![]() | ![]() |
Formats:
|
||||||||||||||||||||||||
Copyright © 2007 by The American Society for Cell Biology Mel-18, a Polycomb Group Protein, Regulates Cell Proliferation and Senescence via Transcriptional Repression of Bmi-1 and c-Myc Oncoproteins ![]() *Division of Cancer Biology and Department of Medicine, Evanston Northwestern Healthcare Research Institute, Evanston, IL 60201; and †Robert H. Lurie Comprehensive Cancer Center, Feinberg School of Medicine, and ‡Department of Biochemistry, Molecular Biology, and Cell Biology, Northwestern University, Evanston, IL 60201 John Cleveland, Monitoring Editor Corresponding author.Address correspondence to: Goberdhan P. Dimri ( Email: g-dimri/at/northwestern.edu) Received May 22, 2006; Revised November 14, 2006; Accepted September 27, 2006. This article has been cited by other articles in PMC.Abstract Polycomb group (PcG) protein Bmi-1 is an important regulator of cell proliferation. It regulates cellular senescence and proliferation of cells via the transcriptional repression of INK4a/ARF locus and other target genes. Here, we report that Mel-18, a PcG ring finger protein (PCGF) transcriptionally down-regulates Bmi-1. Furthermore, the expression of Bmi-1 and Mel-18 inversely correlates in proliferating and senescent human fibroblasts. Bmi-1 down-regulation by Mel-18 results in accelerated senescence and shortening of the replicative life span in normal human cells. Importantly, using promoter-reporter, chromatin immunoprecipitation, and quantitative real-time primary transcript RT-PCR assays, and an RNA interference approach, we demonstrate that Bmi-1 is a bona fide target of c-Myc oncoprotein. Finally, our data suggest that Mel-18 regulates Bmi-1 expression during senescence via down-regulation of c-Myc. These studies link c-Myc and polycomb function in cell proliferation and senescence. INTRODUCTION After a finite number of cell divisions, most normal human cells undergo cellular senescence, whereby cells cease to divide (reviewed in Campisi, 2005 ; Dimri, 2005 ). Cellular senescence constitutes a tumor suppressor mechanism (Campisi, 2005 ; Dimri, 2005 ), and bypass of senescence is required for tumorigenesis (Dimri, 2005 ). It is regulated by an array of growth regulators including polycomb group (PcG) proteins (reviewed in Itahana et al., 2004 ). PcG proteins are chromatin-modifying proteins, which play an important role in development (reviewed in Ringrose and Paro, 2004 ). Besides their role in development, these proteins also regulate cell proliferation, senescence, and tumorigenesis (reviewed in Valk-Lingbeek et al., 2004 ; Gil et al., 2005 ). In particular, EZH2 and Bmi-1 overexpression has been linked to invasive breast and prostate cancers (Varambally et al., 2002 ; Kleer et al., 2003 ; Kim et al., 2004 ; Glinsky et al., 2005 ). In addition to its role in oncogenesis, recent work from several laboratories indicates that Bmi-1 is required for self-renewal of hematopoietic stem cells (HSCs) and neural stem cells in murine models (Lessard and Sauvageau, 2003 ; Molofsky et al., 2003 ; Park et al., 2003 ; Iwama et al., 2004 ). Bmi-1 is also involved in the maintenance and proliferation of breast stem cells (Liu et al., 2006 ).The exact role of PcG proteins in tumorigenesis is still unclear. However, some of the polycomb proteins, such as Bmi-1 and EZH2, are known to regulate senescence and proliferation via well-known growth regulatory pathways (Jacobs et al., 1999 ; Bracken et al., 2003 ; Itahana et al., 2003 ). For example, Bmi-1 negatively regulates INK4a/ARF locus (Jacobs et al., 1999 ), which may impact both p16-pRb and ARF-p53-p21 pathways of cellular senescence (Dimri, 2005 ). Indeed, Bmi-1 has been shown to regulate cellular senescence in murine and human cells (Jacobs et al., 1999 ; Itahana et al., 2003 ). Bmi-1 is also thought to prevent premature senescence of neural stem cells by repressing INK4a/ARF locus (Bruggeman et al., 2005 ; Molofsky et al., 2005 ). Premature senescence of cells may contribute to organismic aging (Campisi, 2005 ). If so, the regulators of senescence are likely to play a role in aging. Indeed, down-regulation of Bmi-1 by the disruption of the SNF2-like gene PASG was shown to result in growth retardation and premature aging in a murine model (Sun et al., 2004 ).Bmi-1 is a particularly interesting oncoprotein; it not only regulates the INK4a/ARF locus, but can also immortalize human mammary epithelial cells (HMECs) (Dimri et al., 2002 ). We recently reported that Bmi-1 expression is down-regulated during cellular senescence (Itahana et al., 2003 ). Molecular pathways that regulate Bmi-1 expression during