• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Antiviral Res. Author manuscript; available in PMC Feb 1, 2008.
Published in final edited form as:
PMCID: PMC1828627
NIHMSID: NIHMS18003

Comparison of the inhibitory effects of interferon alfacon-1 and ribavirin on yellow fever virus infection in a hamster model

Abstract

Antiviral compounds were evaluated for efficacy against yellow fever virus (YFV) in a hamster model of YFV-induced liver disease. Challenge with a 102 50% cell culture infectious doses of YFV resulted in a 50–80% mortality rate in female hamsters. Virus was detected by QRT-PCR in liver, kidney, spleen, and serum with peak titers on 4–6 days post-viral challenge (dpi). Serum levels of alkaline phosphatase, alanine aminotransferase (ALT), bilirubin, blood urea nitrogen, potassium, and creatinine were significantly elevated, while serum levels of albumin, amylase, glucose, calcium, globulin, phosphorus, sodium, and total protein were significantly reduced. Packed cell volume and white blood cell count were significantly elevated during the course of the infection. Intraperitoneal treatment of hamsters with 0.5–5 μg/kg/d interferon (IFN) alfacon-1, 100 mg/kg/d viramidine, or 50 mg/kg/d ribavirin, initiated 4 h prior to YFV challenge, resulted in significant improvement in survival and serum ALT levels. Treatment with IFN alfacon-1 or ribavirin starting 2 dpi, also significantly improved survival and serum ALT levels in hamsters challenged with YFV. Pre- and post-virus exposure treatment with IFN alfacon-1 was efficacious in improving disease in YFV-infected hamsters.

Keywords: Yellow fever virus, Flavivirus, Interferon, Infergen, Ribavirin, Antiviral, Hamster, Alanine aminotransferase, Treatment

1. Introduction

There are no specific antiviral agents for the treatment of yellow fever virus (YFV), and despite a commercial YFV vaccine, there are still approximately 30,000 deaths worldwide each year and cases have been increasing in the last 20 years (Tomori, 2004). The virus is endemic in Africa and South America, but cases of YFV have been reported in nonendemic areas after travel (Bae et al., 2003; McFarland et al., 1997). Viscerotropic infections have also occurred with vaccination, so there is also risk of infection with vaccine strains (Anon., 2002; Martin et al., 2001; Vasconcelos et al., 2001). Therefore, the development of therapies for treatment of YFV disease is not only important for those in endemic areas, but also for those that may travel to endemic areas or those who may experience disease after vaccination.

YFV is a single-stranded RNA virus of the Flaviviridae family, and is related to hepatitis C, dengue, West Nile, and other viruses of human concern. Mosquito species of Aedes and Haemogogus transmit YFV and serve as a reservoir for the virus; humans and monkeys are the primary hosts for viral infection (Lourenco-de-Oliveira et al., 2004; Vasconcelos et al., 2003). The disease may be limited to a mild febrile illness or may be more severe, including jaundice, renal failure, vascular instability, and shock (Monath and Barrett, 2003). There is an approximately 50% case fatality rate in severe YFV cases (Tomori, 2004).

Until recently, non-human primates such as macaques and squirrel monkeys, have been the only available animal models for YFV-induced liver disease (Arroyo et al., 1988; Guirakhoo et al., 2002; Monath et al., 2002). Development of a hamster model for YFV-induced liver disease has been recently described (Tesh et al., 2001; Xiao et al., 2001; Sbrana et al., 2006). The availability of such a model has made it possible to screen potential antiviral agents for activity against the virus in a small animal model. The purpose of this study was to further characterize the hamster YFV for use in the evaluation of antiviral compounds for efficacy against the virus.

2. Materials and Methods

2.1. Virus

Jimenez, hamster-adapted (HA), YFV was kindly provided by Robert Tesh (University of Texas Medical Branch, Galveston, TX). Stock virus was prepared by intraperitoneal (i.p.) inoculation of 5 adult female hamsters. The livers of the infected hamsters were removed 3 days post-virus injection (dpi), and homogenized in a 2 X volume of sterile PBS. The homogenate was clarified by allowing tissue to settle for 15 minutes, and the supernatant was collected and frozen in aliquots at –80° C. The virus was titrated in hamsters, and a 10−4 dilution was used in subsequent studies, which dose corresponded with 102 50% cell culture infectious doses (CCID50)/0.1 ml as determined by infectious cell culture assay.

