1‐associated cytokine production by sensitised T cells obtained from mice immunised with IRBP1–20

We examined whether natural CD4+CD25+ regulatory T cells from normal mice can suppress the proliferation of, and cytokine production by, uveitogenic T cells sensitised in vivo by IRBP1–20 immunisation. Sensitised T cells derived from mice immunised with IRBP1–20 were cultured with CD4+CD25+ or CD4+CD25− T cells isolated from naive C57BL/6 mice, and the proliferation responses and Th1‐type and Th2‐type cytokine production were measured. As fig 33 shows, CD4+CD25+ T cells markedly inhibited the proliferation of uveitogenic T cells sensitised in vivo by IRBP1–20, whereas CD4+CD25− T cells failed to suppress their proliferation (fig 3A3A).). Consistent with the results of proliferation responses, CD4+CD25+ but not CD4+CD25− T cells reduced the IL2, IL5 and IFNγ production by uveitogenic T cells sensitised by IRBP1–20 (fig 3B–D). IL10 production by the uveitogenic T cells was not detectable in any culture (data not shown). We conclude that natural CD4+CD25+ regulatory T cells possess the capacity to suppress the proliferation and Th1 of, and the Th2 type cytokine production by uveitogenic T cells sensitised and activated in vivo by IRBP1–20 immunisation.

figure bj99192.f3
Figure 3 The proliferation of, and T helper (Th)1‐associated and Th2‐associated cytokine production uveitogenic T cells. The proliferation responses (A) and production of interleukin (IL)2 (B), IL5 (C), and interferon (IFN)γ ...

Adoptive transfer of CD4+CD25+ T cells inhibit T cell ‐ proliferation responses of mice immunised with IRBP1–20

As the next step, we examined whether adoptive transfer of natural CD4+CD25+ regulatory T cells can suppress sensitised T cells in vivo. CD4+CD25+ or CD4+CD25− T cells obtained from naive mice were adoptively transferred intravenously into mice immunised with IRBP1–20 7 days after immunisation, and proliferation responses of cervical lymph node cells and spleen cells isolated from the recipients were measured 14 days after immunisation. Although transfer of CD4+CD25+ T cells reduced the proliferation of lymph node‐derived uveitogenic T cells to IRBP1–20, the difference did not reach significance compared with mice receiving either no cell transfer or CD4+ CD25− T cells (fig 4A4A).). However, proliferation responses of spleen‐derived uveitogenic T cells were clearly suppressed by adoptive transfer of CD4+CD25+ T cells, which were significantly lower than those of other groups (fig 4B4B).

figure bj99192.f4
Figure 4 Effect of transfer of natural CD4+CD25+ T cells on the uveitogenic T cell responses to interphotoreceptor retinoid‐binding protein peptide 1–20 (IRBP1–20). Cervical lymph node cells and spleen cells ...

Transfer of CD4+ CD25+ regulatory T cells ameliorates the severity of EAU

The in vitro and in vivo evidence that natural CD4+CD25+ T cells suppressed activation of sensitised T cells suggested that natural CD4+CD25+ regulatory T cells are able to modulate progression of an EAU even in the efferent phase. Therefore, after natural CD4+CD25+ regulatory T cells purified from splenic CD4+ T cells of naive C57BL/6 mice were adoptively transferred intravenously into mice 7 days after immunisation with IRBP1–20, the clinical severity of EAU was investigated on days 15, 18 and 21 after immunisation, and the histopathological incidence and severity were evaluated on day 21. As fig 5A5A shows, six of seven C57BL/6 mice developed clinical EAU on day 15; the severity peaked on day 18 and was ameliorated on day 21. Adoptive transfer of CD4+CD25− T cells did not reduce the development of EAU in mice immunised with IRBP1–20, but conversely exacerbated the severity of the disease. As expected, both the incidence and severity of EAU were markedly reduced in recipients of CD4+CD25+ T cells at all the observation time points. On day 18, three of six mice were affected, and the mean severity score was 0.7. The histopathological incidence and scores of EAU on day 21 after immunisation, and the most severe cases of EAU in each group are displayed in figs 5B and CC,, respectively. Consistent with the results of clinical scores, six of seven mice immunised with IRBP1–20 alone and all seven IRBP1–20‐immunised mice that received transferred CD4+CD25− T cells developed EAU, with mean pathological scores >1, whereas only two of six IRBP1–20‐immunised mice that received transferred CD4+CD25+ T cells were affected, and the mean score decreased to 0.65 (fig 5B5B).). Mice receiving either no cell transfer or CD4+CD25− T cells showed inflammatory cell infiltration into the vitreous cavity and throughout all the retinal layers, together with intensive retinal vasculitis and partial destruction of the retinal layer. In contrast, mice receiving CD4+CD25+ T cells exhibited inflammatory cell infiltration in the vitreous cavity, but only a few infiltrating cells in the retina, and the retinal layers remained intact (fig 5C5C).

