• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of immunologyLink to Publisher's site
Immunology. May 2001; 103(1): 35–40.
PMCID: PMC1783220

Polymorphism of the human α1 immunoglobulin gene 3′ enhancer hs1,2 and its relation to gene expression

Abstract

We studied the hs1,2 transcriptional enhancer identified downstream of the human α1 gene of the immunoglobulin H (IgH) locus, for which two different allelic configurations (a and b) were previously reported by Southern blotting. By using a polymerase chain reaction (PCR) method we amplified minisatellites within the hs1,2 core enhancer, with variable numbers of tandem repeats (VNTR) defining three ‘PCR alleles’ α1A, α1B and α1C (including one, two and three repeats, respectively). Five different α1 h1,2 genotypes were encountered in a population of 513 donors, representing 13·8, 34·5, 49·7, 1·3 and 0·6% for the AA, BB, AB, AC and BC genotypes, respectively. Luciferase assays showed that increasing the number of minisatellites increased the transcriptional strength of the α1 hs1,2 enhancer. Simultaneous determination of Southern blot alleles and VNTR alleles only showed a partial linkage between both types of polymorphism, altogether defining at least six different allelic forms of the 3′α1 region. In conclusion, the present study further demonstrates the genetic instability of the 3′α region, for which multiple alleles have been generated through inversions and internal deletions and/or duplications. This study also strengthens the hypothesis that the polymorphism at the IgH 3′ regulatory region of the α1 gene could play a role in the outcome of diseases involving immunoglobulin secretion.

Introduction

Several reports have suggested a role of the 3′ immunoglobulin H (IgH) region in the control of class switching and immunoglobulin production.1,2 In human, three 3′ IgH regulatory elements called hs1,2, hs3 and hs4 were identified downstream the IgH locus.36 Among them, the hs1,2 element is assumed to play an important role in the control of transcription. The hs1,2 enhancer is located 9 kb downstream of the human α1 gene and 11 kb downstream of the α2 gene.3 Downstream of α1, we identified by Southern blot a restriction fragment length polymorphism with two different alleles, α1a and α1b.5 They differed first by the orientation of the entire hs1,2 regulatory element with respect to α1 gene and second by the presence of variable numbers of tandem repeats (VNTR) within the core enhancer: the α1a allele showed one 53 bp repeat and the sequenced α1b allele carried two. So far, this polymorphism only, followed by Southern blot, has not been extensively studied nor its biological significance explored. A better knowledge of the polymorphism in this potentially important regulatory region lying downstream of the α1 gene might be of importance for diseases related to immunoglobulin production. Among them, IgA nephropathy (IgAN), characterized by IgA1 deposits in the kidney mesangium, might be of interest.7,8

The goal of this study was to improve our knowledge of the α1 h1,2 polymorphism. We thus developed a polymerase chain reaction (PCR) assay that specifically amplified the VNTR region within the α1 h1,2 core enhancer. By screening a wide number of individuals, we found three different alleles of the α1 h1,2 enhancer corresponding to the presence of one, two or three repeats. We evaluated their relationship with circulating IgA levels in healthy individuals and IgAN patients and we compared their transcriptional strength in a gene reporter assay.

Materials and methods

Blood samples

Blood samples were collected on ethylenediamine tetra-acetic acid (EDTA) vials from 426 French individuals after their informed consent and agreement of the local ethical committee. DNA was prepared from isolated leucocytes and plasma samples were recovered by centrifugation and stored at −20° until use. DNA and blood samples were also recovered from 87 patients suffering from IgAN.

PCR

DNA fragments including the VNTR region of the α1 h1,2 enhancer were amplified with consensus flanking primers (sense primer: 5′-GGGTCCTGGTCCCAAAGATGGC-3′ and antisense primer 2, 5′-TTCCCAGGGGTCCTGTGGGTCC-3′) (Fig. 1). Reactions were carried out in 30 µl of a mix made up of 8 mm dinucleosidetriphosphate (dNTP), 100 nm of each primer, 1× Taq buffer and 0·2 U Taq Polymerase (Pharmacia, Uppsala, Sweden). PCR was performed on a Robocycler Gradient 96 (Stratagene, La Jolla, CA). DNA was denatured 3 min at 94°, then submitted to 10 cycles consisting in 94°/45 s, 66°/55 s and 72°/45 s followed with another 20 cycles at 64°/105 s for the annealing step. A final elongation step was carried out at 72° for 10 min.9 The product was then analysed on a 2% agarose gel stained with ethidium bromide; 280 nm ultraviolet illumination allowed scoring the homozygote (AA and BB) and heterozygote (AB, AC, BC) patterns. DNA fragments including the VNTR region of the α2 h1,2 enhancer were amplified with the same primers in a less stringent protocol where hybridization temperatures were reduced by 2° (64° for the 10 first cycles and 62° for the last 20 cycles).