2.2. Animals

Six- to eight-week-old (110–140 g) female Syrian golden hamsters were used (Simonsen Laboratories, Gilroy, CA). Animals were challenged intraperitoneally (i.p.) with 10-fold dilutions of virus stock to determine an acceptable infectious dose. The hamsters were randomly assigned to cages, and given food and water ad libitum. All work with these animals was performed in the Biosafety Level 3 (BL-3) area of the AAALAC-accredited Laboratory Animal Research Center (LARC) at Utah State University (USU).

2.3. Compounds

Interferon alfacon-1 (IFN alfacon-1, infergen), a consensus-type interferon, was provided by InterMune, Inc. (Brisbane, CA) as an aqueous solution. Animals were treated with 5 μg/kg/d for 7 days. IFN alfacon-1 has a specific activity of 1 X 109 Units/mg of protein. In the present study, hamsters were dosed at 5 μg/kg/d IFN alfacon-1, which converts to 5 MU/kg/day. Ribavirin was provided by Valeant Pharmaceuticals (Costa Mesa, CA) and was used at 50 mg/kg/d. Viramidine (ribamidine) was also provided by Valeant Pharmaceuticals and was used at 100 mg/kg/d. All of the compounds were prepared in sterile physiological saline just prior to use, and stored at 4°C thereafter.

2.4. Quantitative Real-time RT-PCR (QRT-PCR)

Primer-pairs (forward AGTTGATTCCATCTTGGGCTTC, reverse ACCTCTTCCTCTCCATCCCATC) and Taq-man probe (5’ 6-carboxyfluorescein-CCTATGGTGGCTCATGGAAGTTGGAAGG-6-carboxy-N,N,N’,N’-tetramethylrhodamine-3’) specific for nucleotides 4767-4860 of the Asibi YFV strain (AY640589.1) were used (Qiagen, Valencia, CA). The one-step Brilliant QRT-PCR master mix 1-step kit (Stratagene, La Jolla, CA) was used for RT and amplification of YFV RNA with primers and probe at 0.2 μM. RNA was isolated from tissue using Trizol (Invitrogen, Carlsbad, CA) according to manufactures instructions and pelleted RNA was reconstituted in 100 μl of DEPC-treated water and stored at –20°C. One μl of total cellular RNA (from a total of 100 μl), extracted from infected or control tissues was used. Samples were run on a DNA Engine Opticon 2 (MJ Research Inc, Waltham, MA). Reverse transcription of cellular RNA was performed for 30 min at 50°C followed by PCR, which consisted of 40 cycles of 15 s at 95°C and 60 sec at 61°C. Results were given in terms of relative equivalents (re), reflecting the amount of YFV present in the sample as extrapolated from a standard curve obtained from amplification of a dilution of total RNA obtained 2 dpi from Vero cells infected with YFV.

2.5. VetScan diagnostics

A volume of 100 μl of serum, obtained at necropsy, was loaded on a VetScan Comprehensive Diagnostic Profile reagent rotor and run on the VetScan Chemistry Analyzer following manufacturer instructions. Serum levels of alanine aminotransferase (ALT), albumin, alkaline phosphatase, amylase, calcium, creatinine, globulin, glucose, phosphorus, potassium, sodium, total bilirubin, total protein, and blood urea nitrogen (BUN), were measured.

2.6. Serum ALT assay

Serum ALT was determined using an ALT reagent kit (Teco Diagnostics, Anaheim, CA). A volume of 50 μl of ALT substrate was placed in each well of a 96-well plate. To the ALT substrate, 10 μl of serum, obtained at necropsy and stored at –80°C until use, was added at timed intervals. Following the same time interval, and after incubation at 37°C for 30 min, 50 μl of color reagent was added to each well. After another incubation at 37°C for 10 min, 200 μl of ALT color developer was added and mixed, after which the samples were incubated at 37°C for an additional 5 min. The plate was read on a SpectraMax Plus384 spectrophotometer (Molecular Devices, Sunnyvale, CA) at 505 nm. Normal and abnormal control sera with known ALT concentrations were used as positive controls.

