• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. Dec 12, 2006; 103(50): 19206–19211.
Published online Dec 5, 2006. doi:  10.1073/pnas.0605275103
PMCID: PMC1748200
Plant Biology

The Arabidopsis NRT1.1 transporter participates in the signaling pathway triggering root colonization of nitrate-rich patches

Abstract

Localized proliferation of lateral roots in NO3-rich patches is a striking example of the nutrient-induced plasticity of root development. In Arabidopsis, NO3 stimulation of lateral root elongation is apparently under the control of a NO3-signaling pathway involving the ANR1 transcription factor. ANR1 is thought to transduce the NO3 signal internally, but the upstream NO3 sensing system is unknown. Here, we show that mutants of the NRT1.1 nitrate transporter display a strongly decreased root colonization of NO3-rich patches, resulting from reduced lateral root elongation. This phenotype is not due to lower specific NO3 uptake activity in the mutants and is not suppressed when the NO3-rich patch is supplemented with an alternative N source but is associated with dramatically decreased ANR1 expression. These results show that NRT1.1 promotes localized root proliferation independently of any nutritional effect and indicate a role in the ANR1-dependent NO3 signaling pathway, either as a NO3 sensor or as a facilitator of NO3 influx into NO3-sensing cells. Consistent with this model, the NRT1.1 and ANR1 promoters both directed reporter gene expression in root primordia and root tips. The inability of NRT1.1-deficient mutants to promote increased lateral root proliferation in the NO3-rich zone impairs the efficient acquisition of NO3 and leads to slower plant growth. We conclude that NRT1.1, which is localized at the forefront of soil exploration by the roots, is a key component of the NO3-sensing system that enables the plant to detect and exploit NO3-rich soil patches.

Keywords: adaptive root development, ANR1 signaling pathway, plant growth, nitrate sensing, nitrogen nutrition

Their lack of mobility means that plants have to modify their organ development to enhance their ability to capture light and edaphic resources. In particular, the plasticity of root development plays an important role in the adaptive responses of plants to the large spatial and temporal changes in the availability of water and mineral ions (1, 2). Many species have evolved mechanisms allowing them to detect a nutrient-rich patch in their root environment and to promote lateral root (LR) growth preferentially within those patches (35). This foraging behavior is crucial because it determines the efficiency with which plants compete with their neighbors and other organisms for the use of limiting mineral resources (6, 7). Although it must somehow involve systems for external nutrient sensing, molecular data unraveling the mechanisms of this adaptive response to spatial heterogeneity of nutrient availability are largely missing. Concerning nitrate (NO3), the main N source for plant nutrition, studies with Arabidopsis thaliana have shown that LR proliferation in NO3-rich patches mostly involves enhanced LR elongation (5). Stimulation of LR elongation by localized high NO3 supply is not a nutritional effect because of improved N assimilation in these roots but results from the action of a specific NO3-signaling pathway (5). The ANR1 MADS box gene, encoding a putative transcription factor, was shown to play a key role in this signaling pathway because its underexpression prevents the local stimulation of LR elongation by high NO3 availability (5). The precise role of ANR1 is not clarified yet. However, its expression was shown to be regulated by N availability in a complex way, being induced by NO3 and repressed by high N supply, depending on the plant growth conditions (5, 8). These data suggest that ANR1 itself is controlled by an upstream NO3-sensing system, which has been postulated to involve an unknown plasma membrane NO3 receptor located in the root tip (9, 10).

The aim of the present studies was to investigate the possibility that the role of NO3 receptor in the A. thaliana root tip could be performed by the NRT1.1 (formerly CHL1) NO3 transporter. In Arabidopsis thaliana, the known NO3 transporters are encoded by two genes families, namely NRT1 (belonging to the large PTR family of 53 transporter genes) and NRT2 (7 members). To date, only four of these putative transporters (NRT1.1, NRT1.2, NRT1.4, and NRT2.1) have been functionally characterized in planta (1114), with three being involved in root NO3 influx: NRT1.1 as dual-affinity transporter (11, 15, 16), NRT1.2 as a low-affinity transporter (12), and NRT2.1 as a major component of the high-affinity uptake system (13, 17). Three main reasons guided us to select NRT1.1 as the most promising candidate for our study. First, NRT1.1 is highly expressed in young tissues, and especially in root tips (18), suggesting a specific role for this transporter in the early acquisition of NO3 when growing roots enter soil areas yet unexplored by the plant. Second, mutants of NRT1.1 (chl1 mutants) were shown to display a root development phenotype under very specific conditions (i.e., reduced LR emergence at low external NO3 concentration and low external pH) that could not be related to NRT1.1 NO3 transport activity (18). Neither the physiological significance of this phenotype nor the mechanisms responsible are understood, but this raised the question of a putative role of NRT1.1 in root development. Most importantly, both a recent report (19) and our previous work (20) suggested a signaling function of NRT1.1 in other key responses of the plant to changes in external N availability, i.e., the relief of seed dormancy by NO3 and the regulation of the high-affinity NO3 uptake system, respectively. Indeed, chl1 mutants show a constitutive overexpression of the high-affinity NO3 uptake system, related to a profound alteration of the feedback repression of NRT2.1 expression by NH4+ or high NO3 supply.