Figure 1
Map of the IgH locus showing the hs1,2 enhancer downstream the α1 genes (a) and PCR product amplification (b). (a) Orientation and numbers of tandem repeats downstream the α1 genes: α1A allele (one repeat), α1B allele (two ...

Southern blot hybridization

A panel of 221 genomic DNA samples from French individuals was assayed by Southern blotting. HindIII-restricted DNA was analysed on 0·7% agarose gels, transferred to nylon sheets (Hybond N+, Amersham Pharmacia Biotech, Amersham, UK) and hybridized with the α membrane exon probe as previously described.10

Assessment of circulating IgA levels

IgA1, IgA2 and total IgA levels were determined on plasma samples from 75 healthy controls. Among them, 24 had an AA genotype (10 men, 14 women, mean age 52 years), 27 had an AB genotype (12 men, 15 women, mean age 50 years), and 25 had a BB genotype (11 men, 14 women, mean age 52 years). Total IgA levels were also investigated in 87 IgAN patients. Among them, 11 had an AA genotype (9 men, 2 women, mean age 37 years), 40 had an AB genotype (33 men, 7 women, mean age 42 years), and 36 had a BB genotype (26 men, 10 women, mean age 42 years). IgA levels were assessed on a BNII nephelometer (Behring, Paris, France).

Luciferase assays

A vector for reporter gene assays was constructed by inserting an immunoglobulin variable heavy chain promoter (pVH) upstream of the luciferase gene (Luc) in the pGL3 vector (Promega Corporation, Madison, WI). The pVH promoter was a 0·2-kb HindIII fragment originating from a rearranged VH segment.11 PCR fragments containing either one repeat (hs1,2 α1A allele), two repeats (hs1,2 α1B allele), three repeats (hs1,2 α1C allele) or four repeats (hs1,2 α2 gene) of the 53 bp minisatellite, were cloned in pCRII-topo cloning vector in the 3′-T overhangs for direct ligation of Taq-amplified PCR products (Invitrogen, Groningen, The Netherlands). After amplification in bacteria, the PCR product was recovered with a BamHI and XhoI digestion (sites are present in the polylinker sequence flanking the PCR product insertion site). The BamHI/XhoI fragment was then inserted downstream the Luc gene in the pVH promoter-driven Luc reporter plasmid in a BamHI/SalI site (XhoI and SalI generated compatible sites with the correct orientation of the PCR product) (Fig. 2). By comparison, an enhancerless construction including only the pVH promoter-driven luciferase gene was transfected in the same conditions in order to evaluate basal transcription. Transfection efficiencies were controlled by simultaneous transfection of a control β galactosidase expression vector (pCMV β vector, Clontech, Palo Alto, CA). Plasmid DNAs were prepared using plasmid Maxi Kit (Qiagen GmbH, Hilden, Germany).

Figure 2
(a) Hybridization of HindIII-restricted human DNA from individuals with the α membrane exon probe showing either homozygocity (aa and bb) or heterozygocity (ab) for the α1 gene Southern blot alleles. Sizes are indicated in kb. (b) Schematization ...

For transient transfection assay, 5 × 105 RPMI human plasma cells were transfected with equal molar amounts (corresponding to 400 ng of pGL3-pVH construct) of each construct, using Superfect transfection reagent (Qiagen GmbH). For each assay, 400 ng of pCMV β vector were added as internal control, and for each construct six assays were performed in parallel. PGL3 control vector plasmid (Promega Corporation) was used as a luciferase positive control. After 20 hr of culture in RPMI-1640 medium (Gibco, Cergy Pontoise, France) supplemented with 10% fetal calf serum (FCS), 2 mm l-glutamine, 100 µg/ml penicillin and 10 µg/ml streptomycin, cells were recovered, lysed and assayed for luciferase activity using the Luclite Plus Assay Kit (Packard Bio-Science B.V., Groningen, The Netherlands) and for β galactosidase activity with the luminescent β galactosidase detection kit (Clontech, Palo Alto, CA) to standardize the assay. The luminescent assays were performed in 96 well Optiplates in a Lumicount microplate reader luminometer (Packard, Meriden, CT). For each assay, luciferase light units were divided by β galactosidase light units in order to normalize the cell transfection efficiency of the various constructions. Transcription effect of PCR fragments with one, two, three or four repeats were reported as fold-activation as compared to pVH effect.