2.7. Blood parameters

Blood samples (approximately 1 ml) were taken at necropsy and parameters, including packed cell volume (PCV) and white blood cell (WBCC) count, were recorded for each day after virus challenge. Whole blood was loaded into a capillary tube, plugged at one end, and spun for 5 minutes on a capillary centrifuge and the PCV was measured. For WBCC, 10 μl of whole blood was added to 190 μl working solution (0.2% crystal violet, 0.4% glacial acetic acid) for 5 min and then counted on a hemocytometer.

2.8. Experimental design for titration of YFV in Syrian golden hamsters

Stock YFV was serial diluted 10-fold from undilute to a 10−5 dilution in minimal essential media. Each dilution was injected i.p. into a group of 5 animals and mortality was recorded through 21 dpi. Daily weight change was also measured in individually marked animals. This experiment was repeated with 10 animals per experimental group, and the resulting data were combined with the results from the first titration experiment.

2.9. Experimental design for characterization of YFV infection in Syrian golden hamsters

Hamsters were challenged i.p. with a 10−4 dilution of stock YFV. On each day for 8 days after virus challenge, liver, kidney, spleen, and serum samples were obtained from 15 animals. These tissues were analyzed for various parameters, including tissue virus titers, serum ions and proteins as measured by the VetScan instrument, PCV, and WBCC.

2.10. Experimental design for treatment of YFV

Hamsters, challenged i.p. with a 10−4 dilution of stock YFV, were treated i.p. with various dilutions (0.5, 1.6, or 5 μg/kg/d) of IFN alfacon-1 or (5 or 50 mg/kg/d) ribavirin starting 4 h prior to virus challenge and continued through 6 dpi. IFN alfacon-1 treatment was given once daily, while ribavirin treatment was administered twice daily, 12 hours apart. Serum samples were analyzed for ALT levels 6 dpi, which was the time that ALT reaches peak values. Weight change was measured on 3 and 6 dpi, which time-points allow for the maximum statistical difference in weight change to be observed in YFV-infected hamsters, and is prior to highest death rates in infected animals.

In a second study, viramidine (100 mg/kg/d) was administered i.p. twice-daily from 4 h prior to virus challenge to 6 dpi, and serum samples were taken as above for ALT measurement and mortality was observed through 21 dpi. Weight change was also measured between 3 and 6 dpi. In a third experiment, treatment with IFN alfacon-1 or ribavirin was initiated 2 dpi, and animals were treated following the same dosing schedule as above from 2–8 dpi to see if treatment initiated later in the infection would be effective in increasing survival, reducing weight loss, and reducing serum ALT levels. Mortality was observed up to 21 dpi and mean day to death was calculated.

2.11. Statistical analysis

The t-test was used to determine statistical differences in all VetScan assay results and serum ALT levels between test groups and placebo-treated controls. Wilcoxon and log-rank tests were used for analysis of survival data.

3. Results

3.1. Titration of YFV in hamsters

Groups of hamsters were inoculated with serial dilutions of virus stock. Mortality occurred in varying degrees in all virus challenge groups, but mortality and mean day to death (MDD) did not correlate with virus challenge (Table 1). Significant weight loss was also observed in animals infected with undiluted stock YFV and weight change correlated with the dilution of YFV stock that groups were challenged with. There was weight gain in the group challenged with a 10−5 dilution of stock virus, but weight loss was observed in all other virus dilution groups, with greatest weight loss in undiluted virus stock (Table 1). A highly significant difference in survival and a significant difference in weight gain between 3 and 6 dpi was observed in the groups of hamsters challenged with a 10−4 dilution (102 CCID50/0.1 ml) as compared with sham-infected animals. Because of the significant differences in these parameters with the 10−4 dilution, this virus challenge was used in all subsequent experiments.

