Logo of immunologyLink to Publisher's site
Immunology. Jun 2006; 118(2): 233–239.
PMCID: PMC1782291

Critical role of M. tuberculosis for dendritic cell maturation to induce collagen-induced arthritis in H-2b background of C57BL/6 mice

Abstract

Collagen-induced arthritis (CIA) can be induced even in CIA-resistant H-2b background of C57BL/6 mice when these mice are immunized with type II collagen (CII) emulsified in complete Freund's adjuvant (CFA) containing high, but not low, dose of Mycobacterium tuberculosis. Here, we investigated the pathogenesis of CIA in C57BL/6 mice induced by the immunizing protocol. We examined expressions of cytokines, costimulatory molecules and major histocompatibility complex (MHC) class II in draining lymph nodes (DLN) in CIA-induced C57BL/6 mice by quantitative reverse transcription–polymerase chain reaction. We also examined an effect of M. tuberculosis on the expression of these molecules on dendritic cells (DC) in vitro by flow cytometry. We finally examined an effect of M. tuberculosis in CFA used for immunization with CII antigen on priming of CD4+ helper T cells specific to CII in DLN of CIA-induced C57BL/6 mice. The expression of interferon-γ (IFN-γ), Interleukin-12p40 (IL-12p40), costimulatory molecules CD40, CD80 and CD86 and MHC class II were up-regulated in DLN of CIA-induced C57BL/6 mice. Expressions of these costimulatory molecules were also up-regulated on DC after stimulation with high, but not low, dose of M. tuberculosis in vitro. Furthermore, priming of CD4+ helper T cells specific to CII antigen in DLN required immunization with CII using CFA containing high, but not low, dose of M. tuberculosis. These results suggested that high dose of M. tuberculosis were required for maturation of DC enough to prime CD4+ helper T cells specific to CII antigen in DLN of H-2b background of C57BL/6 mice.

Keywords: collagen-induced arthritis (CIA), C57BL/6 mice, M. tuberculosis, dendritic cell, costimulatory molecules

Introduction

Rheumatoid arthritis (RA) is an autoimmune disease characterized by chronic inflammation and synovial infiltration of immune cells. Collagen-induced arthritis (CIA) is a mouse model for RA in humans.1 The histopathology of this arthritis is characterized by a proliferative synovitis that erodes the adjacent cartilage, ultimately producing articular injury and ankylosis, like the arthritis in human RA. Therefore, CIA is a useful model of human RA for analysis of pathogenesis of inflammatory joint diseases.24

CIA is purportedly restricted to mice bearing the major histocompatibility complex (MHC) class II H-2q or H-2r, but not H-2b, haplotypes.5,6 Therefore, C57BL/6 mice have been thought to be resistant to CIA because of their H-2b background. However, it should be useful if we could analyse C57BL/6 mice with CIA, because there are a number of C57BL/6 mice deficient in certain genes, which might be involved in the pathogenesis of RA. Recently, Campbell and colleague demonstrated that C57BL/6 mice could be susceptible to CIA using a particular immunization protocol with complete Freund's adjuvant (CFA) containing high dose of Mycobacterium tuberculosis.7 However, it is unclear how a high dose of M. tuberculosis in CFA leads to the induction of CIA in C57BL/6 mice.

In the present study, we investigated the pathogenesis of CIA in C57BL/6 mice and found that high, but not low, dose M. tuberculosis in CFA is required for activation and/or maturation of dendritic cells (DC) to prime type II collagen (C-II) reactive T cells in draining lymph nodes (DLN) of C57BL/6 mice.