DNA sequence analysis

PCR products of the α1C hs1,2 allele from 10 individuals were cloned in Topo vector (TopoTM cloning Kit, Invitrogen, Groningen, The Netherlands.) and sequenced by the dideoxynucleotide method12 on an ABI Prism 310 DNA genetic analyser (Perkin-Elmer, Foster City, CA).

Results

Polymorphism of the α1 h1,2 enhancer by PCR

As shown in Fig. 1, investigation of a wide number of individuals highlighted the presence of three different alleles in the α1 h1,2 enhancer as regard to the size of amplified core enhancer. They were called α1A, α1B and α1C. The sizes of PCR products were 462 bp, 515 bp and 568 bp for α1A, α1B and α1C, respectively. The distribution of the five α1 h1,2 genotypes was the following: 13·8% for AA (71/513), 34·5% for BB (177/513), 49·7% for AB (255/513), 1·3% for AC (7/513) and 0·6% for BC (3/513) (Table 1). Analysis of familial transmission of the A and B alleles (i.e. AA father with BB mother or AB father with AB mother) followed the genetic rules postulated by Mendel's laws (data not shown).

Table 1
Distribution of the five α1 h1,2 PCR genotypes

Polymorphism of the α1 h1,2 enhancer by Southern blot

Southern blot analysis was used in order to further document the known HindIII restriction fragment length polymorphism of the α1 gene 3′ flanking region; two alleles of either 22 kb (α1a) or 10 kb (α1b) which differed by the orientation of the entire hs1,2 regulatory element with respect to α1 gene have been previously reported.5 Accordingly the analysis of 221 DNA samples by Southern blot showed polymorphic α1 fragments and a non polymorphic 12 kb HindIII fragment corresponding to the α2 gene 3′ region (Fig. 2a). The analysis of these 221 DNA samples by PCR and Southern blot revealed that in more than 80% (181/221) of cases, alleles identified by Southern blot were linked to those defined by PCR. Thus, the α1a orientation of the enhancer carried one repeat by PCR (α1A allele) and the α1b orientation carried two repeats (α1B allele) (26 AA individuals by PCR were aa by Southern blot, 97 AB individuals by PCR were ab by Southern blot, 58 BB individuals by PCR were bb by Southern blot; Fig. 2b). By contrast, in 40 cases data were not concordant and thus defined additional alleles. The A allele (one repeat by PCR) showing an orientation similar to α1b by Southern blot was named A′. In turn, the B allele (two repeats by PCR) standing in the α1a orientation according to Southern blot was named B′. Among these 40 individuals, 2 were AA′ (AA by PCR and ab by Southern blot), 2 were B′B′ (BB by PCR and aa by Southern blot), 13 were B′B (BB by PCR and ab by Southern blot), 15 were AB′ (AB by PCR and aa by Southern blot), and 8 were A′B (AB by PCR and bb by southern blot). These different alleles are drawn on Fig. 2(b).

DNA sequence analysis of the α1C allele

In all sequences of hs1,2 variants the repeats were 52–58 bp in length and included an invariant motif of 44 bp GGGTGTCCCCGAATCTGGAGGCCTGAGCCAGCCTGGCCACGCTG, which was followed with a polymorphic end thus defining four subtypes of repeats: R1, R2, R3 and R4 (Fig. 3). As reported in Fig. 3, the presence of several potential human nuclear factor (NF)-κB-, Sp-1-, NF-1-and AP-1-like-binding sites13,14 were found in this invariant region. The α1A allele carried one repeat (R3) while the α1B allele carried two; they were checked by sequencing in three and eight individuals, respectively, and found identical to previously published sequences46 (Fig. 3). The size of the α1C PCR product was consistent with the hypothesis of an allele with three repeats; DNA sequence analysis of the α1C alleles confirmed this hypothesis but yielded two different sequences. Altogether, sequence analysis of the various α1C alleles VNTR from 10 different donors was as follows: α1C1 subtype: R1 + R2 + R3 (n = 6) and α1C2 subtype: R1 + R1 + R3 (n = 4). Finally, we have analysed sequences of repeats in the α2 h1,2 enhancer in three different DNA samples. These data confirmed the presence of four repeats and were in complete agreement with previously published sequences4,6 (Fig. 3).

Figure 3
Comparison of sequences of hs1,2 variants.[n] refers to the appropriate reference. Potential transcription factor binding sites are indicated in the invariant region (see 14 and 15). The EMBL accession numbers were ...