Table 1
Survival, mean day to death, and mean weight change of Syrian golden hamsters challenged with various serial dilutions of Jimenez hamster-adapted yellow fever virusa

3.2. Characterization of YFV infection in Syrian golden hamsters

Groups of 20 hamsters were challenged with 10−4 dilution of virus stock, and tissue samples were obtained from 15 hamsters. Of the remaining hamsters challenged with YFV and not used for sample collection, 23 of 35 (66%) animals died prior to 8 dpi. Tissue samples, including liver, kidney, spleen, and serum, were obtained each day after virus challenge, and assayed for biochemical and viral parameters. Tissue YFV titers were detected by QRT-PCR in liver, spleen, kidney, and serum and reached peak levels on approximately 4–6 dpi (Fig 1), respectively. The highest titer (4.8 log10) of virus was detected in the liver, which was not unexpected.

Figure 1
Time-course of virus titer in various organs taken from hamsters challenged with Jimenez yellow fever virus and measured by QRT-PCR.

Serum parameters were measured using VetScan Comprehensive Diagnostic Profile cartridges. Serum levels of alkaline phosphatase, ALT, bilirubin, BUN, potassium, and creatinine were significantly elevated at some point during the course of infection, while serum levels of albumin, amylase, glucose, calcium, globulin, phosphorus, sodium, and total protein were significantly reduced (Table 2). Approximately half of the animals were observed to have discolored icteric livers, which were noticed 6 dpi, and correlated with icteric serum (data not shown). WBCC (Log10) was significantly elevated 6 (7.0 ± 0.1) and 7 dpi (7.1 ± 0.2) as compared with sham-infected controls (6.8 ± 0.1) (P≤ 0.05, P≤ 0.01, respectively). Red blood cell PCV was also significantly increased 5 dpi (57% ± 3.2%) as compared with sham-infected controls (53% ± 1.9%) (P≤ 0.01).

Table 2
Time-course of various blood parameters of hamsters infected with hamster-adapted yellow fever virus

3.3. Treatment of YFV infection

In the first treatment study, animals challenged with 10−4 dilution of YFV stock were treated with IFN alfacon-1 or ribavirin from –4 h to 6 dpi. There was complete survival in animals treated with 5 μg/kg/d IFN alfacon-1, which was highly significant as compared with placebo treatment (Table 3). Treatment of hamsters with 1.6 or 0.5 mg/kg/d of IFN alfacon-1 also resulted in a significant improvement in survival, although some mortality was observed. Ribavirin treatment, at 50 mg/kg/d, also resulted in a significant improvement in survival, although 5 mg/kg/d did not improve any disease parameters. Weight loss was also markedly reduced in all IFN alfacon-1 treatment groups as well as with 50 mg/kg/d of ribavirin (Table 3). Serum ALT levels were significantly lower in IFN alfacon-1-treated and 50 mg/kg/d ribavirin-treated groups as compared to placebo. All of the serum samples obtained from 5 μg/kg/d IFN alfacon-1-treated animals were clear, while sera from 1 of 10 from 50 mg/kg/d ribavirin-treated animals, 1 of 10 from the 1.6 and 0.5 μg/kg/d IFN alfacon-1, and 4 of 10 from both 5 mg/kg/d ribavirin and placebo-treated animals were icteric, and correlated with high serum ALT values.

Table 3
Effect of i.p. treatment with interferon alfacon-1, ribavirin, and viramidine in hamsters infected with hamster-adapted yellow fever virus

An additional study was conducted using viramidine, a derivative of ribavirin, in treatment of YFV. Viramidine also significantly improved survival and reduced weight loss in animals challenged with YFV (Table 3). Treatment with viramidine also significantly reduced serum ALT levels (P≤ 0.001) to normal, pre-treatment levels (Table 3). There was also a difference in the serum from some of the mice obtained from viramidine-treated animals, which was clear, while 6 of 9 serum samples obtained from placebo-treated animals were icteric and yellow in color. Icteric serum also correlated with death and high ALT values (Table 4).