In the present paper, we have analyzed the response of LR growth to a localized NO3 supply in chl1 mutants to determine whether NRT1.1 also contributes to this aspect of the adaptive response of the plant to NO3 availability. We show that NRT1.1 plays a key role in triggering the stimulation of LR elongation in NO3-rich patches and provide evidence that this aspect of NRT1.1 function is linked to the ANR1-signaling pathway.

Results

Mutants at the NRT1.1 Locus Show Reduced LR Growth Within a Nitrate-Rich Patch.

To mimic the situation where the tip of a growing LR enters a NO3-rich patch, we have devised a split-root experimental system by using segmented vertical agar plates (Fig. 1A) and transferred 9-d-old Arabidopsis seedlings with only the apical part of one first-order LR positioned on high NO3 medium (HN; 10 mM NO3) and the rest of the root system placed on low NO3 medium (LN; 0.05 mM NO3). After 12 d, the single LR on HN medium displayed a dramatic proliferation response in Ws wild-type plants (Fig. 1A), with both a strongly increased elongation of this first-order LR and the appearance of a large number of visible second-order LRs (>0.5 mm). None of these responses were found in control plants transferred to systems with an even distribution of NO3 between the two sides [either HN/HN or LN/LN; supporting information (SI) Fig. 6]. As a consequence, the total second-order LR length measured on the first-order LR on HN medium (taken as an indicator of the proliferation response) was 10-fold higher in plants subjected to local high NO3 supply (LN/HN) than in HN/HN control plants (Fig. 1B). In the chl1-10 mutant, a T-DNA knockout mutant of NRT1.1 (20), the overall LR growth response in the NO3-rich patch was strongly attenuated, with only a 4-fold increase in total second-order LR length on HN medium as compared with controls (Fig. 1 A and B). This was found to be almost entirely due to a 50% reduction of the mean length of these second-order LRs in chl1-10 as compared with Ws plants (Fig. 1 A and C). Neither the final length of the first-order LR on HN medium nor the total number of visible second-order LRs were affected by the NRT1.1 mutation (SI Fig. 7). This LR phenotype of the chl1-10 mutant was specific for plants under localized high NO3 supply because no restriction of root growth was recorded in chl1-10 plants growing on homogeneous medium with 10 mM NO3 (SI Fig. 8, see also HN/HN controls in Fig. 1 B and C).

Fig. 1.
Mutation of NRT1.1 alters LR elongation in a nitrate-rich patch. (A) Response of the root system architecture to a localized high NO3 supply (HN; 10 mM) in wild-type (Ws) and NRT1.1 mutant (chl1-10) of Arabidopsis. LN, low NO3 medium ...

The LR Growth Phenotype of the NRT1.1-Deficient Mutants Is Not Due to Decreased Root Nitrate Uptake Activity.

We considered the possibility that the altered root growth response in chl1-10 may be due to reduced NO3 uptake activity. Both plant growth and NO3 uptake from the HN side therefore were measured in chl1-10 and in another NRT1.1-deficient mutant, chl1-5 (11), and their corresponding wild-types (Ws and Col, respectively). After 12 d of treatment, the mutations at the NRT1.1 locus strongly hampered the increased root biomass allocation to the HN side that was observed in wild-type plants (Fig. 2A). Most importantly, this was not associated with an impaired 15NO3 uptake from the 15N-labeled HN side in the chl1 mutants during the first day after transfer (Fig. 2B). However, at the end of the 12-d treatment, both cumulative 15NO3 uptake and total plant biomass were reduced by ≈25% in chl1 mutants as compared with the wild-types (Fig. 2 C and D). Most of the reduction in final biomass of the mutants was accounted for by a 35% slower growth of the shoot during the treatment (SI Table 1).

