• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of clinexpimmunolLink to Publisher's site
Clin Exp Immunol. Jan 2006; 143(1): 180–192.
PMCID: PMC1809553

Cytokine profile during latent and slowly progressive primary tuberculosis: a possible role for interleukin-15 in mediating clinical disease

Abstract

Recently, mouse models for latent (LTB) and slowly progressive primary tuberculosis (SPTB) have been established. However, cytokine profiles during the two models are not well established. Using quantitative reverse transcription-polymerase chain reaction (qRT-PCR) we studied the expression levels of interleukin (IL)-2, IL-4, IL-10, IL-12, IL-15, interferon (IFN)-γ and tumour necrosis factor (TNF)-α during the course of LTB and SPTB in the lungs and spleens of B6D2F1Bom mice infected with the H37Rv strain of Mycobacterium tuberculosis (Mtb). The results show that, except for IL-4, cytokine expression levels were significantly higher during SPTB than LTB in both the lungs and spleens. During LTB, all the cytokines (except IL-2 in the lungs) had higher expression levels during the initial period of infection both in the lungs and spleens. During SPTB, the expression levels of IL-15 increased significantly from phases 1 to 3 in the lungs. The expression levels of IL-10, IL-12 and IFN-γ increased significantly from 2 to 3 in the lungs. IL-10 and IL-15 increased significantly from phases 2 to 3, whereas that of TNF-α decreased significantly and progressively from phases 1 to 3 in the spleens. Over-expression of proinflammatory cytokines during active disease has been well documented, but factor(s) underlying such over-expression is not known. In the present study, there was a progressive and significant increase in the expression levels of IL-15, together with Th1 cytokines (IL-12 and IFN-γ) during SPTB but a significant decrease during LTB. IL-15 is known to up-regulate the production of proinflammatory cytokines, IL-1β, IL-8, IL-12, IL-17, IFN-γ and TNF-α and has an inhibitory effect on activation-induced cell death. IL-15 is known to be involved in many proinflammatory disease states such as rheumatoid arthritis, sarcoidosis, inflammatory bowel diseases, autoimmune diabetes, etc. Our results, together with the above observations, suggest that IL-15 may play an important role in mediating active disease during Mtb infection.

Keywords: cytokine, latent, progressive, Mycobacterium tuberculosis, RT-PCR

Introduction

An estimated one-third of the world population is believed to be infected with Mycobacterium tuberculosis (Mtb) globally. However, only 5–10% of immunocompetent humans develop clinical disease during Mtb infection [1]. Cytokine-mediated immune responses to Mtb infection are important determinants for development of clinical disease/latent infection. It is generally accepted that Th1 cells through production of interferon (IFN)-γ play a protective role during Mtb infection, whereas Th2 cytokines induce the development of clinical disease through the production of cytokines such as interleukin (IL)-10 and transforming growth factor (TGF)-β. According to the Th1/Th2 paradigm, failure to resolve infection in susceptible individuals is a consequence of the generation of an inadequate level of Th1-mediated immunity, resulting from the down-regulation of Th1 immunity by Th2 response [2]. On the other hand, it has been shown that Th1 cytokines such as IFN-γ and IL-12 are highly expressed during tuberculosis [3]. Recent studies also show that gene-deleted mice incapable of generating a Th2-response are not more resistant than wild-type mice in controlling Mtb infection [4]. Therefore, immunological parameters that lead to development of latent infection or clinical disease during Mtb infection remain unknown. To date, there are a number of newly described cytokines, including IL-15 whose role during Mtb is unknown.

IL-15 is a pleiotropic proinflammatory cytokine which is expressed in several inflammatory disorders. It is a 14-kDa glycoprotein which was first described in 1994 as a T cell-activating factor, with structural similarities to IL-2 [5,6]. IL-15 receptor (IL-15R) is composed of three subunits: α, β and γ. The β and γ subunits of the IL-R are shared with IL-2 but the α-chain is unique to IL-15 [57].

IL-15 mRNA is expressed in a wide variety of tissues and cells but its protein is produced mainly by monocytes and macrophages [5,810]. IL-15Rα mRNA has been observed to have a wide cellular distribution, such as in T cells, macrophages, thymic cells, skeletal muscles, lung and liver [6]. This widespread distribution of the IL-15R system suggests that IL-15 mediates pleiotropic effects on multiple cell types, including cells of non-lymphoid origin [8]. IL-15 induces T cell proliferation and cytokine production, stimulates locomotion and chemotaxis of normal T cells [5,7,11,12] and protects them from apoptosis [13].