Table 4
Correlation of survival with serum alanine aminotransferase levels and serum appearance in viramidine- and placebo-treated animals

In a third study, treatment was initiated 2 dpi with IFN alfacon-1 or ribavirin. This later treatment was also effective in significantly improving survival. There was a highly significant decrease in serum ALT levels in animals treated with ribavirin and a slightly significance in serum ALT decrease in hamsters treated with IFN alfacon-1 (Table 3). There was also a significant reduction of weight loss in IFN alfacon-1-treated animals, but not in animals treated with ribavirin (Table 3).

4. Discussion

In addition to alterations of various parameters previously described in this hamster model (Tesh et al., 2001;Sbrana et al., 2006), we also identified other altered parameters. Tissue titers, as measured by QRT-PCR, peaked between 4 and 6 dpi, and were reduced 7 dpi in liver, kidney, spleen, and serum. High titers are found in the liver and spleen of YFV-infected patients, and correlate with the rapid disease progression (Bae et al., 2005; De Brito et al., 1992). Weight change also appeared to be a good indicator of drug efficacy in treatment, with treated animals generally losing less weight, or gaining weight, as compared with animals treated with placebo. Further serum parameters, i.e. alkaline phosphatase, calcium, creatinine, globulin, glucose, phosphorus, sodium, and total protein were measured and results gave an overall picture of sever liver and kidney disease. Each of these serum parameters was significantly reduced, and could potentially be used to determine the efficacy of an antiviral drug. Serum ALT was used because of availability of reagents, cost, and importance to liver disease measurement.

Titration of virus stock in hamsters revealed that hamsters were susceptible to a 10-4 dilution of virus stock, which correlated with 102 CCID50. It was interesting that lower mortality was observed with higher virus challenge doses, and infection seemed not to be dose dependent. This is likely due to many different factors in the process of infection in an animal model such as defective interfering particles, initial replication in lymph nodes, immune recognition, and others (Barrett et al., 1990; Vlaycheva et al., 2004; Melhop and Diamond, 2006). High variability was observed in these studies, which is a limitation of the model. Mortality rates between 50 and 80% are observed with the same inoculum and serum ALT is highly variable. To determine the number of animals needed to generate statistical significance in light of the variability observed, a statistical power analysis was performed on data from characterization experiments, which indicated that experiments using these parameters for the evaluation of antiviral compounds would need to include at least 10 animals per group (Julander, unpublished data).

Other parameters tested in this study were similar in many respects to published results (Tesh et al., 2001; Sbrana et al., 2006). Mortality in 6–8 week-old hamsters ranged from 50–80% in placebo-treated control animals, which allowed for significant differences between antiviral and placebo treatment to be observed. Serum ALT, bilirubin, BUN, potassium, albumin, and amylase had similar peaks to those published previously. Viremia followed a similar time course as previously reported data with a peak titer 4 dpi. A statistically significant elevation in WBC count was observed 6 and 7 dpi and in PCV on 5 dpi, which correlated with the elevated WBC count and PCV previously reported by Tesh and his associates in 2001.

We demonstrated that treatment with IFN alfacon-1 (0.5, 1.6, and 5 μg/kg/d) reduced mortality, weight loss, and serum ALT levels, even when treatment was initiated 2 days after virus challenge. Treatment with IFN alfacon-1 appeared to be dose responsive with higher survival and greater improvement in other disease parameters at the highest dose, but with diminished effect at lower doses of this cytokine. These results were not surprising as IFN alfacon-1 has been shown to have efficacy against different flaviviruses, as well as other groups of viruses (Gowen et al., 2005; Loutfy et al., 2003; Morrey et al., 2004a; Morrey et al., 2004b; Sjogren et al., 2005). IFN alfacon-1 treatment was effective when administered 2 dpi and further studies should be aimed at determining how late treatment may be initiated with this compound to reduce mortality and viral parameters. The relative biological potency of IFN alfacon-1 in hamsters compared to humans is approximately 40-fold less (Hu et al., 1995). Therefore an estimate of the biological potency (IFN units) given to the hamsters in this study is 125,000 U/kg/day. The FDA approved human dose of IFN alfacon-1 for the treatment of chronic Hepatitis C in humans is 9 μg or 9 MU. On average, chronic Hepatitis C patients weigh approximately 75 kg resulting in the approved dose of IFN alfacon-1 as approximately 120,000 U/kg. Thus, hamsters in this study were treated with therapeutically relevant doses of IFN alfacon-1.