Fig. 2.
Mutation of NRT1.1 does not alter specific nitrate uptake activity but reduces growth of plants subjected to localized nitrate supply. (A) Ratio between root dry biomass in HN (10 mM) and LN (0.05 mM) patches in two NRT1.1 mutant alleles (chl1-10 and ...

It is important to note that cumulative 15NO3 uptake from the HN side in the chl1 mutants (expressed on a total plant weight basis) was reduced by only 25% compared with the wild-types (Fig. 2C), whereas root biomass on this HN side was reduced by at least 50% (Fig. 2A). This shows that the specific NO3 uptake activity (expressed on a root weight basis) of the HN roots has been increased in chl1 mutants, but not enough to compensate for the strongly reduced growth of these roots compared with wild-types. Taken together, these data indicate that the much less pronounced LR growth response of the chl1 mutants was not the consequence of a defect in specific NO3 uptake activity. However, it does result after 12 d in a net reduction in the cumulative N uptake from the NO3-rich patch compared with the wild-types, which accounts for the reduced biomass accumulation of the chl1 mutants.

The Phenotype of NRT1.1-Deficient Mutants Is Associated with Altered Nitrate Signaling.

A limitation of the split-root system depicted in Fig. 1A is that HN and LN sides markedly differed in nature and size at the beginning of the treatment, and that the architecture of the LN side rapidly becomes too complex to be easily assessed. Thus, to investigate more specifically the differential growth between the HN and LN sides of the root system, a simplified split-root device was set up, where the root system of 9-d-old plants was pruned to only the two most basal LRs positioned on LN or HN medium, respectively (Fig. 3A). In wild-type plants, preferential root growth on the HN side was marked particularly in this case (Fig. 3B), because after only 5 d of treatment, total second-order LR length already was between 2- and 4-fold greater on the HN than on the LN side. A similar number of second-order LRs developed on both the HN and the LN sides, but the mean length of these roots was much higher on the HN side. This behavior was found equally whether the NO3 concentration on the HN side was 10 mM or only 0.5 mM (Fig. 3 B and C). In both cases, preferential second-order LR growth on the HN side was attenuated strongly in both chl1 mutants (Fig. 3 B and C), demonstrating the key role of NRT1.1 in governing this adaptive root development response in a wide range of NO3 availability situations. As was the case with 10 mM NO3, specific NO3 uptake activity of the roots on the 0.5 mM NO3 HN side was not reduced by NRT1.1 mutation (SI Fig. 9).

Fig. 3.
The root phenotype of chl1 mutants is due to altered sensing of nitrate. (A) Response of the root system architecture to a localized high NO3 availability in Arabidopsis plants with a root system pruned to two first-order LRs, placed for 5 d ...

Significantly, the LR growth response on the HN side, and its alteration in chl1 mutants, also was observed when the spatial heterogeneity of NO3 availability was compensated for by the addition of glutamine or NH4+ to the medium, to yield the same total N concentration on both HN and LN sides (Fig. 3 D and E). This confirms previous evidence that NO3 stimulation of LR growth is due to the NO3 ion itself and is not a response to higher N availability per se (9). However, it also shows that the altered response of chl1 mutants was not due to any deficiency in their ability to use NO3 as a nutrient, because supply of an alternative N source did not restore LR growth on the HN side to the level of the wild-type. In agreement with the above conclusions, the LR proliferation response to localized supply of NH4+ was much less pronounced than with NO3 (compare SI Fig. 10 with Fig. 3 BE), and was not affected by NRT1.1 mutation (SI Fig. 10).

Furthermore, the time course analysis of LR growth on both HN and LN sides revealed that the attenuation of the LR growth response to localized NO3 supply in chl1 mutants was due to both decreased LR growth on the HN side and increased LR growth on the LN side (Fig. 3F and data not shown for chl1-10). This indicates that under uneven NO3 availability, mutation of NRT1.1 does not impair LR growth per se but strongly modifies the distribution of LR growth between the two sides of the root system.

NRT1.1 Regulates ANR1 Expression.