cellular senescence are unknown. Identification of such regulatory pathways is important for our understanding of the role of Bmi-1 and other PcG proteins in cell proliferation, oncogenesis, stem cell biology, and aging.In addition to Bmi-1, mammalian cells also express Mel-18 (also known as polycomb group ring finger 2 or PCGF2), a closely related PcG protein (Ishida et al., 1993 ). The Mel-18 gene product is structurally highly similar to Bmi-1. Its N-terminal region, which contains a RING finger domain, is 93% homologous to the similar region of Bmi-1 (Ishida et al., 1993 ). The homology toward the C-terminal region, which contains a nuclear localization signal (NLS) and a proline-serine–rich (PS) domain, is less conspicuous than the N-terminal region (Ishida et al., 1993 ). Bmi-1 and Mel-18 are known to interact and are thought to be the constituents of PRC1 (polycomb repressive complex 1; Alkema et al., 1997 ; Ringrose and Paro, 2004 ). However, a recent study suggests that Mel-18 may not be part of PRC1, although it could structurally but not functionally replace Bmi-1 in the PRC1 complex (Cao et al., 2005 ).It is thought that Bmi-1 and Mel-18 regulate overlapping and unique sets of genes (Kanno et al., 1995 ; Tetsu et al., 1998 , Akasaka et al., 2001 ). However, unlike Bmi-1, it has been reported that Mel-18 can bind to a well-defined nucleotide sequence 5′-GACTNGACT-3′ present in the promoter region of certain genes (Kanno et al., 1995 ). One of the unique target genes of Mel-18 is c-Myc, which is transcriptionally repressed by Mel-18 (Kanno et al., 1995 ; Tetsu et al., 1998 ). The exact role of Mel-18 in senescence, proliferation, and oncogenesis is unclear. Although its structural similarities to Bmi-1 suggest it to be an oncoprotein, a few studies have indicated that Mel-18 may in fact function as a tumor suppressor (Kanno et al., 1995 ; Tetsu et al., 1998 ) and that it might negatively regulate self-renewal of HSCs (Kajiume et al., 2004 ).Despite the high similarity between Bmi-1 and Mel-18, we found that Mel-18 overexpression leads to accelerated or premature senescence in proliferating fibroblasts and that it is overexpressed in senescent fibroblasts. We also report that Mel-18 functions as a transcriptional repressor of Bmi-1 expression in human cells. Importantly, we found that the Bmi-1 promoter region contains a functional E-box through which c-Myc and Mel-18 regulate expression of Bmi-1. Because Mel-18 down-regulates c-Myc expression and Bmi-1 is a c-Myc target, our data suggest that Mel-18 regulates expression of Bmi-1 via repression of c-Myc during cellular senescence. MATERIALS AND METHODS Cellular Reagents and Methods WI-38 and BJ fibroblasts were obtained from J. Campisi (Lawrence Berkeley National Laboratory, Berkeley, CA). The MRC-5 fibroblast strain was obtained from the NIA Aging Cell Repository (Coriell Institute for Medical Research, Camden, NJ). The fibroblasts strains were grown and serially passaged in DMEM supplemented with 10% fetal calf serum, and the onset of senescence in fibroblasts was determined using Senescence-associated beta galactosidase (SA-β-gal) assay as described (Dimri et al., 1995 ; Itahana et al., 2003 ). MCF10A and MCF7 cells were cultured as described in Dimri et al. (2002) . Stable cell lines expressing Mel-18 or other genes of interest were generated by infection of the retroviral vectors expressing the particular gene as described (Dimri et al., 2000 ). The retroviruses were produced by transient transfection of the retroviral vector together with pIK packaging plasmid into tsa 54 packaging cell line as described (Dimri et al., 2000 ).Molecular Reagents and Methods: Retroviral Expression and Short-Hairpin RNA Vectors The vector containing cDNAs of Mel-18 and c-Myc were obtained from ATCC (American Type Culture Collection, Manassas, VA). Mel-18 cDNA was amplified and cloned either in pLPC retroviral vector obtained from Dr. J. Campisi (originally from Dr. T. deLange, Rockefeller University, New York) or in pBabe-puro vector (Dimri et al., 2000 ). Bmi-1 and Mel-18 short-hairpin RNAs (shRNAs) were designed and cloned in the retroviral vector pRS (retro-super) obtained from Oligoengine (Seattle, WA). The sequences of shRNA were as follows: Mel-18 no. 1: CGACGCCACCACUAUCGUG; no. 2: AGACCAACAAAUACUGCCC; and Bmi-1 shRNA no. 1 GUUCACAAGACCAGACCAC and no. 2 GACCAGACCACUACUGAAU. A retroviral vector expressing c-Myc shRNA (clone no. SH2236-B-10) was obtained from Open Biosystems (Huntsville, AL).Promoter-Reporter Vectors and Luciferase Assays The promoter region of Bmi-1 was identified by BLAST comparison of the untranslated region of Bmi-1 cDNA with