Viramidine is a prodrug of ribavirin that is converted to ribavirin in liver cells after uptake and has reduced toxicity and better liver-targeting properties as compared with ribavirin treatment (Lin et al., 2003; Sidwell et al., 2005). Viramidine treatment resulted in a highly significant reduction in serum ALT (P<0.001) as compared with placebo. These and previous studies demonstrated the utility of ribavirin treatment in improving survival and reducing serum ALT (Sbrana et al., 2004). Ribavirin did not improve weight change with either treatment regimen, which may be due to slight toxic effects of this compound.

Serum ALT levels seemed to be a good indicator if treatments were successful. There appeared to be a correlation between ALT level and mortality, and animals with ALT levels 3 times greater than normal generally died. Icteric serum correlated with high ALT levels as well as fatty livers, and could serve as an indicator of which animals would potentially die of infection. Higher mortality has been observed in hepatitis C virus-infected patients with chronically elevated ALT levels as compared with patients that had no elevation (Bestard et al., 2005). A similar reduction of ALT and mortality was also seen in mice infected with murine cytomegalovirus and treated with HPMPC or gancyclovir (Bolger et al., 1999). Serum ALT levels may serve as a marker of death in YFV-infected hamsters.

With measurable and quantifiable parameters, such as serum ALT, tissue titers, mortality, and weight change, this hamster model of YFV infection will be useful for experiments evaluating antiviral compounds for efficacy against YFV. There is a need for antiviral agents that are effective in the treatment of YFV infection and this model may be instrumental in determining possible treatments that may reduce morbidity and mortality caused by YFV.

Acknowledgments

We thank Robert Tesh for kindly providing the hamster-adapted Jimenez strain of YFV. We also thank Maysun Ali, Luci Wandersee, and Issac Wong for their help in this study. Thanks to Zhi Hong of Valeant Pharmaceuticals, Inc., for providing viramadine. This work was supported by Contract NO1-AI-15435 from the Virology Branch, NIAID, NIH.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Contributor Information

Justin G. Julander, Institute for Antiviral Research, Utah State University, Logan, UT. 84322-5600. Ph (435)-797-7215, Fax (435)-797-3959, e-mail ude.usu.cc@rednalujgj.

John D. Morrey, Institute for Antiviral Research, Utah State University.

Lawrence M. Blatt, InterMune, Inc., Brisbane, CA.

Kristiina Schafer, Animal Technician, Institute for Antiviral Research, Utah State University.

Robert W. Sidwell, Institute for Antiviral Research, Utah State University.