Circulating IgA levels

Although not statistically significant, lower levels of plasma IgA1 were found in AA healthy individuals than in individuals carrying the B allele (Table 2). Strengthening such a tendency, plasma IgA levels were significantly lower (P < 0·05, Mann–Whitney U-test) in 11 IgAN patients with the AA genotype (2·58 ± 0·41 µg/ml) than in 40 AB patients (3·30 ± 0·21 µg/ml). In contrast, the 40 AB patients did not significantly differ from 37 BB patients (2·96 ± 0·19 µg/ml).

Table 2
Relationship between circulating IgA levels and hs1,2 PCR genotypes

Luciferase assays

Transcriptional enhancer activities from the α1A, α1B and α1C alleles and the α2 gene VNTR fragment (which included four repeats4,6) were compared in a luciferase gene reporter assay. As shown in Fig. 4, their enhancer activity was linked to the number of VNTR fragments.

Figure 4
Transcriptional strength of the three PCR alleles of the α1 h1,2 enhancer and the α2 h1,2 allele in a luciferase gene reporter assay. (a) Construction: hs1,2 elements were cloned as BamHI–XhoI fragments in BamHI–SalI sites ...

Discussion

Several transcriptional enhancers map downstream of the IgH locus and, among them, hs1,2 is considered as the strongest.3 The various 3′ IgH enhancers are by themselves weak, but their combinations reveal a strong ‘coenhancer’ activity.5,15 While the functional interactions among this group of enhancers have been largely studied, the polymorphism of the individual enhancers is largely unexplored. Genetic factors obviously play a role in the occurrence and evolution of various diseases involving IgA secretion. For idiopathic IgAN, several reports have documented the influence of alleles mapping within the IgH locus.1619

In this study we amplified by PCR different allelic forms of the region encompassing the human α1 gene hs1,2 enhancer. Results indicate the presence of three alleles for the α1 gene, allele A characterized by a band of 462 bp, allele B characterized by a band of 515 bp, and allele C characterized by a band of 568 bp. The latter allele is weakly represented among healthy individuals. Sequence analysis of these alleles reveals that the α1 gene hs1,2 enhancer contains variable number of a minisatellite sequence and that allele C itself may carry two different sequences that were likely generated through independent deletion and/or duplication events. In a transcriptional reporter gene assay, the strength of the three α1 h1,2 enhancer alleles is linked to the number of minisatellite regions. Electrophoretic mobility shift experiments reveal that some nuclear factors bind the minisatellite sequence. However, at the present time, these factors remain unidentified (unpublished results).

The minisatellite region of the B allele, which contains two repeats, carries a stronger transcriptional enhancer activity than the single repeat allele A. Since the hs1,2 enhancer has been postulated to play a role in class switching,1 a tempting conclusion would be that allele B of hs1,2 increases switching towards the α1 gene. Strengthening this hypothesis serum IgA levels are increased in AB IgAN patients as compared with AA patients. Indeed, we recently showed that IgAN patients carrying the B allele had a faster evolution of their disease than AA patients.9 However, it is important to raise the possibility that in the endogenous locus, other regulatory elements (with potentially other polymorphism) could play a role (alone or in association with hs1,2). Clearly, further studies are required to clarify this point.

In conclusion, the present study highlights the existence of a more complex polymorphism than previously suggested at the IgH 3′ regulatory region of the α1 gene. Beside polymorphism in the orientation of that region, sequence polymorphism is of importance because it implicates DNA repeated sequences that carry potential transcription factor binding sites that may boost the transcription of the α1 gene. Interestingly, such minisatellites located within regulatory elements and binding transcription factors have been reported in a few other cases,20,21 and constitute one aspect through which the occurrence of such repeats help improve gene expression in the course of evolution. The role of this polymorphism in the outcome of various diseases involving immunoglobulin production will deserve to be investigated.

Acknowledgments

This work was supported by a grant from Région Limousin and Le Comité de la Corrèze de la Ligue Nationale Française Contre le Cancer.