Collectively, the above results show that the LR growth phenotype of the chl1 mutants resembles that of transgenic lines underexpressing ANR1 (i.e., reduced LR elongation in a NO3-rich patch). This suggests that the function of NRT1.1 in regulating LR growth may involve the ANR1-dependent NO3-signaling pathway. To investigate this hypothesis, we compared both the localization of NRT1.1 and ANR1 expression in the roots, and the levels of ANR1 mRNA in wild-type and chl1 mutants. Under most conditions, GUS activity in transgenic pNRT1.1::GUS and pANR1::GUS lines was found to colocalize in the same tissues of the roots (Fig. 4), namely, apex and base of LRs (Fig. 4 AF), young emerging LRs (Fig. 4 G and J), LR primordia (Fig. 4 H and K), and apex of the primary root (Fig. 4 I and L). Quite often, both pNRT1.1 and pANR1 also were found to be active in the stele (Fig. 4 AK). In some instances, pANR1 activity could not be detected in the apex of mature LRs (Fig. 4E), suggesting that ANR1 expression may be down-regulated in the LR tip at a relatively late stage of development. Interestingly, when investigated in the apical part (1–1.5 cm) of both primary and LRs of plants uniformly supplied with NO3, ANR1 transcript levels were found to be dramatically reduced in chl1 plants as compared with wild-types, regardless of the external NO3 concentration in the medium (Fig. 5A). Similar results were obtained in plants under localized supply of NO3, where NRT1.1 mutation strongly reduced ANR1 mRNA accumulation in the apex of first-order LRs and in second-order LRs growing on the HN side (Fig. 5B). The ANR1 transcription regulation was confirmed by the comparison of pANR1::GUS expression in either wild-type or chl1 genetic background (SI Fig. 11). Because a high level of ANR1 expression is required to stimulate LR elongation in NO3-rich patches (5), this provides a convincing molecular explanation for the altered LR growth response of the chl1 mutants.

Fig. 4.
Spatial localization of NRT1.1 and ANR1 expression. (AC and GI) Histochemical localization of GUS activity in pNRT1.1::GUS plants. (DF and JK) Histochemical localization of GUS activity in pANR1::GUS plants. GUS activity ...
Fig. 5.
Effect of NRT1.1 mutation on ANR1 expression. (A) Relative ANR1 mRNA levels in the apical 10–15 mm of primary and LRs of wild-type and chl1 mutant plants, grown on homogenous medium containing either 0.5 or 10 mM NO3 as the N source. ...

Discussion

The detection by the plant of a NO3-rich patch in the root environment is the first step in a crucial developmental response that leads to preferential LR growth in the zone where this essential nutrient is most abundant (35). Using a different experimental approach involving a split root system, we confirm here previous evidence that, in Arabidopsis, this response mainly relies on the stimulation of LR elongation (5) and that it is not a nutritional effect, but results from specific local NO3 signaling (9).

Our data indicate that NRT1.1 has a major role in the NO3-signaling pathway, leading to increased rates of LR elongation. Both NRT1.1-deficient chl1 mutants showed a strongly decreased LR colonization of the NO3-rich patch, resulting in a reduced ability of the plant to efficiently exploit this localized nutrient resource. Four major arguments support the hypothesis that the LR growth phenotype of the chl1-5 and chl1-10 mutants is due to altered local NO3 signaling and not to impaired N acquisition. First, the defect in LR growth was observed only when the NO3 supply was localized and not when NO3 was uniformly supplied. Second, no decrease in specific root NO3 uptake activity was observed in the chl1 mutants. Third, addition of an alternative N source such as glutamine or NH4+ in the HN side was unable to restore normal LR growth in the chl1 mutants. Fourth, both chl1 mutants displayed a dramatically altered expression of ANR1, a major component of the local NO3-signaling pathway triggering LR elongation in NO3-rich patches (5).

The observation that mutations at the NRT1.1 locus did not reduce specific root NO3 uptake activity at either 0.5 mM or 10 mM external NO3 concentration fits well with previous functional characterization of this transporter. Indeed, Touraine and Glass (21) showed that NRT1.1 mutation has little impact on low-affinity NO3 uptake (i.e., at external concentrations >1 mM) when NO3 is the sole N source. The same is true for high-affinity NO3 uptake (i.e., at external concentrations <1 mM), because it is now well documented that NRT2.1, and not NRT1.1, is the main transport system for root NO3 uptake in this situation (13, 17, 2224). Thus, together with the previous report that chl1 mutants display an altered root growth under very specific conditions even in the absence of added NO3 in the medium (18), this indicates that the consequences of NRT1.1 mutation on root architecture cannot simply be explained by lowered N acquisition by the plant. Thus, it is not surprising that the altered LR growth phenotype of chl1 mutants could not be rescued by glutamine or NH4+ supply. However, the effects of NRT1.1 on LR growth remain in line with its surprising functional transport properties. Indeed, NRT1.1 is an unusual dual-affinity transporter (15, 16), shifting from low to high affinity for NO3 in response to posttranslational regulation by phosphorylation (25). This may explain why a LR growth phenotype is found for chl1 mutants independently of whether the actual NO3 concentration in the NO3-rich patch is in the low (0.5 mM) or high (10 mM) range. Finally, the observation that mutation of NRT1.1 prevents normal expression of ANR1 is most important, because it provides a clear indication of altered NO3 signaling in chl1 mutants. Although the precise role of ANR1 is not clarified yet, it has been reported that a high level of ANR1 transcript accumulation is required to yield the LR growth response (5). This suggests that NRT1.1 directs preferential LR elongation in NO3-rich patches because it contributes to activating the ANR1-mediated NO3-signaling pathway through modulation of ANR1 mRNA accumulation.