human genomic clones and analyzing the region further upstream of it. The putative promoter region was amplified using a BAC clone RP11-573G6 obtained from the Children's Hospital Oakland Research Institute, Oakland, CA. The promoter regions of different sizes were amplified by PCR and cloned in the pGL3 luciferase reporter vector (Promega, Madison, WI). The reporter assays were performed using a luciferase assay kit (Promega) as described (Dimri et al., 2002 ).Chromatin Immunoprecipitation Assays Chromatin immunoprecipitation (ChIP) assays were performed using a kit from Upstate Cell Signaling Solutions (Charlottesville, VA). Briefly, chromatin that was cross-linked to transcription factors was immunoprecipitated using antibodies against c-Myc or Mel-18 (obtained from Santa Cruz Biotechnology, Santa Cruz, CA). The immunoprecipitated chromatin was amplified using 5′ACGGGCCTGACTACACCGACACT3′ and 5′CTGAAGGCAGAGTGGAAACTGACAC3′ primers, which flank the c-Myc binding site of the Bmi-1 promoter. The primers- 5′TTCAAAGGCATCTTCTGCAG3′ and 5′CTTAACCGCCCAGATACATC3′, which amplify a non-Myc binding region of the Bmi-1 promoter were used as a negative control. Quantitative Real-Time RT-PCR Assays The real-time RT-PCR (QRT-PCR) was carried out using Brilliant SYBR Green QRT-PCR Master Mix, 2-Step kit (Stratagene, La Jolla, CA). Briefly, total RNA was isolated using TRIzol reagent as described by manufacturer (Invitrogen, Carlsbad, CA), and treated with DNase (Promega) to remove any contaminating genomic DNA. The cDNA was generated using oligo dT primer mix and 2.0 μg of DNase treated total RNA. The cDNA was PCR-amplified using primers specific for GAPDH, c-Myc, and Bmi-1. The PCR amplification was carried out using Mx 3000P QPCR system (Stratagene). The PCR conditions consisted of an initial activation of SureStart Taq DNA polymerase at 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min. The Ct (threshold cycle) value of Bmi-1 or c-Myc amplification was normalized to that of GAPDH control. The primers for QRT-PCR were as follows: GAPDH forward (F), 5′ GCTGAACGGGAAGCTCACTG 3′; GAPDH reverse (R), 5′GTGCTCAGTGTAGCCCAGGA 3′; Bmi-1 F, 5′ TGGAGAAGGAATGGTCCACTTC 3′; Bmi-1 R, 5′ GTGAGGAAACTGTGGATGAGGA 3′; and c-Myc F, 5′ TACATCCTGTCCGTCCAAGCA 3′; and c-Myc R, 5′ TCAGCCAAGGTTGTGAGGTTG 3′.Quantitative real-time PCR to detect primary transcription, referred to as PT RT-PCR (primary transcript real-time RT-PCR) was carried out as described (Murray, 2005 ). Briefly, DNase-treated RNA was reverse-transcribed using random primer mix and amplified using primers that amplify a region of ~200 base pairs of reverse-transcribed unspliced RNAs. The primers for PT RT-PCR were as follows: Bmi-1 F, 5′ CGTGTATTGTTCGTTACCTGGA3′ (present in Exon 2); Bmi-1 R, 5′ GGCAAGAAATTAAACGGCTACC3′ (present in Intron 3); c-Myc F, 5′GTCCAGAGACCTTTCTAACGTA3′ (present in Intron 2); and c-Myc R, 5′AGAAGGTGATCCAGACTCTGAC3′ (present in Exon 3).Immunological Reagents, Western Blot Analysis, and Determination of Protein Half-Life Bmi-1 was detected using either F6 mouse mAb from Upstate Cell Signaling Solutions or 1H6B10G7 mAb from Zymed (South San Francisco, CA). Mel-18 was detected by a rabbit polyclonal H-115 (Santa Cruz Biotechnology). The 9E10 mAb (Santa Cruz Biotechnology) against c-Myc was used to detect the expression of c-Myc tag in exogenously expressed proteins. p14ARF was detected using a rabbit polyclonal H-132 Ab (Santa Cruz Biotechnology). Western blot analyses to detect the expression of various proteins were performed as described (Dimri et al., 2000 ; Itahana et al., 2003 ). Protein half-life was determined using cyclohexamide (CHX) treatment to block the synthesis of new protein or by pulse-chase immunoprecipitation (IP) experiment using in vivo labeling of proteins with 35S-Express labeling mix (cat. no. NE-072, PerkinElmer Life and Analytical Sciences, Wellesley, MA) followed by chase with cold methionine/cysteine mix for different time points and IP using a specific antibody as described (Boyer et al., 1996 ).RESULTS Mel-18 Induces Premature Senescence in Normal Human Diploid Fibroblasts To understand the role of Bmi-1–related PcG proteins in cellular senescence and proliferation, we cloned the cDNA of Mel-18 into a retroviral expression vector pLPC. Using this vector, we overexpressed Mel-18 in MRC-5, a normal strain of human diploid fibroblasts (HDFs; Figure 1 ), Mel-18 overexpression led to inhibition of cellular proliferation (Figure 1 ), we also examined c-Myc expression in Mel-18–overexpressing cells. Consistent with published findings, significant down-regulation of c-Myc was noticed in Mel-18–overexpressing cells.