References

1. CognÉ M, Lansford R, Bottaro A, Zhang J, Gorman J, Young F, Cheng HL, Alt FW. A class switch control region at the 3′ end of the immunoglobulin heavy chain locus. Cell. 1994;77:737–47. [PubMed]
2. Lieberson R, Ong J, Shi X, Eckhardt LA. Immunoglobulin gene transcription ceases upon deletion of a distant enhancer. EMBO J. 1995;14:6229–38. [PMC free article] [PubMed]
3. Khamlichi AA, Pinaud E, Decourt C, Chauveau C, CognÉ M. The 3′ IgH regulatory region: a complex structure in a search for a function. Adv Immunol. 2000;75:317–45. [PubMed]
4. Mills FC, Harindranath N, Mitchell M, Max EE. Enhancer complexes located downstream of both human immunoglobulin alpha genes. J Exp Med. 1997;186:845–58. [PMC free article] [PubMed]
5. Pinaud E, Aupetit C, Chauveau C, CognÉ M. Identification of a homologue of the Cα3′/hs3 enhancer and of an allelic variant of the 3′IgH/hs 1,2 enhancer downstream the human immunoglobulin α1 gene. Eur J Immunol. 1997;27:2981–5. [PubMed]
6. Chen C, Birshtein BK. Virtually identical enhancers containing a segment of homogy to murine 3′IgH-E (hs1,2) lie downstream of human Ig Cα1 and Cα2 genes. J Immunol. 1997;159:1310–8. [PubMed]
7. Galla JH. Kidney Int. 1995;47:377–7. IgAN. [PubMed]
8. D'Amico G. The commonest glomerulonephritis in the world: IgA nephropathy. Q J Med. 1987;64:709–27. [PubMed]
9. Aupetit C, Drouet M, Pinaud E, Denizot Y, Aldigier JC, Bridoux F, CognÉ M. Alleles of the α1 immunoglobulin gene 3′ enhancer control evolution of IgA nephropathy towards renal failure. Kidney Int. 2000;58:966–71. 10.1046/j.1523-1755.2000.00253.x. [PubMed]
10. CognÉ M, Preud'Homme JL. Gene deletions force nonsecretory alpha-chain disease plasma cells to produce membrane-form alpha-chain only. J Immunol. 1990;145:2455–8. [PubMed]
11. Chauveau C, Pinaud E, CognÉ M. Synergies between regulatory elements of the immunoglobulin heavy chain locus and its palindromic 3′ locus control region. Eur J Immunol. 1998;28:3048–56. 10.1002/(sici)1521-4141(199810)28:10<3048::aid-immu3048>3.0.co;2-v. [PubMed]
12. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 1977;74:5463–7. [PMC free article] [PubMed]
13. Jones KA, Kadonaga JT, Rosenfeld PJ, Kelly TJ, Tjian R. A cellular DNA-binding protein that activates eukaryotic transcription and DNA replication. Cell. 1987;48:79–89. [PubMed]
14. Hirano F, Tanaka H, Hirano Y, Hiramoto M, Handa H, Makino I, Scheidereit C. Functional interference of Sp1 and NF-κB through the same DNA binding site. Mol Cell Biol. 1998;18:1266–74. [PMC free article] [PubMed]
15. Ong J, Stevens S, Roeder RG, Eckhardt LA. 3′ IgH enhancer elements shift synergistic interactions during B cell development. J Immunol. 1998;160:4896–903. [PubMed]
16. Allen AC, Topham PS, Harper SJ, Feehally J. Leucocyte β 1,3 galactosyl–transferase activity in IgAN. Nephrol Dial Transplant. 1997;12:701–6. 10.1093/ndt/12.4.701. [PubMed]
17. Yano N, Asakura K, Endoh M, Abe Y, Nomoto Y, Sakai H, Kurokawa K, Tsukamoto H. Polymorphism in the Iα1 germ line transcript regulatory region and IgA productivity in patients with IgAN. J Immunol. 1998;160:4936–42. [PubMed]
18. Demaine AG, Rambausek M, Knight JF, William DG, Welch KJ, Ritz E. Relation of mesangial IgA glomerulonephritis to polymorphism of immunoglobulin heavy chain switch region. J Clin Invest. 1988;81:611–4. [PMC free article] [PubMed]
19. Moore RH. Immunoglobulin heavy chain switch region gene polymorphisms in glomerulonephritis. Kidney Int. 1990;38:332–6. [PubMed]
20. Kominato Y, Tsuchiya T, Hata N, Takizawa H, Yamamoto FI. Transcription of human ABO histo-blood group genes is dependent upon binding of transcription factor CBF/NF-Y to minisatellite sequence. J Biol Chem. 1997;272:25890–8. [PubMed]
21. Maeng JH, Yoon JB. The human PTFgamma/SNAP43 gene: structure, chromosomal location, and identification of a VNTR in 5′UTR. J Biochem. 1998;124:23–7. [PubMed]

Articles from Immunology are provided here courtesy of British Society for Immunology

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • MedGen
    MedGen
    Related information in MedGen
  • Nucleotide
    Nucleotide
    Published Nucleotide sequences
  • PubMed
    PubMed
    PubMed citations for these articles

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...