To account for our observations, we propose that NRT1.1 acts in external NO3 sensing, and is located upstream of ANR1 in the NO3 signaling pathway that triggers increased LR elongation in NO3-rich patches. The question rises whether NRT1.1 actually is a NO3 sensor generating a signal transduced internally by the ANR1 pathway or is the specific transporter providing the NO3 signal to an internal sensor triggering the ANR1 pathway. The fact that specific NO3 uptake activity is not reduced in the chl1 mutants as compared with wild-types supports the first hypothesis, because it indicates that entry of the NO3 signal into the roots is not prevented by NRT1.1 mutation. Accordingly, other aspects of NO3 signaling, such as NO3 induction of NRT2.1, are not altered by an NRT1.1 mutation (20) and NO3 induction of NRT2.1 is not affected in an ANR1 knockout mutant (8).

Well documented in yeast, the idea that members of membrane transporter families may fulfill a nutrient-signaling function also has been proposed in plants (26). In Arabidopsis, the NRT2.1 high-affinity NO3 transporter recently has been shown to be implicated in the modulation of LR initiation, also in a way that cannot be explained by changes in root NO3 uptake activity (27, 28). Furthermore, a NO3-signaling role for NRT1.1 already has been proposed to account for the fact that its mutation strongly alters the normal regulation of NRT2.1 expression in preventing repression of this gene by high N provision to the plant (20). Alternatively, one could argue that a possible very localized defect in NO3 transport (e.g., at the root tip) of the chl1 mutants, which cannot be unraveled by our macroscopic 15NO3 uptake measurements, may prevent NO3 reaching the internal sensor. Expression of ANR1 initially was shown to be NO3 inducible (5). Thus, a possibility would be that NRT1.1 is responsible for supplying locally the NO3 inducer for expression of ANR1. However, this explanation may be too simplistic because recent data indicate that regulation of ANR1 is much more complex and that, as commonly observed for several other N-related genes, it is also repressed by high N provision to the plant (8). Whatever the precise role of NRT1.1, it appears to be functionally related to the ANR1-signaling pathway and may either provide or transduce the NO3 signal to this pathway. Moreover, the importance of NRT1.1 as a central player in the integrated responses of the plant to nutrient cues is highlighted, because it governs both key metabolic (NRT2.1 uptake system) and developmental (LR elongation) adaptive responses to changes in external NO3 availability.

The predominant expression of NRT1.1 in all root tips (Fig. 4 and SI Fig. 12) is of major significance because it indicates that this transporter is localized at the forefront of the soil exploration by the root system, a strategic place for scanning the mineral environment at the periphery of the rooted area and identifying gradients in external nutrient availability (10, 29). Furthermore, the overlap between NRT1.1 and ANR1 expression in LR primordia and LR apices is consistent with the conclusion that the local NO3 signaling triggering the LR growth response in NO3-rich patches stimulates cell production in LR meristems (9). This also provides an explanation for the role of NRT1.1 in modulating the distribution of LR growth within the root system, because it suggests that this transporter specifically favors meristem activity on the HN side, thus increasing the sink strength of this part of the root system, to the detriment of the roots in LN side. Accordingly, NRT1.1 mutation not only reduces LR elongation on the HN side but also increases it on the LN side (Fig. 3 BF). However, we cannot formally rule out the reverse hypothesis, i.e., that the primary action of NRT1.1 is to repress meristem activity on the LN side, indirectly favoring root growth on the HN side.