figure bj99192.f5
Figure 5 Experimental autoimmune uveoretinitis (EAU) in mice that had natural CD4+CD25+ regulatory T cells adoptively transferred. (A) Clinical severity of EAU was evaluated on days 15, 18 and 21 after immunisation by a blinded ...

Subsequently, to examine whether natural CD4+CD25+ regulatory T cells are able to modulate EAU at the peak of inflammation, CD4+CD25+ regulatory T cells purified from splenic CD4+ T cells of naive C57BL/6 mice were adoptively transferred 15 days after immunisation with IRBP1–20, and the histopathological incidence and severity of EAU were evaluated 21 days after immunisation. Transfer of CD4+CD25+ T cells clearly reduced both the incidence and the severity of EAU compared with mice receiving either no cell transfer or CD4+CD25− T cells, although there was no significant difference between each group (fig 66).

figure bj99192.f6
Figure 6 Effect of transfer of natural CD4+CD25+ regulatory T cells on the development of Experimental autoimmune uveoretinitis (EAU) during the effector phase. CD4+CD25+ or CD4+CD25− T cells obtained ...

Discussion

We have recently reported that mice depleted of natural CD4+CD25+ regulatory T cells spontaneously develop autoimmune uveoretinitis.21 In addition, Avichezer et al22 have shown that retinal antigen expression in the thymus is critical for the generation of autoimmune uveitis‐relevant CD4+CD25+ regulatory T cells, and that retinal antigen deficiency in the thymus considerably enhances uveitogenic T cell responses. These reports provide strong evidence that autoimmune uveitis‐relevant CD4+CD25+ regulatory T cells are present in the natural CD4+CD25+ regulatory T cell population. Although CD4+CD25+ regulatory T cells have inhibitory roles in an antigen‐non‐specific manner,23 the autoimmune uveitis‐relevant regulatory cells would be maintained in vivo by retinal antigen stimulation.

It has recently been shown that mycobacterial components in CFA activate CD25+ regulatory T cells of other specificities, which inhibit the generation of IRBP‐specific effector T cells in a bystander fashion.24 On the basis of these data, some of the natural CD25+ regulatory T cells transferred into mice immunised with hIRBP1–20 were possibly activated by CFA in vivo. In our study, the proliferation responses of splenocytes and the severity of EAU in the recipients with natural CD25+ regulatory T cells might also be inhibited by CFA‐activated CD25+ regulatory T cells of other specificities in a bystander fashion.

Previous studies have shown that CD4+CD25+ regulatory T cells inhibit the activation of autoreactive T cells.25,26 Regarding this regulatory mechanism, IL10 and TGFβ are considered to be the key molecules involved in immunosuppression by CD4+CD25+ regulatory T cells in some reports.13,14 In our in vitro study, in which IRBP‐sensitised T cells were stimulated with IRBP1–20, although CD25+ regulatory T cells inhibited the sensitised T cells to proliferate and produce IFNγ, no increase in IL10 was detected in the supernatant of cultures with CD4+CD25+ regulatory T cells. Further studies are required to gain an understanding of the exact mechanisms of how CD25+ regulatory T cells suppress the T cells specific for retinal self antigen.