Materials and methods

Animals and induction of CIA

C57BL/6 mice (6–10-week-old, female) were purchased from the Japan Charles River Breeding Laboratories and maintained in the animal facility under specific pathogen-free conditions at the University of Tsukuba. CIA was induced as previously described.7 In brief, complete Freund's adjuvant (CFA) was prepared by grinding 2 mg or 10 mg heat-killed M. tuberculosis (H37Ra; Difco Laboratories, Detroit, MI) in 2 ml incomplete Freund's adjuvant (IFA; Sigma Chemical Co., St. Louis, MO). An emulsion was formed by dissolving 2 mg/ml chick collagen type II (CII; Sigma Chemical Co.) overnight at 4° in 10 mm acetic acid, followed by mixture with an equal volume of CFA. Mice were injected intradermally (i.d.) at the base of tail with a total of 100 µl emulsion of 50 µl of CII (2 mg/ml) and 50 µl of IFA or CFA containing 1 or 5 mg/ml M. tuberculosis, followed by the second injection as a booster 21 days after the first injection. The day of the second immunization (booster) was designated as day 0.

Clinical assessment of CIA

The swelling of each paw was graded as follows: grade 0, no swelling; grade 1, swelling or focal redness of finger joints; grade 2, mild swelling of wrist or ankle joints; grade 3, severe swelling of the entire paw. The scores of four paws were totalled so that the maximal score per mouse was 12. Incidence of CIA was calculated by dividing the number of mice showing swelling of any paws with the number of total mice tested. Anteroposterior radiographs of the four limbs were obtained, using X-ray apparatus (muFX-1000, FUJIFILM, Tokyo) and BAS-5000 (FIJIFILM), 12 weeks after the second immunization. Paraffin sections of hind paws after decalcification with 10% ethylenediaminetetraacetic acid were stained with haematoxylin-eosin (H&E, 100×).

RNA Extraction and polymerase chain reaction (PCR) analysis

Total RNA was prepared from draining LN (DLN) cells and hind paw joints, which were removed 10 days after the second immunization. DLN cells were prepared from 10 arthritic or control non-arthritic mice that were immunized with CII in IFA. Gene expression was measured by TaqMan real-time PCR (Applied Biosystems, Foster City, CA), according to the manufacturer's protocol. Probes and primer sets for mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH), CD80, CD86, CD40, MHC II, interleukin-4 (IL-4), and IL-12p40 were purchased from Applied Biosystems, and those for interferon-γ (IFN-γ) were designed as follows; TCACCATCCTTTTGCCAGTTCCTCCAG (probe), TCAAGTGGCATAGATGTGGAAGAA (forward primer), and TGGCTCTGCAGGATTTTCATG (reverse primer). Target gene probes were labelled with 6-carboxyfluorescein (FAM) and internal reference probes and the rodent GAPDH were labelled with VIC. PCR were performed on the ABI PRISM 7700 Sequence Detection System (Applied Biosystems) using the following conditions: 2 min at 50°, 10 min at 95°, followed by two-step PCR for 40 cycles of 95° for 15 s followed by 60° for 1 min. mRNA expression of each cytokine was normalized by those of GAPDH in each sample.

Effect of M. tuberculosis on DC maturation in vitro

Splenocytes prepared from naïve C57BL/6 mice were cultured in 12-well flat-bottom plates (1 × 107/well) in the presence of 2·5 or 5·0 µg/ml or absence of M. tuberculosis for 48 hr. Cells were then incubated with anti-FcγR (BD PharMingen, San Diego, CA) to block non-specific binding of antibody, followed by simultaneous staining with fluorescein isothiocyanate (FITC)-conjugated anti-mouse CD80, CD86, CD40 or MHC II, and phycoerythrin (PE)-conjugated anti-mouse CD11c (BD PharMingen). Cells were analysed by flow cytometry.

Effect of M. tuberculosis on DC maturation in vivo

Mice were injected into the foot pads with a total of 100 µl emulsion of 50 µl of CII (2 mg/ml) and 50 µl of IFA or CFA containing 1 or 5 mg/ml M. tuberculosis. Five days after the immunization, DLN were removed and gene expressions were measured by TaqMan real-time PCR, as described above.