Finally, it must be recalled that mutation of NRT1.1 markedly attenuates, but does not totally suppress, the LR growth response in NO3-rich patches. This indicates that part of this response may involve other signaling pathways, independent of NRT1.1 and possibly of ANR1. Interestingly, several putative NO3 transporter genes other than NRT1.1 were found to be expressed in root tips (30). This does not necessarily mean that these transporters also participate to NO3 sensing in relation with root development. However, the fact that both NRT1.1 and NRT2.1, the first NO3 transporters identified in higher plants, now are reported to have a signaling function may indicate a more general role of NO3 transporters, and by analogy of other ion transporters, in external nutrient sensing. Furthermore, several other MADS box genes have been shown to be regulated in the roots by N provision to the plant (8), thus providing interesting candidates for the investigation of additional signaling pathways involved in the adaptive responses of the plant to the changes in external N availability. We anticipate that a wider investigation of mutants defective in ion transporters or other MADS box genes (particularly those expressed in root tips or LR primordia) will provide important insight into the mechanisms enabling the plant to modulate its root development for improved efficiency and higher competitiveness in nutrient acquisition.

Methods

Plant Material.

The Arabidopsis thaliana Heynh ecotypes used in this study were Wassileskija (Ws) and Columbia (Col-0). The NRT1.1 mutants were the chl1-5 mutant in a Col-0 background (11) and the chl1-10 T-DNA insertion mutant in a Ws background (20). Transgenic Arabidopsis lines used for histochemical studies carried the following promoter-reporter gene fusions: pNRT1.1::GUS (18) and pANR1::GUS. For the pANR1::GUS construct, a 2,957-bp fragment located upstream of the translation initiation codon (−2,963 to −6) of ANR1 was cloned into the BamHI site in pBI101.3 (Clontech Laboratories, Palo Alto, CA), and Col-0 was transformed by the floral dip method (31) by using Agrobacterium tumefaciens GV3101. The pANR1::GUS construct has been introduced in chl1-5 background by crossing.

Plant Growth.

Basal medium contained 0.5 mM CaSO4, 0.5 mM MgCl2, 1 mM KH2PO4, 2.5 mM Mes (2-[morpholino]ethanesulphonic acid; Sigma, Saint Quentin, France) (pH 5.8), 50 μM NaFeEDTA, 50 μM H3BO3, 12 μM MnCl2, 1 μM CuCl2, 1 μM ZnCl2, and 0.03 μM NH4MoO4. This basal medium was supplemented with KNO3 as a sole nitrogen source at the concentrations indicated for each individual experiment. The K+ concentration was adjusted to 10 mM by addition of K2SO4 in all media with KNO3 concentrations <10 mM. Arabidopsis seeds were surface sterilized for 10 min in 1 ml of 50% (vol/vol) ethanol containing 2% (wt/vol) Bayrochlor (Bayrol, Mundolsheim, France), followed by five washes with 100% ethanol and drying in a laminar air flow. Sterilized seeds were planted with a sterile toothpick in 12 × 12 cm transparent plates on 40 ml of solid medium (1% Difco Bacto agar; BD Biosciences, Sparks, MD) containing 10 mM NO3. After storing for 2 d at 4°C in the dark, plates were incubated vertically in a growth chamber at 22°C, with a 16 h/8 h light/dark regime and a light intensity of 230 μmoles·m−2·sec−1. Plantlets growing on the surface of the agar were transferred at various time points as indicated to fresh growth media (at five plants per plate) containing various NO3 concentrations.

The experimental device for localized high NO3 supply was established by using segmented agar plates where two patches of agar were separated by a trench. The high NO3concentration on one side was obtained by placing concentrated KNO3 solution on top of the solidified medium. Concentrated K2SO4 solution was added on the other side to keep K+ concentration equal between the two patches. To allow diffusion of the added solutions in the agar patches, the plates were prepared 24 h before the experiments. For split-root experiments with intact root systems (Fig. 1A), 9-d-old seedlings were transferred for 12 d to vertical 24 × 24 cm agar plates containing segmented agar media. The apical part of one single LR was positioned on treatment medium with high NO3 concentration, whereas the rest of the root system was placed on low NO3 concentration medium. For split-root experiments with root systems pruned to only two LRs (Fig. 3A), the primary root of 6-d-old seedlings was cut just below the second visible LR. After 3 extra days of culture, plantlets were transferred for 5 d to vertical 12 × 12 cm agar plates containing segmented agar media.

Analysis of Root Growth.

The root systems in segmented vertical agar plates were scanned daily at 300 dpi (Epson Perfection 2450 Photo; Seiko Epson, Nagano, Japan), and root growth parameters were analyzed (32) by using the Optimas image analysis software (MediaCybernetics, Silver Spring, MD).

Nitrate Uptake Studies.