Elevated concentrations of IL-15 have been associated with several autoimmune and inflammatory diseases. Increased levels of IL-15 have been detected in the synovial fluids and in the synovium of rheumatoid arthritis patients [14,15]. IL-15 is also highly expressed in inflammatory pulmonary diseases, including tuberculosis, sarcoidosis and chronic bronchitis [16]. IL-15 is also highly expressed in leprosy skin lesions [16].

Recently, animal models for latent tuberculosis (LTB) and slowly progressive primary tuberculosis (SPTB) have been developed and the results show that the two disease models closely mimic human LTB and SPTB [17,18]. However, cytokine profiles, in particular those of IL-15 during LTB and SPTB, have not been well documented.

In the present study, we investigated the expression patterns of IL-2, IL-4, IL-10, IL-12, IL-15, IFN-γ and TNF-α during the course of LTB and SPTB. We show the possible role of IL-15 in mediating active disease during Mtb infection by up-regulating the production of proinflammatory cytokines.

Materials and methods

Ethical clearance

The experiments were performed with the permission of the Norwegian Experimental Animal Board, and Norwegian law corresponds with the European Commission on the Protection of Experimental Animals.

Mice

B6D2F1Bom (C57BL/6JBomxDBA/2JBom) mice were purchased from Bomholtgård Breeding and Research Centre Ltd, Denmark. This centre follows the FELASA (Federation of European Laboratory Animal Science Association) recommendations for health control of laboratory animals. The animals were acclimatized for 15 days before being included in the experiments. All mice were aged 17 weeks when they were used in experiments. The average lifespan of these mice is 975 days [19]. Animals were given standard mouse diet (RMI, SDS, Witham, UK) and water ad libitum. They were kept in MAKIII macorolon cages. The cages were kept in negative pressure plastic film isolators (Plastic Film Industries, Milton Keynes, UK). The isolators were supplied with temperature (22 ± 1°C) and humidity (50% ± 10% relative humidity (RH)) controlled air. The room lighting was set at 14/10 light/dark.

Mycobacteria

All experiments were conducted with the H37Rv strain of Mtb. The mycobacteria were first cultured on Lowenstein–Jensen media for 10 weeks.

Preparation of inocula

Stock inocula were prepared by subculturing colonies in Middlebrook 7H9 liqiud supplemented by Middlebrook ADC (Difco Laboratories, Detroit, MI, USA) (10: 1) and 0·05% Tween-80. The stock culture was incubated at 37°C for 10 days and shaken briefly on alternate days. Small aliquots of the stock bacillary suspension were maintained at −70°C. The desired number of bacilli for inoculation was prepared from the stock suspension after diluting with phosphate buffered saline (PBS). The bacillary suspension for inoculation was sonicated for 5 s in a water bath sonicator (General-probeR, HF-frequency-35KHz, Type-T460/H, Hanover, Germany) before use.

Assessment of viability of stock culture by colony forming units (CFU)

The stock culture was sonicated for 30 s in the bath sonicator. It was then serially diluted 10-fold with medium and plated onto Middlebrook 7H10. This medium was prepared by mixing agar base Middlebrook 7H10 (Difco) with Middlebrook OADC (Gibco, Life Technologies Ltd, Scotland, UK). The inoculated plates were incubated at 37°C in a CO2 (5%) incubator. CFU were counted twice weekly after the appearance of pinpoint size colonies.

Experimental design, routes and doses of infection

First, two separate experiments were performed to know which route and dose were suitable for establishing latent and chronic infection [17,18]. To establish LTB and SPTB, the mice were infected intraperitoneally by injecting 104 and 1·5 × 106 CFU, respectively, in 0·2 ml PBS. Twelve uninfected mice served as controls for growth and age and were kept in a separate isolator. Eight uninfected mice were housed with the infected groups as sentinel controls to check the transmission of infection and environmental conditions in the cages. No cross-infection was observed.

Isolation of total RNA and cDNA synthesis

Groups of three mice were sacrificed at each time-point under sterile conditions to collect lungs and spleens. The harvested organs were immediately weighed and partitioned. One part was immediately homogenized in TRIzolTM (Life Technologies, Gaithersburg, MD, USA) using Hybaid Ribolyser and silica matrix (Hybaid Co. Ltd, Teddington, UK). The remaining part was immediately frozen in liquid nitrogen for subsequent use. Total RNA was isolated according the TRIzol procedure supplied by the manufacturer. The amount of total RNA isolated was measured by genequant spectrophotometer (Pharmacia Biochemicals, La Jolla, CA, USA) and samples were run on agarose gels to monitor RNA integrity. To generate cDNA, 4 µg of total RNA was reverse-transcribed using 1·5 µM 18-mer oligo dT primer and 200 U M-MLV reverse transcriptase (Promega Corp. Madison, WI, USA) at 42°C for 60 min in the presence of 1 U/µl RNasin (Promega Corp. Madison, WI, USA) and one reaction buffer [50 mM Tris HCl (pH 8·3), 3 mM MgCl2, 75 mM KCl, 10 mm DTT] in a 30 µl reaction volume. Reactions were terminated and the enzyme inactivated by brief heating at 90°C for 3–5 min in a water bath. Reactions were then diluted to 100 µl for ease and accuracy in pipetting and stored at −20°C until use. cDNA synthesis was always monitored by performing reverse transcription-polymerase chain reaction (RT-PCR0 on the housekeeping gene hypoxanthine-phospho-ribosyl-transferase (HPRT) and running the products on 2% agarose gels.