Interestingly, however, we found that Mel-18 overexpression leads to down-regulation of endogenous Bmi-1 and up-regulation of p16 in MRC-5 fibroblasts (Figure 1 ). Nonetheless, a modest up-regulation of p14ARF in Mel-18–overexpressing cells may still contribute to growth inhibition by p53-independent mechanisms (reviewed in Sherr et al., 2005 ).To confirm the results of overexpression studies, we further determined if knockdown of Mel-18 expression by RNA interference (RNAi) approach up-regulates Bmi-1 and extends the replicative life span. Indeed, stable overexpression of two different Mel-18 shRNAs extended the replicative life span in MRC-5 fibroblasts (Figure 1 Mel-18 Expression Is Up-regulated during Cellular Senescence in HDFs We have previously reported that Bmi-1 expression is down-regulated during cellular or replicative senescence in HDFs (Itahana et al., 2003 ). The molecular basis of Bmi-1 down-regulation during cellular senescence is not known. On the basis of our data, we surmised that Mel-18 expression might be up-regulated during senescence, which would result in down-regulation of Bmi-1 expression. Conversely, low levels of Mel-18 or absence of its expression in presenescent cells may permit high Bmi-1 expression in these cells. To address these hypotheses, we prepared total cell extract from presenescent (Presen), and senescent (Sen) cells of MRC5, BJ, and WI-38 fibroblast strains and examined Mel-18, Bmi-1, c-Myc, pRb, and p16 expression by Western blot analysis. The onset of senescence in these fibroblast strains was determined using SA-β-gal marker (Dimri et al., 1995 ). Consistent with our previous results (Itahana et al., 2003 ), Bmi-1 was down-regulated during cellular senescence (Figure 2
Our data indicate that Mel-18 expression is virtually undetectable in presenescent (Presen) cells and is up-regulated in senescent (Sen) fibroblasts (Figure 2 ). Up-regulation of Mel-18 in senescent cells could result because of the growth-arrested stage of these cells and not necessarily because of senescence. To rule out this possibility, we also examined Mel-18 expression in quiescent cells, which were growth arrested by serum starvation as described (Dimri et al., 1995 ). The results indicated that growth arrest due to quiescence does not increase Mel-18 expression, suggesting that up-regulation of Mel-18 is senescence-specific and is not due to growth arrest per se (Figure 2 ), c-Myc expression was significantly reduced in quiescent fibroblasts. Our data also suggested a correlation between c-Myc and Bmi-1 expression in growing and senescent but not in quiescent fibroblasts. Importantly, Bmi-1 expression inversely correlated with Mel-18 expression during all three growth conditions: senescence (Sen), quiescence (Q), and proliferation (Pr; Figure 2Mel-18 Regulates Bmi-1 and c-Myc Expression To further confirm that Mel-18 regulates Bmi-1 expression and to gain insight into its mechanisms, we carried out Mel-18 overexpression and Mel-18 knockdown studies in multiple cell types. Our results indicated that similar to MRC-5 fibroblasts, stable overexpression of Mel-18 results in Bmi-1 down-regulation in MCF10A and MCF7 cells (Figure 3 ), Mel-18 overexpression led to down-regulation of c-Myc in multiple cell types (Figures 1
To rule out the possibility of unknown genetic changes contributing to Bmi-1 down-regulation during selection of the stable expression of Mel-18, we also performed transient transfection assays in 293T cells. Increasing concentrations of transiently transfected Mel-18 resulted in a corresponding down-regulation of endogenous Bmi-1 and c-Myc in these cells (Figure 3 RING Finger of Mel-18 Is Required for the Down-Regulation of Bmi-1 To identify the structural domain(s) of Mel-18 required for Bmi-1 down-regulation, we generated ΔRF (lacks RING finger domain), ΔRFNLS (lacks RING finger and nuclear localization signal), and ΔPS (lacks a PS region) mutants (Figure 4
Mel-18 Transcriptionally Down-Regulates Bmi-1 Gene Expression Next, we determined the mechanism of down-regulation of Bmi-1 by Mel-18. Because Mel-18 contains a RING finger domain, and RING finger proteins can function as an E3 ubiquitin ligase and promote protein degradation via proteosome pathway (Pickart, 2001 ), we hypothesized that Mel-18 may down-regulate Bmi-1 at the protein level. To examine this possibility, we subjected Mel-18–overexpressing and control cells to treatment with proteosome inhibitor MG-132 and determined Bmi-1 protein levels by Western blot analysis. The results indicated that MG-132 treatment did not significantly increase Bmi-1 protein levels, suggesting that Mel-18 does not regulate Bmi-1 by promoting its degradation via proteosomal pathway (Figure 5