Cumulative uptake of NO3 from the NO3-rich patch was determined by 15N labeling. Therefore, the concentrated NO3 solution added to the solid medium in one side of the segmented agar plates contained K15NO3, at either 99% atom 15N or 1% atom 15N, for 1- or 12-d labeling, respectively. Plant tissues were harvested, dried at 70°C for 48 h, and weighed. Total 15N content in both roots and shoots was determined (33) by using an integrated system for continuous flow isotope ratio mass spectrometry (Euro-EA elemental analyzer; EuroVector S.P.A., Milan, Italy; and Isoprime mass spectrometer; GV Instruments, Crewe, U.K.).

GUS Expression Analysis.

Histochemical analysis of the GUS reporter enzyme activity was adapted from Jefferson (34). Plantlets were incubated for 4 h (pNRT1.1::GUS) in reaction buffer containing 1 mM 5-bromo-4-chloro-3-indolyl-β-d-glucuronid acid as the substrate. For improved staining (pANR1::GUS), samples were vacuum infiltrated for 30 min and incubated for 18 h in reaction buffer containing 0.05% Triton X-100 and 2 mM 5-bromo-4-chloro-3-indolyl-β-d-glucuronic acid. Plant pigments were cleared (35), and the GUS staining patterns were analyzed on an Olympus (Tokyo, Japan) BX61 microscope and a digital camera (Colorview 2) driven by Analysis software (Soft Imaging System, Lakewood, CO).

RNA Extraction and Gene Expression Analysis.

The apical part (1–1.5 cm) of primary and all LRs of 12-d-old plants were separated surgically from the rest of the root system. Frozen (−80°C) root samples (20–100 mg) were homogenized for 1 min at 30 s−1 (Retch mixer mill MM301; Retch, Haan, Germany) in 2-ml tubes containing two tungsten beads (2.5-mm diameter). Total RNA was extracted from homogenized tissues by using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Three micrograms of RQ-DNase (Promega, Madison, WI) digested total RNA was used to prepare cDNA by reverse transcription with M-MLV reverse transcriptase (Promega) and oligo(dT)18 primers, according to the manufacturer's protocol. Gene expression was determined by quantitative real-time PCR (LightCycler; Roche Diagnostics, Mannheim, Germany) by using ANR1 (AT2g14210) gene-specific primers (forward, aatgcgattgaaggcaattc; reverse, tcgatgtcccacatgttttg) and LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics). Expression levels of tested genes were normalized to expression levels of the CLATHRIN (At4g24550) gene (F, agcatacactgcgtgcaaag and R: tcgcctgtgtcacatatctc).

Supplementary Material

Supporting Information:

Acknowledgments

We thank Nigel Crawford (University of California at San Diego, La Jolla, CA) for supplying seeds of the pNRT1.1::GUS line. This work was supported by the European Union Research Training Network, “Plant Use of Nitrate” HPRN-CT-2002-00247 (to A.G. and B.G.F.), French government research programs “Action Concertée Incitative–Biologie du Développement et Physiologie Intégrative” P2R-Etude Intégrée de la Nutrition des Plantes par une Approche de System Biology (to A.G.), and a grant from the U.K. Biotechnology and Biological Sciences Research Council (to B.G.F.).

Abbreviations

HN
high NO3 medium
LN
low NO3 medium
LR
lateral root.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS direct submission. J.M. is a guest editor invited by the Editorial Board.

This article contains supporting information online at www.pnas.org/cgi/content/full/0605275103/DC1.