References

  • Anon. Adverse events associated with 17D-derived yellow fever vaccination--United States, 2001–2002. MMWR Morb Mortal Wkly Rep. 2002;51:989–993. [PubMed]
  • Arroyo JI, Apperson SA, Cropp CB, Marafino BJ, Jr, Monath TP, Tesh RB, Shope RE, Garcia-Blanco MA. Effect of human gamma interferon on yellow fever virus infection. Am J Trop Med Hyg. 1988;38:647–650. [PubMed]
  • Bae HG, Drosten C, Emmerich P, Colebunders R, Hantson P, Pest S, Parent M, Schmitz H, Warnat MA, Niedrig M. Analysis of two imported cases of yellow fever infection from Ivory Coast and The Gambia to Germany and Belgium. J Clin Virol. 2005;33:274–280. [PubMed]
  • Bae HG, Nitsche A, Teichmann A, Biel SS, Niedrig M. Detection of yellow fever virus: a comparison of quantitative real-time PCR and plaque assay. J Virol Methods. 2003;110:185–191. [PubMed]
  • Barrett AD, Monath TP, Cropp CB, Adkins JA, Ledger TN, Gould EA, Schesinger JJ, Kinney RM, Trent DW. Attenuation of wild-type yellow fever virus by passage in HeLa cells. J Gen Virol. 1990;71:2301–2306. [PubMed]
  • Bestard O, Cruzado JM, Torras J, Gil-Vernet S, Seron D, Moreso F, Rama I, Grinyo JM. Long-term effect of hepatitis C virus chronic infection on patient and renal graft survival. Transplant Proc. 2005;37:3774–3777. [PubMed]
  • Bolger G, Lapeyre N, Rheaume M, Kibler P, Bousquet C, Garneau M, Cordingley M. Acute murine cytomegalovirus infection: a model for determining antiviral activity against CMV induced hepatitis. Antiviral Res. 1999;44:155–165. [PubMed]
  • De Brito T, Siqueira SA, Santos RT, Nassar ES, Coimbra TL, Alves VA. Human fatal yellow fever. Immunohistochemical detection of viral antigens in the liver, kidney and heart. Pathol Res Pract. 1992;188:177–181. [PubMed]
  • Gowen BB, Barnard DL, Smee DF, Wong MH, Pace AM, Jung KH, Winslow SG, Bailey KW, Blatt LM, Sidwell RW. Interferon alfacon-1 protects hamsters from lethal pichinde virus infection. Antimicrob Agents Chemother. 2005;49:2378–2386. [PMC free article] [PubMed]
  • Guirakhoo F, Pugachev K, Arroyo J, Miller C, Zhang ZX, Weltzin R, Georgakopoulos K, Catalan J, Ocran S, Draper K, Monath TP. Viremia and immunogenicity in nonhuman primates of a tetravalent yellow fever-dengue chimeric vaccine: genetic reconstructions, dose adjustment, and antibody responses against wild-type dengue virus isolates. Virology. 2002;298:146–159. [PubMed]
  • Hu CJ, Ozes ON, Klein SB, Blatt LM, Taylor MW. Comparison of the in vitro host range of recombinant met-interferon-con 1, interferon-alpha 2b, and interferon-beta. J Interferon Cytokine Res. 1995;15:231–234. [PubMed]
  • Lin CC, Yeh LT, Vitarella D, Hong Z. Viramidine, a prodrug of ribavirin, shows better liver-targeting properties and safety profiles than ribavirin in animals. Antivir Chem Chemother. 2003;14:145–152. [PubMed]
  • Lourenco-de-Oliveira R, Vazeille M, de Filippis AM, Failloux AB. Aedes aegypti in Brazil: genetically differentiated populations with high susceptibility to dengue and yellow fever viruses. Trans R Soc Trop Med Hyg. 2004;98:43–54. [PubMed]
  • Loutfy MR, Blatt LM, Siminovitch KA, Ward S, Wolff B, Lho H, Pham DH, Deif H, LaMere EA, Chang M, Kain KC, Farcas GA, Ferguson P, Latchford M, Levy G, Dennis JW, Lai EK, Fish EN. Interferon alfacon-1 plus corticosteroids in severe acute respiratory syndrome: a preliminary study. JAMA. 2003;290:3222–3228. [PubMed]
  • Martin M, Tsai TF, Cropp B, Chang GJ, Holmes DA, Tseng J, Shieh W, Zaki SR, Al-Sanouri I, Cutrona AF, Ray G, Weld LH, Cetron MS. Fever and multisystem organ failure associated with 17D-204 yellow fever vaccination: a report of four cases. Lancet. 2001;358:98–104. [PubMed]