Design and sequence of primers and probes used

All probes and primers were designed by the Primer Express Software (Perkin Elmer/Applied Biosystems, Foster City, CA, USA). The probe was synthesized with FAM as reporter dye and Tamra as the quencher dye. The forward primer (FP), reverse primer (RP) and Taqman probe (TP) sequences, all in 3′→5′orientation, were the following:

  • IL-2: forward primer CCTGAGCAGGATGGAGAATTACA, reverse primer TCCAGAACATGCCGCAGAG, Taqman-probe CCCAAGCAGGCCACAGAATTGAAAG.
  • IL-4: forward primer ACAGGAGAAGGGACGCCAT, reverse primer GAAGCCCTACAGACGAGCTCA, Taqman-probe TCCTCACAGCAACGAAGAACACCACA.
  • IL-10: forward primer GGTTGCCAAGCCTTATCGGA, reverse primer ACCTGCTCCACTGCCTTGCT, Taqman-probe TGAGGCGCTGTCATCGATTTCTCCC.
  • IL-12: forward primer GGAAGCACGGCAGCAGAATA, reverse primer AACTTGAGGGAGAAGTAGGAATGG, Taqman-probe CATCATCAAACCAGACCCGCCCAA.
  • IL-15: forward primer CATCCATCTCGTGCTACTTGT GTT, reverse primer CATCTATCCAGTTGGCCTCTGTTT, Taqman-probe AGGGAGACCTACACTGACACAGCCCAA AA.
  • IFN-γ: forward primer TCAAGTGGCATAGATGTGGAAG AA, reverse primer TGGCTCTGCAGGATTTTCATG, Taqman-probe TCACCATCCTTTTGCCAGTTCCTCCAG.
  • TNF-α forward primer CATCTTCTCAAAATTCGAGTGA CAA, reverse primer TGGGAGTAGACAAGGTACAACCC, Taqman-probe CACGTCGTAGCAAACCACCAAGTGGA.

PCR amplified cytokine DNA cloned onto a plasmid vector was used to draw standard curves for quantification of cytokines.

qRT-PCR procedure

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using the ABI-prism 7700 Sequence Detector Apparatus (Perkin Elmer/Applied Biosystems, Foster City, CA, USA) and the programs were designed on a Power Macintosh connected to the sequence detection appliance. The qRT-PCR was performed for all cytokines and the housekeeping gene HPRT for 40 cycles in a two-temperature profile: a denaturation period of 15 s at 94°C followed by a 1-min annealing/extension period at 60°C. All PCR reactions were carried out in 25 µl final volumes comprising the following components: 5 µl (200 ng) cDNA, 1× reaction buffer [50 mM Tris-HCl (pH 9·0 at 25°C), 50 mM KCl and 0·1% Triton X-100], 9 mM MgCl2, 900 nM primers and 130 nm probes. DEPC-treated sterile H2O was added to adjust the final volume to 25 µl. PCR of a cloned DNA positive control and an HPRT control were included to control for PCR set up and cDNA synthesis, respectively.

Quantification of cytokine mRNA in mice tissue

The amount of cytokines was calculated by the Sequence Detection Systems (SDS) software which use standard curves generated by serial dilutions of known amounts of cloned counterparts.

Phases of infection

SPTB was divided into three distinct phases based on lung weight, which is roughly proportional to granuloma index. Granuloma index, on the other hand, is proportional to gross pathological changes (granuloma type and size) observed in the lungs of infected mice during the course of infection [18]. During phase 1 (weeks 1–7) an increase in the bacillary number are noted in the lungs; lesions are absent or small but the mice do not show any sign of sickness. During phase 2 (weeks 8–17) granulomas increase in size and cellular composition of the granulomas mature into separate aggregates of vacuolated macrophages and lymphocytes. The bacillary numbers are stabilized in the lungs and spleens. Some mice start to show signs of disease but mortality is low. During phase 3 (weeks 21–33) the lesions increase in size and there is an increase in mortality. The lung weight increases significantly from phases 1 to 2 and from 2 to 3, in a manner proportional to the granuloma index (data not shown). No distinct phases comparable to that of SPTB were observed during LTB.