CII-specific T-cell proliferation and cytokine secretion

Five days after immunization at the base of tail with CII emulsified with IFA or CFA, CD4+ T cells were purified from the draining lymph node by magnetic-antibody cell sorting (MACS, Miltenyi Biotec). The purity of CD4+ T cells was more than 95%, as determined by flow cytometry. CD4+ T cells were cocultured in 96-well flat-bottom microtitre plates (1 × 105/well) in the presence (50 µg/ml) or absence of the denatured chick CII for 48 hr with splenocytes (5 × 106/well) from naïve C57BL/6 mice as antigen-presenting cells (APC), which had been treated with 50 µg/ml mitomycin C (Sigma-Aldrich) at 37° for 30 min. T-cell proliferations specific to CII were measured by enzyme-linked immunosorbent assay (ELISA) using BrdU Kit (Roche, Mannheim, Germany). IFN-γ and IL-4 levels in the culture supernatants were determined by ELISA (Ready-SET-Go; eBioscience, San Diego, CA).

Statistical analyses

Statistical analyses were performed using the Mann–Whitney U-test.

Results

Induction of CIA in mice of C57BL/6 background

To investigate whether CIA can be induced in mice of C57BL/6, we immunized C57BL/6 mice with CII emulsified in IFA or CFA containing either 1 or 5 mg/ml M. tuberculosis. We observed that neither mice immunized with CII in IFA nor those with CFA containing 1 mg/ml of M. tuberculosis developed any clinical signs of arthritis. However, immunization of CII emulsified in CFA containing 5 mg/ml of M. tuberculosis induced CIA in more than half of C57BL/6 10 days after immunization (Fig. 1a–c). The incidence of CIA and the mean clinical score reached to the maximum around 2 weeks after immunization (Fig. 1a, b). The histopathological analyses showed mononuclear cells, synovial hyperplasia, pannus formation, cartilage destruction and bone erosion (Fig. 1d). Radiological examination at 12 weeks after immunization showed bone erosion and destruction in the affected joints (Fig. 1e). These data were consistent with a previous report that CIA can be induced in mice bearing the MHC class II haplotypes of not only H-2q or H-2r, but also H-2b,7 and suggested that susceptibility to CIA may reflect immunization conditions.

Figure 1
Induction of CIA in C57BL/6 mice. C57BL/6 mice were injected i. twice at day −21 and 0 with 100 µg CII emulsified in either IFA (Tb 0 mg/ml) (◊), or CFA containing M. tuberculosis at a concentration of 1 or 5 mg/ml (□ and ...

Elevated T helper 1 (Th1) responses in draining lymphnodes and arthritis joints of CIA-induced C57BL/6 mice

It has been suggested that RA is mediated by IFN-γ-producing Th1 cells, which stimulate inflammatory responses.8,9 It is also reported that Th1 responses are predominant in DLN of CIA-induced mice of DBA/1 background at the time of onset of arthritis.10 To examine whether Th1 cells are predominant also in CIA-induced C57BL/6 mice, DLN cells were isolated from mice with CIA induced by CII in CFA containing 5 mg/ml of M. tuberculosis or control mice that were immunized with CII in IFA 10 days after the second immunization and were examined for cytokine production by quantitative reverse transcription (RT)–PCR. As demonstrated in Fig. 2(a), while IL-4 mRNA levels were not different between arthritis and control non-arthritis mice, IFN-γ mRNA levels were significantly higher in arthritis than control mice (P < 0·01). We also observed the similar results in the synovial tissues of arthritis joints of CIA-induced C57BL/6 mice (Fig. 2b). These results indicated that Th1 responses were predominant during the arthritic phase in both DLN and arthritis joints of CIA-induced C57BL/6 mice.

Figure 2
Expression of cytokines in DLN and affected joints of CIA-induced C57BL/6 mice. mRNA was extracted from DLN (a) and affected joints (b) of CIA-induced C57BL/6 mice 10 days after the second immunization and expression of cytokines indicated were analysed ...