  • McFarland JM, Baddour LM, Nelson JE, Elkins SK, Craven RB, Cropp BC, Chang GJ, Grindstaff AD, Craig AS, Smith RJ. Imported yellow fever in a United States citizen. Clin Infect Dis. 1997;25:1143–1147. [PubMed]
  • Melhop E, Diamond MS. Protective immune responses against West Nile virus are primed by distinct complement activation pathways. J Exp Med. 2006;203:1371–1381. [PMC free article] [PubMed]
  • Monath TP, Arroyo J, Levenbook I, Zhang ZX, Catalan J, Draper K, Guirakhoo F. Single mutation in the flavivirus envelope protein hinge region increases neurovirulence for mice and monkeys but decreases viscerotropism for monkeys: relevance to development and safety testing of live, attenuated vaccines. J Virol. 2002;76:1932–1943. [PMC free article] [PubMed]
  • Monath TP, Barrett AD. Pathogenesis and pathophysiology of yellow fever. Adv Virus Res. 2003;60:343–395. [PubMed]
  • Morrey JD, Day CW, Julander JG, Blatt LM, Smee DF, Sidwell RW. Effect of interferon-alpha and interferon-inducers on West Nile virus in mouse and hamster animal models. Antiviral Chem and Chemother. 2004a;15:67–75. [PubMed]
  • Morrey JD, Day CW, Julander JG, Olsen AL, Sidwell RW, Cheney CD, Blatt LM. Modeling hamsters for evaluating West Nile virus therapies. Antiviral Res. 2004b;63:41–50. [PubMed]
  • Sbrana E, Xiao SY, Guzman H, Ye M, Travassos da Rosa AP, Tesh RB. Efficacy of post-exposure treatment of yellow fever with ribavirin in a hamster model of the disease. Am J Trop Med Hyg. 2004;71:306–312. [PubMed]
  • Sbrana E, Xiao SY, Popov VL, Newman PC, Tesh RB. Experimental yellow fever virus infection in the Golden hamster (Mesocictus auratus) III. Clinical laboratory values. Am J Trop Med Hyg. 2006;74:1084–1089. [PubMed]
  • Sidwell RW, Bailey KW, Wong MH, Barnard DL, Smee DF. In vitro and in vivo influenza virus-inhibitory effects of viramidine. Antiviral Res. 2005;68:10–17. [PubMed]
  • Sjogren MH, Sjogren R, Holtzmuller K, Winston B, Butterfield B, Drake S, Watts A, Howard R, Smith M. Interferon alfacon-1 and ribavirin versus interferon alpha-2b and ribavirin in the treatment of chronic hepatitis C. Dig Dis Sci. 2005;50:727–732. [PubMed]
  • Tesh RB, Guzman H, da Rosa AP, Vasconcelos PF, Dias LB, Bunnell JE, Zhang H, Xiao SY. Experimental yellow fever virus infection in the Golden Hamster (Mesocricetus auratus). I. Virologic, biochemical, and immunologic studies. J Infect Dis. 2001;183:1431–1436. [PubMed]
  • Tomori O. Yellow fever: the recurring plague. Crit Rev Clin Lab Sci. 2004;41:391–427. [PubMed]
  • Vasconcelos PF, Luna EJ, Galler R, Silva LJ, Coimbra TL, Barros VL, Monath TP, Rodigues SG, Laval C, Costa ZG, Vilela MF, Santos CL, Papaiordanou PM, Alves VA, Andrade LD, Sato HK, Rosa ES, Froguas GB, Lacava E, Almeida LM, Cruz AC, Rocco IM, Santos RT, Oliva OF. Serious adverse events associated with yellow fever 17DD vaccine in Brazil: a report of two cases. Lancet. 2001;358:91–97. [PubMed]
  • Vasconcelos PF, Sperb AF, Monteiro HA, Torres MA, Sousa MR, Vasconcelos HB, Mardini LB, Rodrigues SG. Isolations of yellow fever virus from Haemagogus leucocelaenus in Rio Grande do Sul State, Brazil. Trans R Soc Trop Med Hyg. 2003;97:60–62. [PubMed]
  • Vlaycheva L, Nickells M, Droll DA, Chambers TJ. Yellow fever 17D virus: pseudo-revertant suppression of defective virus penetration and spread by mutations in domains II and III of the E protein. Virology. 2004;15:41–49. [PubMed]
  • Xiao SY, Zhang H, Guzman H, Tesh RB. Experimental yellow fever virus infection in the Golden hamster (Mesocricetus auratus). II. Pathology J Infect Dis. 2001;183:1437–1444. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links