Statistical analysis

Differences in cytokine expression levels in the lungs and spleens and between LTB and SPTB were compared using the Mann–Whitney U-test. The spss computer program was used for data analysis and P-values < 0·05 were considered statistically significant.

Results

The results of cytokine expression levels (mean mRNA/0·5 µg total RNA) during LTB and SPTB are presented in Figs 14 and Tables 1 and and2.2. As indicated in the Materials and methods, SPTB was divided into distinct phases based on disease progression. Although no such distinct phases were observed during LTB, results are presented in three phases to make comparisons between the two models easier. Cytokine expression levels, except for IL-4, were higher during SPTB than LTB in both the lungs and spleens. The differences between LTB and SPTB were pronounced in the lungs than in the spleens (Tables 1 and and2)2) and ranged from twofold (IL-4) to 20-fold (IL-10) in the lungs and two-fold (IL-2) to fourfold (IL-15) in the spleens. In the lungs, the expression levels of IL-10, IL-12 and IL-15 were significantly (P < 0·0001) higher in controls than in latently infected mice. Moreover, control mice had significantly higher (P < 0·0001) expression levels of IL-12 than latently infected mice in the spleen (Tables 1 and and22).

Fig. 1
Box plots (10th, 25th, 50th, 75th and 90th percentiles) showing cytokine expression levels (mean mRNA/0·5 µg total RNA) during latent tuberculosis (LTB) in the lungs of infected mice. The expression levels of interleukin (IL)-15, interferon ...
Fig. 4
Box plots (10th, 25th, 50th, 75th and 90th percentiles) showing cytokine expression levels (mean mRNA/0·5 µg total RNA) in the spleens of mice during slowly progressive primary tuberculosis (SPTB). The expression levels of interleukin ...
Table 1
Differences in cytokine expression levels (mean total mRNA/0·5 µg total RNA) in the lungs of mice during the two disease models (***P < 0·0001). The expression levels of all cytokines increased at least by twofold [interleukin ...
Table 2
Differences in cytokine expression levels (mean total mRNA/0·5 µg total RNA) in the spleens of mice during the two disease models (***P < 0·0001). The expression levels of all cytokines [except interleukin (IL)-2 and IL-4] ...

During LTB (Figs 1 and and3),3), all the cytokines with the exception of IL-2 (in the lungs) had generally high expression levels 1–3 weeks post-infection, followed by a decline in both the lungs and the spleens. Some of the cytokines showed an intermittent increase both in the lungs and spleens; for instance, IL-2 and IL-4 (in the lungs) and TNF-α (in the spleens) had their peaks 8 weeks post-infection (data not shown).

Fig. 3
Box plots showing cytokine expression levels (mean RNA/0·5 µg total RNA) in the spleens of mice during latent tuberculosis (LTB). Similar to the lungs, cytokine expression was depressed during LTB in the spleens. Levels of interleukin ...

The expression levels of cytokines during SPTB are given in Figs 2 and and4.4. In the lungs, the expression levels of IL-15 increased significantly from phases 1 to 2 (P < 0·0001) and 2 to 3 (P = 0·01). The expression levels of IL-10, IL-12 and IFN-γ increased significantly from phase 2–3 (P = 0·003, P = 0·006, P = 0·007, respectively). However, no significant changes were observed in the expression levels of IL-2, IL-4 and TNF-α in the lungs of infected mice.

Fig. 2
Box plots showing cytokine expression levels (mean mRNA/0·5 µg total RNA) in the lungs of infected mice during slowly progressive primary tuberculosis (SPTB). The expression levels of interleukin (IL)-15 increased significantly (P < ...

In the spleens, the expression levels of IL-2 decreased significantly from phases 1 to 2 (P = 0·049); that of IL-12 decreased from phases 1 to 2 (P = 0·03) but increased again from phases 2 to 3 (P = 0·02). The expression levels of TNF-α decreased significantly from phases 1 to 3 (P = 0·01). The expression levels of IL-10 increased from phases 2 to 3 (P = 0·005) and IL-15 increased from phases 2 to 3 (P = 0·03). No significant changes were seen in the levels of IL-4 and IFN-γ.

Quantitative relationships between cytokines during LTB and SPTB in the lungs and spleens are given in Tables 36. During LTB, IL-15 was significantly positively correlated with IL-2, IL-4, IL-10 and IFN-γ (phase 1), IL-10 and IL-12 (phase 2) and IL-10 and IFN-γ (phase 3) in the lungs of infected mice. In the spleens, IL-15 was significantly positively associated with IL-10 and IL-12 (phase 1), TNF-α (phase 2) and IL-2, IL-10, IL-12 and IFN-γ (phase 3).