Up-regulation of IL-12 and costimulatory molecules in DLN of CIA-induced C57BL/6 mice

Because IL-12 is essentially required for Th1 development and activation11,12 we examined whether IL-12p40 mRNA was expressed in DLN and arthritis joints of CIA-induced C57BL/6 mice by quantitative RT–PCR. As demonstrated in Fig. 2, expression of IL-12p40 mRNA in DLN of CIA-induced C57BL/6 mice was significantly higher than that of control non-arthritis mice (P < 0·01). Because IL-12 is produced from APC such as DC and macrophages, these results suggested that APC were activated in DLN of CIA-induced C57BL/6 mice. We therefore further examined whether expression of costimulatory molecules were also up-regulated on these APC. As demonstrated in Fig. 3, CD40, CD80, CD86 and MHC II were expressed in DLN of CIA-induced C57BL/6 mice significantly higher than those of control naïve mice (P < 0·05) 10 days after the second immunization, indicating that APC were activated and/or matured in DLN of CIA-induced C57BL/6 mice. Taken together, these results suggested a hypothesis that antigen presentation by mature APC differentiated naïve helper T cells into collagen-specific Th1 cells in DLN of CIA-induced C57BL/6 mice.

Figure 3
Expression of costimulatory molecules and MHC II in DLN of CIA-induced C57BL/6 mice mRNA was extracted from DLN of CIA-induced C57BL/6 mice 10 days after the second immunization and expression of costimulatory molecules indicated were analysed by quantitative ...

M. tuberculosis up-regulated costimulatory molecules expression on DC

We have shown that CIA can be induced in C57BL/6 mice when these mice are immunized with CII emulsified with CFA containing high, rather than low, dose of M. tuberculosis. However, it has not been determined how the immunization conditions induce CIA in these mice. To address this issue, we examined whether high, but not low, concentrations of M. tuberculosis could induce maturation of DC in vitro. Splenocytes from naïve C57BL/6 mice were cultured in the absence or presence of heat-killed M. tuberculosis for 48 hr and then simultaneously stained with anti-CD11c and either anti-CD80, anti-CD86 or anti-CD40. Analysis by flow cytometry demonstrated that expression of these costimulatory molecules were up-regulated on CD11c+ cells in a dose of M. tuberculosis-dependent manner(Fig. 4), suggesting that maturation of DC by high dose of M. tuberculosis may be critical for induction of CIA in C57BL/6 mice.

Figure 4
Maturation of DC induced by M. tuberculosis in vitro. Splenocytes prepared from naïve C57BL/6 mice were cultured and stimulated or not with 2·5 or 5·0 µg/ml heat-killed M. tuberculosis for 48 hr. Cells were then simultaneously ...

To further examine whether DC maturation is dependent on the dose of M. tuberculosis in vivo, mice were injected into their foot pads with CII plus IFA or CFA containing 1 or 5 mg/ml of M. tuberculosis and the mRNA expressions of costimulatory molecules and MHC II were determined in DLN (Fig. 5). Consistent with the results of in vitro studies, the mRNA levels of these molecules in DLN of mice that injected with CII plus CFA containing high does (5 mg/ml) of M. tuberculosis were significantly higher than those injected with CII plus IFA or CFA containing low does (1 mg/ml) of M. tuberculosis.

Figure 5
Maturation of DC induced by M. tuberculosis in vivo. Mice were injected into their foot pads with CII in IFA (Tb; 0 mg/ml) or CFA containing 1 or 5 mg/ml of M. tuberculosis. Five days after the immunization, total RNA was prepared from DLN cells and the ...

CII-specific Th1 responses by high, but not low, dose of M. tuberculosis

To examine whether immunization of C57BL/6 mice with CII emulsified with CFA containing high, but not low, dose of M. tuberculosis induces Th1 cells specific to CII in DLN, CD4+ T cells were sorted from DLN of immunized mice and stimulated with denatured CII for 48 hr in the presence of splenocytes that were used as APC. As shown in Fig. 6(a), CD4+ T cells from mice immunized using a high dose of M. tuberculosis significantly proliferated in response to CII. By contrast, we observed significantly less proliferation of CD4+ T cells from mice immunized using no or a low dose of M. tuberculosis. Similarly, IFN-γ production was detected in the culture of CD4+ T cells from mice immunized using a high dose of M. tuberculosis significantly more than those from mice immunized using no or a low dose of M. tuberculosis (Fig. 6b). These results suggest that high dose of M. tuberculosis is required for priming of CII-specific Th1 cells in vivo.