In this series of experiments, adoptive transfer of as few as 2.5×106 CD4+CD25− naive T cells consistently increased the immune responses and the severity of EAU in the recipient. For instance, proliferation responses of spleen‐derived uveitogenic T cells were increased in the recipients receiving CD4+CD25− T cell populations to twice that in the recipients receiving no cells (fig 44).). It was previously reported that adoptive transfer of 1–5×107 CD4+CD25− naive T cells can induce autoimmune diseases such as gastritis and thyroiditis in nude mice.2 Therefore, it is conceivable that 2.5×106 of CD4+CD25− naive T cells contain adequate number of various autoreactive T cells, by which immune responses in mice receiving CD4+CD25− naive T cells would be increased.

In summary, our data show that supplementation of natural CD4+CD25+ T cells effectively suppresses EAU in the efferent phase by impairing the activation of in vivo sensitised T cells, and these regulatory T cells may have therapeutic potential for effective treatment of uveitis. Although several practical difficulties remain to be overcome for clinical application, technical improvements to expand CD4+CD25+ T cells would allow multiple transfers of regulatory T cells.

Abbreviations

CFA - complete Freund's adjuvant

EAU - experimental autoimmune uveoretinitis

IFN - interferon

IRBP - interphotoreceptor retinoid‐binding protein

IRBP1–20 - interphotoreceptor retinoid‐binding protein peptide 1–20

PCR - polymerase chain reaction

TCR - T cell receptor

TGF - transforming growth factor

Footnotes

Funding: This work was supported by Grant‐in‐Aid 17791258 for Scientific Research from the Japan Society for the Promotion of Science.

Competing interests: None declared.