To further confirm the above result, we determined the half-life of Bmi-1 and p53 proteins in control and Mel-18–overexpressing cells using CHX treatment (Figure 5 Because Mel-18 did not appear to regulate Bmi-1 expression via protein stability, we determined whether Mel-18 could regulate the transcription of the Bmi-1 gene. To examine this possibility, we first performed a QRT-PCR to determine the mRNA levels of Bmi-1 and c-Myc in control and Mel-18–overexpressing MCF 10A and MCF7 cells. Our data indicated that Mel-18 down-regulates both Bmi-1 and c-Myc at the mRNA level (Figure 6
Mel-18 and c-Myc Regulate Bmi-1 Transcription via the c-Myc Binding Site Present in Its Promoter To examine the possibility of Mel-18 regulating Bmi-1 transcription, we analyzed 400 base pairs of 5′ untranslated region (UTR) containing the Bmi-1 promoter. The analysis of binding sites for various transcription factors was done using TFSEARCH, version 1.3 (www.cbrc.jp/research/db/TFSEARCH.html). This analysis showed that the Bmi-1 promoter is a GC-rich promoter without a well-defined TATA sequence and that it contains numerous potential SP-1 binding sites (Supplementary Figure 4). We did not find any potential binding sites (GACTNGACT) for Mel-18. However, the sequence analysis showed the presence of a perfect E-box sequence (CACGTG), which is a potential binding site for the Myc family of transcription factors (Adhikary and Eilers, 2005 ). The importance of Myc binding sites in the Bmi-1 promoter was further underscored by the fact that this site is also present in the mouse Bmi-1 promoter (data not shown).To determine if Bmi-1 is regulated by c-Myc via the E-box present in the Bmi-1 promoter, we first performed ChIP assay using vector control and Mel-18–overexpressing MCF7 and MCF10A cells. The cross-linked chromatin was immunoprecipitated (IPed) using a rabbit polyclonal Ab against c-Myc and the control rabbit IgG, and the PCR was performed using primers (c-Myc primer set) that flank c-Myc binding sites in the Bmi-1 promoter. A primer set derived from further upstream sequences that does not flank the c-Myc binding site was used as a control primer set. The results indicated that c-Myc primer set was specifically able to amplify the PCR product of an expected size (200 base pairs) from the vector control cells (Figure 7
We further cloned the E-box region (150 base pairs) of the Bmi-1 promoter in the pLuc vector (Stratagene), which contains a minimal promoter and studied c-Myc regulation of the reconstituted promoter (pLuc-Myc). The results strongly indicated that the E-box present in the Bmi-1 promoter is functional. Transient cotransfection of c-Myc increased the activity of the reconstituted promoter, whereas knockdown of c-Myc using a c-Myc shRNA resulted in inhibition of pLuc-Myc promoter activity (Supplementary Figure 5). Next, three different Bmi-1 promoter-reporter constructs based on the pGL3 vector were generated (Figure 7 Myc binding sequences (CACGTG changed to CGCGTG). The third construct pGL3-Bmi PrΔMyc contained a complete deletion of the c-Myc binding site. We determined the luciferase activity driven by wild-type or mutant promoters. The results indicated that wild-type promoter displays robust promoter activity, whereas the mutant promoters exhibited 50% less activity than the wild-type promoter (Figure 7We further studied the regulation of the Bmi-1 promoter by c-Myc and Mel-18 (Figure 8
Our promoter-reporter analysis suggested that c-Myc positively regulates the expression of Bmi-1 and that Mel-18 negatively regulates Bmi-1 expression via repression of c-Myc. To further confirm these results, we performed a real-time PT RT-PCR assay, which accurately determines the regulation of a particular gene in its native state at the level of primary transcription (Murray, 2005 ). Our data indicated that Mel-18 indeed down-regulates Bmi-1 and c-Myc at the level of primary transcription (Figure 9