Figure 6
Collagen specific T cells were recruited to draining lymph nodes in Tb 5 mice. Naïve C57BL/6 mice were immunized with CII antigen emulsified in IFA or CFA containing M. tuberculosis at a final concentration of 1 or 5 mg/ml. Five days after the ...

Discussion

The majority of autoimmune diseases are associated with the expression of specific MHC class II.13,14 The susceptibility of CIA has been considered to be restricted by H-2q and H-2r haplotypes.6 However, the present study indicated that MHC class II molecule I-Ab could also present the C-II peptide antigen enough to prime antigen-specific CD4+ helper T cells and induce CIA.

In the present study, we have shown that expressions of IFN-γ, IL-12p40, costimulatory molecules CD40, CD80 and CD86 and MHC II were up-regulated in DLN of CIA-induced C57BL/6 mice by immunization with CII emulsified in CFA containing high dose of M. tuberculosis. Because Toll-like receptor 2 expressed on DC recognizes M. tuberculosis and induces up-regulation of costimulatory molecule expression15 and IL-12 secretion,16,17 immunization with CII using high, but not low, dose of M. tuberculosis might induce maturation of DC in DLN; in these DLN DC secreted IL-12 and induced differentiation of CII-specific naïve helper T cells into IFN-γ-producing Th1 cells. In fact, we have demonstrated that M. tuberculosis induced maturation of DC in vitro in a dose-dependent manner. Furthermore, we have shown that priming of CD4+ helper T cells specific to CII antigen in DLN required immunization with CII using CFA containing high, but not low, doses of M. tuberculosis in vivo. Taken together, these results suggested that high doses of M. tuberculosis were required for maturation of DC enough to prime CD4+ helper T cells specific to CII antigen in DLN of H-2b background of C57BL/6 mice.

Th1/Th2 cytokine imbalance has been implicated in the pathogenesis of CIA in mice.10,18 In the present study, we demonstrated the predominant Th1 phenotype in DLN of C57BL/6 mice with CIA. High level of IFN-γ production in response to CII has also been reported in DBA/1 mice, a susceptible strain of CIA, suggesting a critical role of Th1 responses in the pathogenesis of CIA in both DBA/1 and C57BL/6 mice.10,19 However, C57BL/6 mice deficient in IFN-γ or IFN-γ receptor genes demonstrated increased incidence and severity of CIA.20,21 A protective role of IFN-γ has been demonstrated in a number of distinct organ-specific autoimmune diseases, including EAE,22 thyroiditis23 and uveitis.24 A number of models have been proposed for the down-regulatory effects of IFN-γ in autoimmunity, including the induction of inducible nitric oxide (NO) synthetase,25 which leads to an increase in NO-mediated apoptosis of activated T cells.26 Together, these studies suggested that IFN-γ may have dual roles in pathogenesis of CIA.

Th1 cells are differentiated from CD4+ naïve T cells, in which IL-12 plays a critical role.27 In the present study, we observed that the expression of IL-12p40 mRNA in DLN and joint tissues of CIA-induced C57BL/6 mice was significantly higher than that of control mice. Consistent with our results, a previous report showed that in vivo injection of IL-12 into mice accelerated incidence and severity of CIA.28 Moreover, mice deficient in the IL-12p40 gene, a subunit of the IL-12 heterodimer, showed a significant reduction in both incidence and severity of CIA.29 In contrast, mice deficient in the IL-12p35 gene, another subunit of the IL-12 heterodimer, showed exacerbated CIA.30 Recent evidence indicated that IL-12p40 is a subunit of not only IL-12 but also IL-23 heterodimer31 suggesting that IL-23, rather than IL-12, may play an important role in CIA development. Because microbial Toll-like receptor ligands stimulate APC, such as macrophages and DC, to produce IL-12 and IL-23, immunization with C II in CFA containing a high dose of M. tuberculosis induced IL-12 and/or IL-23 in C57BL/6 mice, which might regulate the development of CIA.