Table 3
Quantitative relationships between cytokines during latent tuberculosis (LTB) in the lungs of infected mice based on Spearman's rank correlation. There are no distinct phases during LTB; however, it is divided into three phases to make comparison with ...
Table 6
Quantitative relationships between cytokines during the three phases of slowly progressive primary tuberculosis (SPTB) in the spleens of infected mice, based on Spearman's rank correlation.

During SPTB, IL-2, IL-4, IL-10, IL-12 and IL-15 were significantly positively correlated with each other in the lungs of infected mice during phase 1. IL-15 had a highly significant positive correlation with IL-2, IL-4, IL-10 and IL-12 (phase 1), with IL-10 (phases 2 and 3).

In the spleens, IL-15 had a significant positive correlation with IL-10, IL-12, IFN-γ and TNF-α but a significant negative correlation with IL-4 during phase 1. During phases 2 and 3, IFN-γ had a significant positive correlation with IL-2 and IL-15. IL-10 had a significant positive correlation with IL-15 and IFN-γ but a significant negative correlation with TNF-α.

Discussion

In the present study, the expression levels of IL-15 increased significantly and progressively from phase 1–3, whereas those of IL-10, IL-12 and IFN-γ increased significantly from phases 2 to 3 in the lungs of infected mice. Increased expression of these cytokines was associated with progression of active disease, whereas decreased expression of IL-10, IL-15 and IFN-γ were associated with containment of Mtb infection, leading to LTB in the lungs of infected mice. Similarly, the expression levels of IL-10 and IL-15 was increasing during SPTB, whereas the expression levels of IL-2, IL-4, IL-12, IL-15 and IFN-γ was decreasing significantly during LTB in spleens of infected mice. Increased expression of Th1 cytokines (IL-12 and IFN-γ), together with IL-10, in the present study is not consistent with the widely held view of Th1/Th2 paradigm which explains the failure to resolve Mtb infection, leading to development of active disease as a consequence of the down-regulation of Th1 cytokines by Th2 cytokines, IL-10 and TGF-β[2,3].

Previously, several studies have implicated IL-10 with development of active disease through multiple proposed immunosuppressive mechanisms, such as inhibition of IFN-γ production [2022]; down-regulation of macrophage activation [23]; inhibition of TNF-α production [24]; and down-regulation of the expression of co-stimulatory molecules [25]. Both Th1 cytokines (IL-12 and IFN-γ) and a Th2 cytokine (IL-10) increased concurrently in the present study, indicating that IL-10 has no effect on the generation of these cytokines. Our findings are in line with a recent observation that IL-10 gene disrupted and wild-type mice generated similar and vigorous IL-12p40 and IFN-γ synthesis and displayed identical capacity to control Mtb infection, as opposed to the views of Th1/Th2 paradigm [4].

One possible explanation for this inconsistent observation is partly because little is known about some of the newly emerging cytokines, such as IL-15 during Mtb infection. In the present study, the expression of IL-15 increased progressively and significantly (10-fold in the lungs and fourfold in the spleens) during SPTB, but decreased significantly during LTB in the lungs and spleens of infected mice. IL-15 was associated more significantly with IL-10 than any other cytokine in the lungs during progressive disease (Table 5). Although it is difficult to determine the exact relationships, IL-10 has been shown to up-regulate the production of IL-15 in mouse macrophages [10]. Similarly, IL-15 has also been shown to up-regulate the production of IL-10 [24].

Table 5
Quantitative relationships between cytokines during the three phases of slowly progressive primary tuberculosis (SPTB) in the lungs of infected mice, based on Spearman's rank correlation.

IL-15 was significantly positively correlated with IL-12, IFN-γ and TNF-α during phase 1 and with IFN-γ during phase 2 in the spleen, and with IL-12 during phase 1 in the lungs. Although IL-12 and IFN-γ increased from phases 2 to 3 during disease progression lack of correlation between IL-15 and these cytokines in the lungs during the last two phases could be explained by the fact that the expression of IL-15 rose earlier (during phase 2) compared to the expression of IL-12 and IFN-γ, which increased progressively during the third phase of disease progression. Peak IL-15 expression was observed at around week 17 post-infection, followed by a continued rise until week 30 where it showed a decreasing trend. On the other hand, the expression levels of IL-12, IFN-γ and TNF-α increased after week 20 post-infection and the peak for the three cytokines was at week 33 (termination of the study). Moreover, the association between IL-12, on one hand, and IL-15, IFN-γ and TNF-α on the other hand, followed some kind of stage-specific sequence in the lungs during disease progression. IL-12 had a significant positive association with IL-15 during phase 1, with IFN-γ during phase 2 and finally with IFN-γ and TNF-α during phase 3, which suggests the pattern in which these cytokines increased during disease progression. Moreover, IFN-γ was the only cytokine that was significantly positively associated with IL-15 during phase 2 of disease progression in the spleens. Previously it has been shown that during SPTB mice remained healthy until week 16, after which infected mice started to develop pathology [18]. The above results may suggest that the increase in IL-15 expression during the second phase of disease progression may have contributed to increased expression (during phase 3) of IL-12, IFN-γ and TNF-α (not significant), cytokines believed to contribute to disease pathology, particularly in the development of granulomatous lesions [26].