Although our data indicate that Mel-18 and c-Myc regulate the expression of the Bmi-1 promoter via the E-box and Mel-18 acts via c-Myc repression, it is possible that Mel-18 directly binds to the E-box binding site and represses Bmi-1 promoter activity independent of c-Myc. To exclude this possibility, we performed ChIP assay using Mel-18 antibody. Because the E-box region is sufficient for Mel-18–mediated regulation of the Bmi-1 promoter, PCR primers in this region were chosen for the ChIP assay. Our results (Supplementary Figure 7) indicate that Mel-18 does not bind to the E-box present in the promoter region of Bmi-1; hence, Mel-18 does not directly regulate Bmi-1 expression. On the other hand, c-Myc was clearly able to bind the E-box as determined by ChIP assay (Figure 7 Bmi-1 Is a Bona Fide Target of c-Myc, and c-Myc Overexpression Rescues Mel-18–mediated Repression of Bmi-1 Expression To further confirm that the endogenous promoter of Bmi-1 is regulated by c-Myc, we studied the expression of Bmi-1 in MCF10A cells, which stably overexpress c-Myc under a retroviral promoter (Figure 10
Next, we carried out a c-Myc rescue experiment. Because Mel-18 represses c-Myc expression by binding to its native promoter, we reasoned that c-Myc overexpression using a heterologous promoter should rescue Bmi-1 repression caused by Mel-18 overexpression. To test this hypothesis, we transiently transfected pLPC-Mel-18 together with pCMV-Myc. Our results indicated that indeed c-Myc overexpression using the CMV promoter rescues Mel-18–mediated repression of endogenous Bmi-1 (Figure 10 DISCUSSION Various PcG proteins form higher order complexes such as PRC1 and PRC2 in cells (Ringrose and Paro, 2004 ). These complexes are thought to regulate expression of target genes such as members of the Hox family (Ringrose and Paro, 2004 ). When over- or underexpressed, individual polycomb proteins such as Bmi-1 can also regulate expression of specific target genes that are involved in proliferation and senescence. Virtually nothing is known about the regulation of the expression of various PcG proteins. Here, we report a novel observation that Bmi-1 is specifically regulated by another PcG protein Mel-18.Our novel observation suggests that Mel-18 is an upstream negative regulator of Bmi-1 function, which promotes proliferation, oncogenesis, and stem “cell-ness.” Consistent with such an observation, Bmi-1 knockdown by RNAi as well as its down-regulation by Mel-18 overexpression in cells resulted in accelerated senescence. As senescence constitutes a tumor suppressor mechanism and is regulated by various tumor suppressors (Dimri, 2005 ), our results clearly place Mel-18 in the tumor suppressor category. It is known that various tumor suppressors are either up-regulated (for example, p16) or the physiological activity of tumor suppressors is up-regulated during senescence (Dimri, 2005 ). For example, DNA binding activity of p53 is up-regulated, and there is a relative increase in hypophosphorylated pRb compared with hyperphosphorylated pRb during senescence (Dimri, 2005 ). Forced expression of p16, p14ARF, and other tumor suppressors has been shown to accelerate senescence in human cells (Dimri, 2005 ). Consistent with these properties of tumor suppressors, we found that Mel-18 is up-regulated during senescence in human fibroblasts, which contributes to down-regulation of c-Myc and Bmi-1 oncoproteins. Accelerated senescence in Mel-18–overexpressing fibroblasts is accompanied by down-regulation of Bmi-1, robust p16 up-regulation, and an increase in hypophosphorylated pRb.In contrast to wild-type Mel-18, RING finger mutants up-regulate Bmi-1, suggesting potential dominant negative activity (DN) of these mutants. RING finger mutants may bind to the promoter of presumptive target(s), which may be Bmi-1 itself or the other target(s) that regulate Bmi-1, and inhibit the function of nuclear Mel-18. However, if this was the case, ΔRFNLS should not have exhibited a DN activity because it lacks the nuclear localization signal. We speculate that RING finger mutants may simply up-regulate Bmi-1 by inhibiting the function of endogenous Mel-18, by binding it and sequestering it in the cytoplasm. Detailed mechanism of Bmi-1 up-regulation by RING mutants remains to be studied. Although, Mel-18 can regulate its target genes by binding to the promoter regions, the Bmi-1 promoter does not contain presumptive Mel-18 binding sequences. However, it remains possible that Mel-18 regulates Bmi-1 expression by repressing a positive regulator of Bmi-1. Indeed, we found that the Bmi-1 promoter contains an E-box to which a positive or negative regulator of Bmi-1 can bind. Identification of an E-box in the Bmi-1 promoter is very intriguing from an oncogenesis point of view. A number of E-box binding proteins are known, some of which act as repressors, whereas others act as activators of transcription. The c-Myc family of transcription factors, which bind to the E-box, are clearly implicated in oncogenesis. The c-Myc oncogene is amplified and/or overexpressed in a