Acknowledgments

We thank Yurika Soeda for secretarial assistance. This research was supported in part by the grants provided by the Ministry of Education, Science and Culture of Japan and the Uehara Memorial Foundation.

References

1. Courtenay JS, Dallman MJ, Dayan AD, Martin A, Mosedale B. Immunisation against heterologous type II collagen induces arthritis in mice. Nature. 1980;283:666–8. [PubMed]
2. Holmdahl R, Andersson ME, Goldschmidt TJ, Jansson L, Karlsson M, Malmstrom V, Mo J. Collagen induced arthritis as an experimental model for rheumatoid arthritis. Immunogenetics, pathogenesis and autoimmunity. Apmis. 1989;97:575–84. [PubMed]
3. Durie FH, Fava RA, Noelle RJ. Collagen-induced arthritis as a model of rheumatoid arthritis. Clin Immunol Immunopathol. 1994;73:11–8. [PubMed]
4. Myers LK, Rosloniec EF, Cremer MA, Kang AH. Collagen-induced arthritis, an animal model of autoimmunity. Life Sci. 1997;61:1861–78. [PubMed]
5. Wooley PH, Luthra HS, Stuart JM, David CS. Type II collagen-induced arthritis in mice. I. Major histocompatibility complex (I region) linkage and antibody correlates. J Exp Med. 1981;154:688–700. [PMC free article] [PubMed]
6. Wooley PH, Luthra HS, Griffiths MM, Stuart JM, Huse A, David CS. Type II collagen-induced arthritis in mice. IV. Variations in immunogenetic regulation provide evidence for multiple arthritogenic epitopes on the collagen molecule. J Immunol. 1985;135:2443–51. [PubMed]
7. Campbell IK, Hamilton JA, Wicks IP. Collagen-induced arthritis in C57BL/6 (H-2b) mice: new insights into an important disease model of rheumatoid arthritis. Eur J Immunol. 2000;30:1568–75. [PubMed]
8. Morita Y, Yamamura M, Kawashima M, Harada S, Tsuji K, Shibuya K, Maruyama K, Makino H. Flow cytometric single-cell analysis of cytokine production by CD4+ T cells in synovial tissue and peripheral blood from patients with rheumatoid arthritis. Arthritis Rheum. 1998;41:1669–76. [PubMed]
9. Park SH, Min DJ, Cho ML, Kim WU, Youn J, Park W, Cho CS, Kim HY. Shift toward T helper 1 cytokines by type II collagen-reactive T cells in patients with rheumatoid arthritis. Arthritis Rheum. 2001;44:561–9. [PubMed]
10. Mauri C, Williams RO, Walmsley M, Feldmann M. Relationship between Th1/Th2 cytokine patterns and the arthritogenic response in collagen-induced arthritis. Eur J Immunol. 1996;26:1511–8. [PubMed]
11. O'Garra A, Arai N. The molecular basis of T helper 1 and T helper 2 cell differentiation. Trends Cell Biol. 2000;10:542–50. [PubMed]
12. O'Garra A. Immunology. Commit ye helpers. Nature. 2000;404:719–20. [PubMed]
13. Stastny P, Ball EJ, Dry PJ, Nunez G. The human immune response region (HLA-D) and disease susceptibility. Immunol Rev. 1983;70:113–53. [PubMed]
14. Stastny P, Ball EJ, Khan MA, Olsen NJ, Pincus T, Gao X. HLA-DR4 and other genetic markers in rheumatoid arthritis. Br J Rheumatol. 1988;27(Suppl. 2):132–8. [PubMed]
15. Schnare M, Barton GM, Holt AC, Takeda K, Akira S, Medzhitov R. Toll-like receptors control activation of adaptive immune responses. Nat Immunol. 2001;2:947–50. [PubMed]
16. Thoma-Uszynski S, Kiertscher SM, Ochoa MT, et al. Activation of toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. J Immunol. 2000;165:3804–10. [PubMed]