Although it is difficult to determine the exact role of IL-15 during development of clinical disease from the present study, this cytokine has been shown to exhibit broad inflammatory effects on several disease states, including dermatological inflammatory diseases, inflammatory rheumatic diseases, autoimmune diabetes, inflammatory bowel diseases and pulmonary inflammation, reviewed by McInnes and Gracie [27]. As a proinflammatory cytokine, IL-15 has been shown to enhance local T cell activation and proliferation and the production of proinflammatory cytokines, such as IFN-γ and TNF-α by T cells and IL-12 by monocytes in patients with bowel disease [28]; induction of IL-1β production [29]; stimulation of IL-8 and IL-17 production, cytokines known for their promotion of neutrophilia [30,31]; up-regulation of IL-12 and IFN-γ expression in patients with TB [3] and sarcoidosis [32]. IL-15 has been shown to antagonize the biological activities of IL-2 by inhibiting activation-induced cell death and by maintaining CD4+ and CD8+ memory cells that are important in the maintenance of long-lasting specific immune responses to foreign pathogens [29].

The known proinflammatory effects of IL-15 indicated above, together with its increased expression during the progression of clinical disease in the present study, may suggest that by up-regulating proinflammatory cytokines, IL-15 could determine the course Mtb infection. Our results are supported by an earlier study by Taha et al. [3], who found increased expression of IL-12 and IFN-γ but found no significant difference between active and inactive TB in the expression of IL-2, IL-4 and TNF-α in the lungs of human patients. More specifically, IL-15 has been shown to be an important trigger for IL-17-mediated pulmonary inflammation, reviewed by McInnes and Gracie [27]. A recent study shows that IL-15 participates in pulmonary disease by attracting neutrophils, modulating cell surface expression molecules and neutrophil adhesion onto pulmonary cells, a major event leading to development of inflammation [33].

During LTB, most cytokines showed elevated expression 1–3 weeks post-infection, followed by a decline. The expression levels of IL-10, IL-12 and IL-15 (in the lungs) and IL-12 (in the spleens) were significantly lower than those of control mice (Tables 1 and and2),2), and this depressed expression was associated with development of latency. Although reasons for such a phenomenon is not clear, it could be related to tight regulation of the expression of IL-15 by complex mechanisms at the transcriptional [8,3436] and secretion levels [37].

In the present study, we observed high IL-4 expression levels between weeks 5–9 in both disease models, followed by a decline. Our results confirm (in mice) earlier reports that IL-4 is generated in the lungs of human TB patients [3740]. On the other hand, however, we observed neither an increase in IL-4 expression with disease progression nor the down-regulation of Th1 cytokines, associated with this cytokine, reported by Biedermann et al. [41].

We assume that the failure of Th1-mediated immunity to resolve Mtb infection in mice is not due to the down-regulation of Th1-mediated immunity by Th2 cytokines (IL-10) but may be due to the over-expression of these cytokines together with other proinflammatory cytokines, mediated by IL-15.

The study has one limitation, in that the intraperitoneal route of infection has been used. Although the method has been successful as evidenced from progression of disease in latently infected mice following corticosterone treatment and during SPTB, it is worth noting that it may not be the best method as aerosol is the natural route of Mtb infection.

Table 4
Quantitative relationships between cytokines during latent tuberculosis (LTB) in the spleens of infected mice based on Spearman's rank correlation. There are no distinct phases during LTB; however, it is divided into three phases to make comparison with ...

Acknowledgments

This study was initiated as part of Fiseha Abebe-Akele's PhD work, who due to unfortunate circumstances could not complete the work. He has contributed to project development, laboratory work and data entry. We are especially grateful to the staff at the Vivarium, University of Bergen for excellent technical assistance.