variety of malignancies (see Myc Cancer Gene web site: http://www.myccancergene.org). It acts as a transcription factor and regulates the expression of a number of genes (Zeller et al., 2003 ; Adhikary and Eilers, 2005 ). However, it is still unclear what the cancer-relevant bona fide targets of c-Myc are. Here, we identified Bmi-1 oncogene as an important target of c-Myc oncoprotein. Similar to our results, a very recent report has also implicated c-Myc in regulation of Bmi-1 expression and induction of telomere-independent senescence by reduced c-Myc levels and a consequent increase in p16 (Guney et al., 2006 ).c-Myc oncoprotein dimerizes with Max, which is usually in excess. Myc-Max complexes positively regulate expression of Myc target genes. Myc and Max also dimerizes with Mad1, Mxi-1, Mad3, Mad4, and Mnt (Adhikary and Eilers, 2005 ). Heterodimers of these proteins also bind to the E-box and often negatively regulate the expression of the target genes. It is very likely that Bmi-1 is negatively regulated by Max-Mad and Mnt-Max complexes. Thus, our studies suggest that c-Myc and other E-box binding proteins may positively or negatively regulate Bmi-1, which in turn regulates proliferation, senescence, oncogenesis, and stem cell-ness. Besides E-box binding proteins, other transcription factors may also regulate the expression of Bmi-1. Indeed, a recent report suggests that E2F 1 also regulates Bmi-1 expression (Nowak et al., 2006 ). Moreover, we did not find any positive correlation between Bmi-1 and c-Myc expression during quiescence, suggesting that under quiescence condition, transcription factors other than c-Myc regulate the expression of Bmi-1. Such regulators of Bmi-1 remain to be identified.Our studies suggest that Mel-18 is a physiological regulator of Bmi-1 expression in human fibroblasts and mammary epithelial cells. On the basis of our data, we suspect that this inverse correlation between Bmi-1 and Mel-18 expression may persist with other cell types and various cancers. Indeed, our preliminary data suggest a strong negative correlation between Bmi-1 and Mel-18 expression in a significant number of breast tumors. It has been suggested that Bmi-1 may be a cancer stem cell marker (Lessard and Sauvageau, 2003 ; Glinsky et al., 2005 ); it will be interesting to explore whether Mel-18 down-regulation in certain specific cell types makes them susceptible to cancer stem cell conversion.In summary, our studies suggest that the Mel-18-c-Myc-Bmi-1-p16-pRb pathway regulates cellular senescence and proliferation in human cells. Additionally, Mel-18 and Bmi-1 can also regulate p14ARF expression, which may contribute to the regulation of proliferation and senescence via p53-independent mechanisms. Although there has already been considerable interest in c-Myc, p16, p14ARF, and pRb, our data suggest that PcG protein Mel-18 and Bmi-1 are also valid targets for cancer therapy. For example, restoration of Mel-18 expression or ablation of Bmi-1 expression in tumors by various therapeutic approaches might help in cancer treatment. Lastly, because stem cell defect has been linked to various age-related pathologies (reviewed in Ho et al., 2005 ; Rosenthal, 2005 ), we speculate that Mel-18 may play an important role in the development of age-related ailments by virtue of down-regulating Bmi-1, a known regulator of stem cell-ness.ACKNOWLEDGMENTS We thank Dr. J. Campisi and Dr. M. van Lohuizen for the gift of reagents used in this study. We thank Dr. J. Campisi and the members of G.D.'s laboratory for helpful comments. We also thank Dr. C. Barry for help in performing real-time PCR analysis and Prashant Bommi for providing technical assistance. This work was supported by the grants from the National Cancer Institute (RO1CA 094150) and the US Department of Defense (DAMD17-02-1-0509) to G.D. Footnotes This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-05-0447) on December 6, 2006. ![]() The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org).REFERENCES
|
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||||
Cell. 2005 Feb 25; 120(4):513-22.
[Cell. 2005]Cancer Cell. 2005 Jun; 7(6):505-12.
[Cancer Cell. 2005]Biogerontology. 2004; 5(1):1-10.
[Biogerontology. 2004]Annu Rev Genet. 2004; 38():413-43.
[Annu Rev Genet. 2004]Cell. 2004 Aug 20; 118(4):409-18.
[Cell. 2004]Nature. 1999 Jan 14; 397(6715):164-8.
[Nature. 1999]EMBO J. 2003 Oct 15; 22(20):5323-35.
[EMBO J. 2003]Mol Cell Biol. 2003 Jan; 23(1):389-401.
[Mol Cell Biol. 2003]Cancer Cell. 2005 Jun; 7(6):505-12.
[Cancer Cell. 2005]Genes Dev. 2005 Jun 15; 19(12):1432-7.