References

1. Sakaguchi S. Naturally arising Foxp3‐expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non‐self. Nat Immunol 2005. 6345–352.352 [PubMed]
2. Sakaguchi S, Sakaguchi N, Asano M. et al Immunologic self‐tolerance maintained by activated T cells expressing IL‐2 receptor alpha‐chains (CD25). Breakdown of a single mechanism of self‐tolerance causes various autoimmune diseases. J Immunol 1995. 1551151–1164.1164 [PubMed]
3. Shevach E M. Regulatory T cells in autoimmmunity. Annu Rev Immunol 2000. 18423–449.449 [PubMed]
4. Thornton A M, Shevach E M. Suppressor effector function of CD4+CD25+ immunoregulatory T cells is antigen nonspecific. J Immunol 2000. 164183–190.190 [PubMed]
5. Dieckmann D, Plottner H, Berchtold S. et al Ex vivo isolation and characterization of CD4(+)CD25(+) T cells with regulatory properties from human blood. J Exp Med 2001. 1931303–1310.1310 [PMC free article] [PubMed]
6. Baecher‐Allan C, Brown J A, Freeman G J. et al CD4+CD25 high regulatory cells in human peripheral blood. J Immunol 2001. 1671245–1253.1253 [PubMed]
7. Jonuleit H, Schmitt E, Stassen M. et al Identification and functional characterization of human CD4(+)CD25(+) T cells with regulatory properties isolated from peripheral blood. J Exp Med 2001. 1931285–1294.1294 [PMC free article] [PubMed]
8. Jordan M S, Boesteanu A, Reed A J. et al Thymic selection of CD4+CD25+ regulatory T cells induced by an agonist self‐peptide. Nat Immunol 2001. 2301–306.306 [PubMed]
9. Morgan M E, Flierman R, van Duivenvoorde L M. et al Effective treatment of collagen‐induced arthritis by adoptive transfer of CD25+ regulatory T cells. Arthritis Rheum 2005. 522212–2221.2221 [PubMed]
10. Beyersdorf N, Gaupp S, Balbach K. et al Selective targeting of regulatory T cells with CD28 superagonists allows effective therapy of experimental autoimmune encephalomyelitis. J Exp Med 2005. 202445–455.455 [PMC free article] [PubMed]
11. Kohm A P, Carpentier P A, Anger H A. et al Cutting edge: CD4+CD25+ regulatory T cells suppress antigen‐specific autoreactive immune responses and central nervous system inflammation during active experimental autoimmune encephalomyelitis. J Immunol 2002. 1694712–4716.4716 [PubMed]
12. DiPaolo R J, Glass D D, Bijwaard K E. et al CD4+CD25+ T cells prevent the development of organ‐specific autoimmune disease by inhibiting the differentiation of autoreactive effector T cells. J Immunol 2005. 1757135–7142.7142 [PubMed]
13. Maloy K J, Powrie F. Regulatory T cells in the control of immune pathology. Nat Immunol 2001. 2816–822.822 [PubMed]
14. Nakamura K, Kitani A, Strober W. Cell contact‐dependent immunosuppression by CD4(+)CD25(+) regulatory T cells is mediated by cell surface‐bound transforming growth factor beta. J Exp Med 2001. 194629–644.644 [PMC free article] [PubMed]
15. Caspi R R, Roberge F G, Chan C C. et al A new model of autoimmune disease. Experimental autoimmune uveoretinitis induced in mice with two different retinal antigens. J Immunol 1988. 1401490–1495.1495 [PubMed]
16. Chan C C, Caspi R R, Ni M. et al Pathology of experimental autoimmune uveoretinitis in mice. J Autoimmun 1990. 3247–255.255 [PubMed]
17. Gregerson D S, Fling S P, Donoso L A. et al Unresponsiveness to self‐peptides of S‐antigen in EAU: an overview of recent results. Curr Eye Res 1992. 11(Suppl)67–74.74 [PubMed]
18. Avichezer D, Silver P B, Chan C C. et al Identification of a new epitope of human IRBP that induces autoimmune uveoretinitis in mice of the H‐2b haplotype. Invest Ophthalmol Vis Sci 2000. 41127–131.131 [PubMed]
19. Thurau S R, Chan C C, Nussenblatt R B. et al Oral tolerance in a murine model of relapsing experimental autoimmune uveoretinitis (EAU): induction of protective tolerance in primed animals. Clin Exp Immunol 1997. 109370–376.376 [PMC free article] [PubMed]
20. Hori S, Nomura T, Sakaguchi S. Control of regulatory T cell development by the transcription factor Foxp3. Science 2003. 2991057–1061.1061 [PubMed]
21. Takeuchi M, Keino H, Kezuka T. et al Immune responses to retinal self‐antigens in CD25(+)CD4(+) regulatory T‐cell‐depleted mice. Invest Ophthalmol Vis Sci 2004. 451879–1886.1886 [PubMed]
22. Avichezer D, Grajewski R S, Chan C C. et al An immunologically privileged retinal antigen elicits tolerance: major role for central selection mechanisms. J Exp Med 2003. 1981665–1676.1676 [PMC free article] [PubMed]
23. Sakaguchi S. Regulatory T cells: key controllers of immunologic self‐tolerance. Cell 2000. 101455–458.458 [PubMed]
24. Grajewski R S, Silver P B, Agarwal R K. et al Endogenous IRBP can be dispensable for generation of natural CD4+CD25+ regulatory T cells that protect from IRBP‐induced retinal autoimmunity. J Exp Med 2006. 203851–856.856 [PMC free article] [PubMed]
25. Takahashi T, Kuniyasu Y, Toda M. et al Immunologic self‐tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int Immunol 1998. 101969–1980.1980 [PubMed]
26. Itoh M, Takahashi T, Sakaguchi N. et al Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self‐tolerance. J Immunol 1999. 1625317–5326.5326 [PubMed]

Articles from The British Journal of Ophthalmology are provided here courtesy of BMJ Group
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links