17. Henderson RA, Watkins SC, Flynn JL. Activation of human dendritic cells following infection with Mycobacterium tuberculosis. J Immunol. 1997;159:635–43. [PubMed]
18. Ortmann RA, Shevach EM. Susceptibility to collagen-induced arthritis: cytokine-mediated regulation. Clin Immunol. 2001;98:109–18. [PubMed]
19. Pan M, Kang I, Craft J, Yin Z. Resistance to development of collagen-induced arthritis in C57BL/6 mice is due to a defect in secondary, but not in primary, immune response. J Clin Immunol. 2004;24:481–91. [PubMed]
20. Vermeire K, Heremans H, Vandeputte M, Huang S, Billiau A, Matthys P. Accelerated collagen-induced arthritis in IFN-gamma receptor-deficient mice. J Immunol. 1997;158:5507–13. [PubMed]
21. Guedez YB, Whittington KB, Clayton JL, Joosten LA, van de Loo FA, van den Berg WB, Rosloniec EF. Genetic ablation of interferon-gamma up-regulates interleukin-1beta expression and enables the elicitation of collagen-induced arthritis in a nonsusceptible mouse strain. Arthritis Rheum. 2001;44:2413–24. [PubMed]
22. Segal BM, Dwyer BK, Shevach EM. An interleukin (IL)-10/IL-12 immunoregulatory circuit controls susceptibility to autoimmune disease. J Exp Med. 1998;187:537–46. [PMC free article] [PubMed]
23. Tang H, Sharp GC, Peterson KP, Braley-Mullen H. IFN-gamma-deficient mice develop severe granulomatous experimental autoimmune thyroiditis with eosinophil infiltration in thyroids. J Immunol. 1998;160:5105–12. [PubMed]
24. Jones LS, Rizzo LV, Agarwal RK, Tarrant TK, Chan CC, Wiggert B, Caspi RR. IFN-gamma deficient mice develop experimental autoimmune uveitis in the context of a deviant effector response. J Immunol. 1997;158:5997–6005. [PubMed]
25. Willenborg DO, Fordham SA, Staykova MA, Ramshaw IA, Cowden WB. IFN-gamma is critical to the control of murine autoimmune encephalomyelitis and regulates both in the periphery and in the target tissue: a possible role for nitric oxide. J Immunol. 1999;163:5278–86. [PubMed]
26. Chu CQ, Wittmer S, Dalton DK. Failure to suppress the expansion of the activated CD4 T cell population in interferon gamma-deficient mice leads to exacerbation of experimental autoimmune encephalomyelitis. J Exp Med. 2000;192:123–8. [PMC free article] [PubMed]
27. Abbas AK, Murphy KM, Sher A. Functional diversity of helper T lymphocytes. Nature. 1996;383:787–93. [PubMed]
28. Leung BP, McInnes IB, Esfandiari E, Wei XQ, Liew FY. Combined effects of IL-12 and IL-18 on the induction of collagen-induced arthritis. J Immunol. 2000;164:6495–502. [PubMed]
29. McIntyre KW, Shuster DJ, Gillooly KM, et al. Reduced incidence and severity of collagen-induced arthritis in interleukin-12-deficient mice. Eur J Immunol. 1996;26:2933–8. [PubMed]
30. Murphy CA, Langrish CL, Chen Y, Blumenschein W, McClanahan T, Kastelein RA, Sedgwick JD, Cua DJ. Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation. J Exp Med. 2003;198:1951–7. [PMC free article] [PubMed]
31. Oppmann B, Lesley R, Blom B, et al. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity. 2000;13:715–25. [PubMed]

Articles from Immunology are provided here courtesy of British Society for Immunology
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...