[Genes Dev. 2005]Cancer Res. 2002 Aug 15; 62(16):4736-45.
[Cancer Res. 2002]Mol Cell Biol. 2003 Jan; 23(1):389-401.
[Mol Cell Biol. 2003]Gene. 1993 Jul 30; 129(2):249-55.
[Gene. 1993]Genes Dev. 1997 Jan 15; 11(2):226-40.
[Genes Dev. 1997]Annu Rev Genet. 2004; 38():413-43.
[Annu Rev Genet. 2004]Mol Cell. 2005 Dec 22; 20(6):845-54.
[Mol Cell. 2005]EMBO J. 1995 Nov 15; 14(22):5672-8.
[EMBO J. 1995]Immunity. 1998 Oct; 9(4):439-48.
[Immunity. 1998]Development. 2001 May; 128(9):1587-97.
[Development. 2001]Exp Hematol. 2004 Jun; 32(6):571-8.
[Exp Hematol. 2004]Proc Natl Acad Sci U S A. 1995 Sep 26; 92(20):9363-7.
[Proc Natl Acad Sci U S A. 1995]Mol Cell Biol. 2003 Jan; 23(1):389-401.
[Mol Cell Biol. 2003]Cancer Res. 2002 Aug 15; 62(16):4736-45.
[Cancer Res. 2002]Mol Cell Biol. 2000 Jan; 20(1):273-85.
[Mol Cell Biol. 2000]Mol Cell Biol. 2000 Jan; 20(1):273-85.
[Mol Cell Biol. 2000]Cancer Res. 2002 Aug 15; 62(16):4736-45.
[Cancer Res. 2002]Proc Natl Acad Sci U S A. 2005 Jun 14; 102(24):8686-91.
[Proc Natl Acad Sci U S A. 2005]Mol Cell Biol. 2000 Jan; 20(1):273-85.
[Mol Cell Biol. 2000]Mol Cell Biol. 2003 Jan; 23(1):389-401.
[Mol Cell Biol. 2003]Mol Cell Biol. 2003 Jan; 23(1):389-401.
[Mol Cell Biol. 2003]Immunity. 1998 Oct; 9(4):439-48.
[Immunity. 1998]Mol Cell Biol. 2003 Jan; 23(1):389-401.
[Mol Cell Biol. 2003]Cold Spring Harb Symp Quant Biol. 2005; 70():129-37.
[Cold Spring Harb Symp Quant Biol. 2005]Mol Cell Biol. 2003 Jan; 23(1):389-401.
[Mol Cell Biol. 2003]Proc Natl Acad Sci U S A. 1995 Sep 26; 92(20):9363-7.
[Proc Natl Acad Sci U S A. 1995]Mol Cell Biol. 2003 Jan; 23(1):389-401.
[Mol Cell Biol. 2003]Mol Cell. 2005 Dec 22; 20(6):845-54.
[Mol Cell. 2005]Oncogene. 1991 May; 6(5):797-805.
[Oncogene. 1991]Immunity. 1998 Oct; 9(4):439-48.
[Immunity. 1998]Annu Rev Biochem. 2001; 70():503-33.
[Annu Rev Biochem. 2001]Nat Rev Mol Cell Biol. 2005 Aug; 6(8):635-45.
[Nat Rev Mol Cell Biol. 2005]Proc Natl Acad Sci U S A. 2005 Jun 14; 102(24):8686-91.
[Proc Natl Acad Sci U S A. 2005]Annu Rev Genet. 2004; 38():413-43.
[Annu Rev Genet. 2004]Cancer Cell. 2005 Jun; 7(6):505-12.
[Cancer Cell. 2005]Genome Biol. 2003; 4(10):R69.
[Genome Biol. 2003]Nat Rev Mol Cell Biol. 2005 Aug; 6(8):635-45.
[Nat Rev Mol Cell Biol. 2005]Proc Natl Acad Sci U S A. 2006 Mar 7; 103(10):3645-50.
[Proc Natl Acad Sci U S A. 2006]Nat Rev Mol Cell Biol. 2005 Aug; 6(8):635-45.
[Nat Rev Mol Cell Biol. 2005]Nucleic Acids Res. 2006; 34(6):1745-54.
[Nucleic Acids Res. 2006]Nature. 2003 May 15; 423(6937):255-60.
[Nature. 2003]J Clin Invest. 2005 Jun; 115(6):1503-21.
[J Clin Invest. 2005]Proc Natl Acad Sci U S A. 1995 Sep 26; 92(20):9363-7.
[Proc Natl Acad Sci U S A. 1995]Cancer Res. 2002 Aug 15; 62(16):4736-45.
[Cancer Res. 2002]Mol Cell Biol. 2003 Jan; 23(1):389-401.
[Mol Cell Biol. 2003]