References

1. World Health Organization (WHO). The world health report, global tuberculosis control. Geneva: WHO; 2001. Report no. 287.
2. Power CA, Wei G, Bretscher PA. Mycobacterial dose defines the Th1/Th2 nature of the immune response independently of whether immunization is administered by intravenous, subcutaneous, or intradermal route. Infect Immun. 1998;66:5743–50. [PMC free article] [PubMed]
3. Taha RA, Kotsimbos TC, Song YL, Menzies D, Hamid Q. IFN-gamma and IL-12 are increased in active compared with inactive tuberculosis. Am J Respir Crit Care Med. 1997;155:1135–9. [PubMed]
4. Jung Y-J, Ryan L, Lacourse R, North RT. Increased interleukin-10 expression is not responsible for failure of T helper 1 immunity to resolve airborne Mycobacterium tuberculosis infection in mice. Immunol. 2003;109:295–9. [PMC free article] [PubMed]
5. Grabstein KH, Eiseman J, Shanebeck K, et al. Cloning of a T cell growth factor that interacts with the beta chain of interleukin-2 receptor. Science. 1994;264:965–8. [PubMed]
6. Giri JG, Kumaki S, Ahdieh M, et al. Identification and cloning of a novel IL-15 binding protein that is structurally related to the alpha chain of the IL-2 receptor. EMBO J. 1995;14:3654–63. [PMC free article] [PubMed]
7. Giri JG, Ahdieh M, Eisenman J, et al. Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 1994;13:2822–30. [PMC free article] [PubMed]
8. Tagaya Y, Bamford BN, DeFilippis AP, Waldmann TA. IL-15: a pleiotropic cytokine with diverse/signaling pathways whose expression is controlled at multiple levels. Immunity. 1996;4:329–36. [PubMed]
9. Carson WE, Ross ME, Baiocchi RA, et al. Endogenous production of interleukin 15 by activated human monocytes is critical for optimum production of interferon-γ by natural killer cells in vitro. J Clin Invest. 1995;96:2578–82. [PMC free article] [PubMed]
10. Doherty TM, Seder RA, Sher A. Induction and regulation of IL-15 expression in murine macrophages. J Immunol. 1996;156:735–41. [PubMed]
11. Wilkensen PC, Liew FY. Chemo-attraction of human blood T lymphocytes by interleukin 15. J Exp Med. 1995;181:1255–9. [PMC free article] [PubMed]
12. Seder RA. High-dose IL-2 and IL-15 enhance the in vitro priming of naïve CD4+ T cells for IFN-gamma but have differential effects on priming for IL-4. J Immunol. 1996;156:2413–22. [PubMed]
13. Bulfane-Paus S, Ungureanu D, Pohl T, et al. Interleukin-15 protects from lethal apoptosis in vivo. Nat Med. 1997;3:1124–8. [PubMed]
14. McInnes IB, al-Mughales J, Field M, et al. The role of interleukin-15 in T cell migration and activation in rheumatoid arthritis. Nat Med. 1996;2:175–82. [PubMed]
15. Thurkow EW, van der Heijden IM, Breedveld FC, et al. Increased expression of IL-15 in synovium of patients with rheumatoid arthritis compared with patients with Yersinia-induced arthritis and osteoarthritis. J Pathol. 1997;181:444–50. [PubMed]
16. Muro S, Taha R, Tsicpoulos A, et al. Expression of IL-15 in inflammatory pulmonary diseases. J Allergy Clin Immunol. 2001;108:970–5. [PubMed]
17. Phyu S, Mustafa T, Hofstad T, Nilsen R, Fosse R, Bjune G. A mouse model for latent tuberculosis. Scand J Infect Dis. 1999;30:59–68. [PubMed]
18. Mustafa T, Phyu S, Nilsen R, Jonsson R, Bjune G. A mouse model for slowly progressive primary tuberculosis. Scand J Immunol. 1999;50:127–36. [PubMed]
19. Smith PG, Moss AR. Epidemiology of tuberculosis. In: Bloom BR, editor. Tuberculosis: pathogenesis, protection and control. Washington, DC: ASM Press; 1994. pp. 47–59.
20. Rojas RE, Balaji KN, Subramanian A, Boom WH. Regulation of human CD4+ aβ T-cell-receptor-positive (TCR+) and γδ TCR+ T-cell responses to Mycobacterium tuberculosis by IL-10 and transforming growth factor β Infect Immun. 1999;67:6461–72. [PMC free article] [PubMed]
21. de Waal Malefyt R, Yssel H, de Vries JE. Direct effects of IL-10 on subsets of human CD4+ T cell clones and resting T cells: specific inhibition of IL-2 production and proliferation. J Immunol. 1993;150:4754–65. [PubMed]
22. Fiorentino DF, Zlotnik A, Vieira P, et al. IL-10 acts on the antigen presenting cell to inhibit cytokine production by Th1 cells. J Immunol. 1991;146:3444–51. [PubMed]