References

1. Forde BG, Lorenzo H. Plant Soil. 2001;232:51–68.
2. Lopez-Bucio J, Cruz-Ramirez A, Herrera-Estrella L. Curr Opin Plant Biol. 2003;6:280–287. [PubMed]
3. Drew MC. New Phytol. 1975;75:479–490.
4. Robinson D. New Phytol. 1994;127:635–674.
5. Zhang H, Forde BG. Science. 1998;279:407–409. [PubMed]
6. Lynch J. Plant Physiol. 1995;109:7–13. [PMC free article] [PubMed]
7. Robinson D, Hodge A, Griffiths BS, Fitter AH. Proc R Soc London Ser B. 1999;266:431–435.
8. Gan Y, Filleur S, Rahman A, Gotensparre S, Forde BG. Planta. 2005;222:730–742. [PubMed]
9. Zhang H, Jennings A, Barlow PW, Forde BG. Proc Natl Acad Sci USA. 1999;96:6529–6534. [PMC free article] [PubMed]
10. Filleur S, Walch-Liu P, Gan Y, Forde BG. Biochem Soc Trans. 2005;33:283–286. [PubMed]
11. Tsay YF, Frank MJ, Page T, Dean C, Crawford NM. Cell. 1993;72:705–713. [PubMed]
12. Huang NC, Liu KH, Lo HJ, Tsay YF. Plant Cell. 1999;11:1381–11392. [PMC free article] [PubMed]
13. Filleur S, Dorbe MF, Cerezo M, Orsel M, Granier F, Gojon A, Daniel-Vedele F. FEBS Lett. 2001;489:220–224. [PubMed]
14. Chiu CC, Lin CS, Hsia AP, Su RC, Lin HL, Tsay YF. Plant Cell Physiol. 2004;45:1139–1148. [PubMed]
15. Wang R, Liu D, Crawford NM. Proc Natl Acad Sci USA. 1998;95:15134–15139. [PMC free article] [PubMed]
16. Liu KH, Huang CY, Tsay YF. Plant Cell. 1999;11:865–874. [PMC free article] [PubMed]
17. Cerezo M, Tillard P, Filleur S, Muños S, Daniel-Vedele F, Gojon A. Plant Physiol. 2001;127:262–271. [PMC free article] [PubMed]
18. Guo FQ, Wang R, Chen M, Crawford NM. Plant Cell. 2001;13:1761–1777. [PMC free article] [PubMed]
19. Alboresi A, Gestin C, Leydecker MT, Bedu M, Meyer C, Truong H-N. Plant Cell Environ. 2005;28:500–512. [PubMed]
20. Munos S, Cazettes C, Fizames C, Gaymard F, Tillard P, Lepetit M, Lejay L, Gojon A. Plant Cell. 2004;16:2433–2447. [PMC free article] [PubMed]
21. Touraine B, Glass AD. Plant Physiol. 1997;114:137–144. [PMC free article] [PubMed]
22. Lejay L, Tillard P, Lepetit M, Olive F, Filleur S, Daniel-Vedele F, Gojon A. Plant J. 1999;18:509–519. [PubMed]
23. Zhuo D, Okamoto M, Vidmar JJ, Glass AD. Plant J. 1999;17:563–568. [PubMed]
24. Lejay L, Gansel X, Cerezo M, Tillard P, Muller C, Krapp A, von Wiren N, Daniel-Vedele F, Gojon A. Plant Cell. 2003;15:2218–2232. [PMC free article] [PubMed]
25. Liu KH, Tsay YF. EMBO J. 2003;22:1005–1013. [PMC free article] [PubMed]
26. Lalonde S, Boles E, Hellmann H, Barker L, Patrick JW, Frommer WB, Ward JM. Plant Cell. 1999;11:707–726. [PMC free article] [PubMed]
27. Little DY, Rao H, Oliva S, Daniel-Vedele F, Krapp A, Malamy JE. Proc Natl Acad Sci USA. 2005;102:13693–13698. [PMC free article] [PubMed]
28. Remans T, Nacry P, Pervent M, Girin T, Tillard P, Lepetit M, Gojon A. Plant Physiol. 2005;140:909–921. [PMC free article] [PubMed]
29. Barlow PW. J Plant Growth Regul. 2002;21:261–286.
30. Birnbaum K, Shasha DE, Wang JY, Jung JW, Lambert GM, Galbraith DW, Benfey PN. Science. 2003;302:1956–1960. [PubMed]
31. Clough SJ, Bent AF. Plant J. 1998;16:735–743. [PubMed]
32. Nacry P Canivenc G, Muller B, Azmi A, Van Onckelen H, Rossignol M, Doumas P. Plant Physiol. 2005;138:2061–2074. [PMC free article] [PubMed]
33. Clarkson DT, Gojon A, Saker LR, Wiersema PK, Purves JV, Tillard P, Arnold GM, Paans AJM, Vaalburg W, Stulen I. Plant Cell Environ. 1996;19:859–868.
34. Jefferson RA. Plant Mol Biol Rep. 1987;5:387–405.
35. Herr JM. Am J Bot. 1971;58:785–790.

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Compound
    Compound
    PubChem Compound links
  • Gene
    Gene
    Gene links
  • GEO Profiles
    GEO Profiles
    Related GEO records
  • HomoloGene
    HomoloGene
    HomoloGene links
  • MedGen
    MedGen
    Related information in MedGen
  • Pathways + GO
    Pathways + GO
    Pathways, annotations and biological systems (BioSystems) that cite the current article.
  • Protein
    Protein
    Published protein sequences
  • PubMed
    PubMed
    PubMed citations for these articles
  • Substance
    Substance
    PubChem Substance links
  • Taxonomy
    Taxonomy
    Related taxonomy entry
  • Taxonomy Tree
    Taxonomy Tree

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...