23. Moore KW, de Waal Malefyt R, Coffman L, Garra AO. Interleukin-10 and interleukin-10 receptor. Ann Rev Immunol. 2001;19:683–765. [PubMed]
24. Korholz D, Banning U, Bonig H, et al. The role of interleukin-10 (IL-10) in IL-15-mediated T cell responses. Blood. 1997;90:4513–21. [PubMed]
25. de la Barrera S, Aleman M, Musella R, et al. IL-10 down-regulates co-stimulatory molecules on Mycobacterium tuberculosis-pulsed macrophages and impairs the lytic activity of CD4 and CD8 CTL in tuberculosis patients. Clin Exp Immunol. 2004;138:128–38. [PMC free article] [PubMed]
26. Bergeron A, Bonay M, Kambouchner M, et al. Cytokine patterns in tuberculous and sarcoid granulomas: correlations with histopathologic features of the granulomatous response. J Immunol. 1997;159:3034–43. [PubMed]
27. McInnes IB, Gracie JA. Interleukin-15: a new cytokine target for the treatment of inflammatory diseases. Curr Opin Pharm. 2004;4:392–7. [PubMed]
28. Liu Z, Geboes KS, Colpaert S, et al. IL-15 is highly expressed in inflammatory bowel disease and regulates local T cell dependent cytokine production. J Immunol. 2000;164:3608–15. [PubMed]
29. Waldmann TA, Tagaya Y. Multifaceted regulation of interleukin-15 expression and the role of this cytokine in NK-cell differentiation and host response to intracellular pathogens. Ann Rev Immunol. 1999;17:19–49. [PubMed]
30. Ferratti S, Bonneau O, Dubois GR, Jones CE, Trifilieff A. IL-17 produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide-induced airway neutrophils: IL-15 a possible trigger. J Immunol. 2003;170:2106–12. [PubMed]
31. McDonald PP, Russo MP, Ferrini S, Cassatella MA. Interleukin-15 (IL-15) induces NF-kappaβ activation and IL-8 production in human neutrophils. Blood. 1998;92:4828–35. [PubMed]
32. Minshall EM, Tsicopoulos A, Yasruel Z, et al. Cytokine mRNA gene expression in active and non-active pulmonary sarcoidosis. Eur Respir J. 1997;10:2034–9. [PubMed]
33. Pelletier M, Girard D. Interleukin-15 increases neutrophil adhesion onto human respiratory epithelial A549 cells and attracts neutrophils in vivo. Clin Exp Immunol. 2005;141:315–25. [PMC free article] [PubMed]
34. Gaggero A, Azzarone B, Andrei C, et al. Differential intracellular trafficking, secretion and endosomal localization of two IL-15 isoforms. Eur J Immunol. 1999;29:1265–74. [PubMed]
35. Azimi N, Brown K, Bamford R, Tagaya Y, Siebenlist U, Waldmann TA. Human T cell lymphotropic virus type 1 Tax protein transactivates interleukin-15 gene transcription through an NF-kappaB site. Proc Natl Acad Sci USA. 1998;95:2452–7. [PMC free article] [PubMed]
36. Bamford RN, Battiata AP, Burton JD, Sharma H, Waldmann TA. Interleukin (IL) 15/IL-T production by the adult T cell leukemia cell line HuT-102 is associated with a human T cell lymphotrophic virus type region/IL-15 fusion message that lack many upstream AUGs that normally attenuates IL-15 mRNA translation. Proc Natl Acad Sci USA. 1996;93:2897–902. [PMC free article] [PubMed]
37. Seah GT, Scott GM, Rook GA. Type 2 cytokine gene activation and its relationship to extent of disease in patients with tuberculosis. J Infect Dis. 2000;181:385–9. [PubMed]
38. van Crevel R, Karyadi E, Preyers F, et al. Increased production of interleukin 4 by CD4+ and CD8+ T cells from patients with tuberculosis is related to the presence of pulmonary cavities. J Infect Dis. 2000;181:1194–7. [PubMed]
39. Marchant A, Amedei A, Azzurri A, et al. Polarization of PPD-spepcific T-cell response of patients with tuberculosis from Tho to Th1 profile after successful antimycobacterial therapy or in vitro conditioning interferon-a or interleukin-12. Am J Respir Cell Mol Biol. 2001;24:187–94. [PubMed]
40. Lienhardt C, Azzurri A, Amedei A, et al. Active tuberculosis in Africa is associated with reduced Th1 and increased Th2 in vivo. Eur J Immunol. 2002;32:1605–13. [PubMed]
41. Biedermann T, Zimmermann SH, Himmelrich A, et al. IL-4 instructs Th1 response and resistance to Leishmania major in susceptible BALB/c mice. Nat Immunol. 2001;2:1054–60. [PubMed]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...