|
|
Proc Natl Acad Sci U S A. 2000 October 24; 97(22): 12138–12143. Published online 2000 October 17. | PMCID: PMC17307 |
Copyright © 2000, The National Academy of Sciences Developmental Biology Quantitative transcript imaging in normal and heat-shocked
Drosophila embryos by using high-density
oligonucleotide arrays Ronny Leemans,*† Boris Egger,* Thomas Loop,* Lars Kammermeier,* Haiqiong He,* Beate Hartmann,* Ulrich Certa,‡ Frank Hirth,* and Heinrich Reichert* *Institute of Zoology, Biocenter/Pharmacenter, University of Basel, CH-4056 Basel, Switzerland; and ‡Roche Genetics Pharmaceuticals Division, F. Hoffmann–La Roche, Ltd., CH-4070 Basel, Switzerland Received February 15, 2000. Embryonic development in Drosophila is characterized
by an early phase during which a cellular blastoderm is formed and
gastrulation takes place, and by a later postgastrulation phase in
which key morphogenetic processes such as segmentation and
organogenesis occur. We have focused on this later phase in
embryogenesis with the goal of obtaining a comprehensive analysis of
the zygotic gene expression that occurs during development under normal
and altered environmental conditions. For this, a functional genomic
approach to embryogenesis has been developed that uses high-density
oligonucleotide arrays for large-scale detection and quantification of
gene expression. These oligonucleotide arrays were used for
quantitative transcript imaging of embryonically expressed genes under
standard conditions and in response to heat shock. In embryos raised
under standard conditions, transcripts were detected for 37% of the
1,519 identified genes represented on the arrays, and highly
reproducible quantification of gene expression was achieved in all
cases. Analysis of differential gene expression after heat shock
revealed substantial expression level changes for known heat-shock
genes and identified numerous heat shock-inducible genes. These results
demonstrate that high-density oligonucleotide arrays are sensitive,
efficient, and quantitative instruments for the analysis of large scale
gene expression in Drosophila embryos. Recently the genome of
the first multicellular eukaryote Caenorhabditis
elegans was completely elucidated ( 1). Sequencing of the
Drosophila melanogaster genome has now also been carried
out, and currently the corresponding putative open reading frames are
being defined and verified ( 2). On the basis of this complete genomic
information, it will now be important to determine the complex
expression of all encoded genes and to analyze physiological as well as
pathological phenomena from a global genetic perspective. Large-scale
transcript analysis is made possible by DNA micro- or oligonucleotide
arrays ( 3, 4), both of which allow the simultaneous monitoring of
hundreds of mRNA expression profiles ( 5, 6). In this study, we used
Drosophila high-density oligonucleotide arrays to monitor
the simultaneous expression of zygotically active genes during the
later postgastrulation stages of embryonic development ( 7– 9). We
analyzed the relative abundance levels of hundreds of embryonically
expressed genes under normal physiological conditions and in response
to heat shock ( 10). In embryos raised under normal conditions, we
obtained highly reproducible quantification for 563 expressed genes
corresponding to different functional classes. After a 36°C heat
shock, we detected increases in expression levels for known heat-shock
genes and identified numerous heat-shock-inducible genes. Embryos. D. melanogaster Oregon R stocks were kept on standard
cornmeal/yeast/agar medium at 25°C. Embryos were collected
overnight on grape-juice plates for 12 h and were kept for a
further 5 h at 25°C before RNA isolation. Therefore, at the time
of RNA isolation, these embryos were at embryonic stages 10–17 ( 9). In
heat-shock experiments, embryos were collected overnight in the same
way, kept for a further 4 h at 25°C, and then subjected to a
36°C heat shock for 25 min followed by a recovery period of 25 min at
25°C before RNA isolation. Embryos younger than embryonic stage 10
were not used, because heat shock in these earlier stages results in
lethality ( 11). Embryos used for in situ hybridization
studies were collected and heat shock treated in the same way. Preparation of Biotinylated cRNA. Initial experiments designed to determine the sensitivity and
reproducibility of hybridization showed that the use of total RNA vs.
poly(A) + RNA as template for cDNA synthesis and subsequent
amplification (synthesis of cRNA) gave comparable results, despite the
fact that we consistently detected 5S RNA and histone genes present on
the array with cRNA derived from total RNA. On the basis of these
findings, all experiments were carried out by using a total RNA
protocol ( 12, 13). Total RNA was isolated from 200 mg of embryonic tissue by using
guanidinium isothiocyanate in combination with acidic phenol (pH 4.0)
(fast RNA tube green kit from BIO101) in a fast-prep homogenizer FP120
(Bio 101). After precipitation, the RNA was dissolved in diethyl
pyrocarbonate-treated water (Ambion, Austin, TX) and
spectrophotometrically quantified by using a genequant
RNA/DNA calculator (Pharmacia Biotech). cDNA was synthesized on total
RNA as a template by using the SuperScript Choice System for cDNA
synthesis (GIBCO/BRL) with a T7-(T)24 DNA primer:
5′GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(T)24VN-3′). For
first-strand cDNA synthesis, a typical 40-μl reaction contained 25
μg RNA, 200 pmols T7-(T)24 primer, 500 μM of each dNTP, and 800
units of reverse transcriptase (AMV Superscript II) (GIBCO/BRL). The
reaction was incubated for 1 hour at 42°C. Second-strand cDNA
synthesis was carried out at 18°C for 2 hours in a total volume of
340 μl by using 20 units Escherichia coli DNA ligase, 80
units E. coli DNA polymerase I, and 4 units RNase H in the
presence of 250 μM of each dNTP. After second-strand cDNA synthesis,
0.5 μl of RNase A (100 mg/ml) (Qiagen, Chatsworth, CA) was added,
and the samples were incubated at 37°C for one-half hour. Thereafter
7.5 μl proteinase K (10 mg/ml) (Sigma) was added and the samples
were further incubated at 37°C for another half-hour. After cDNA
synthesis was completed, samples were phenol chloroform extracted
(three times) by using Phase Lock Gel (Eppendorf-5Prime, Boulder, CO)
and precipitated overnight at −20°C with 2.5 volumes of 100%
ethanol. After precipitation, the samples were stored at −20°C.
Biotinylated antisense cRNA was synthesized from the
double-stranded DNA template, by using T7 RNA polymerase (MEGAscript T7
Kit, Ambion). A 20-μl reaction volume contained 0.3–1.5 μg of
cDNA, 7.5 mM of both ATP and GTP, 5.6 mM of both UTP and CTP, and 1.8
mM of both biotinylated Bio-16-UTP and Bio-11-CTP (Enzo
Diagnostics), and 2 μl 10× T7 enzyme mix. The reaction was incubated
at 37°C for 8 h. Thereafter, the unincorporated NTPs were
removed by putting the sample over an RNeasy spin column (Qiagen).
Samples were precipitated overnight at −20°C, taken up in 20 μl
DEPC-treated water, and spectrophotometrically quantified. Thereafter,
40 μg of the biotinylated antisense cRNA was fragmented by
heating the sample to 95°C for 35 min in a volume of 25 μl,
containing 40 mM Tris ![[center dot]](/corehtml/pmc/pmcents/middot.gif) acetate (pH 8.1), 100 mM KOAc, and 30 mM
MgOAc. High-Density Oligonucleotide Arrays. In this study, a custom-designed Drosophila
oligonucleotide array (ROEZ003A, Affymetrix, Santa Clara, CA) was used.
The genes represented on the array correspond to 1,519 sequenced
Drosophila genes encoding open reading frames deposited in
SwissProt/Tr EMBL databases as of spring 1998. Each gene is
represented on the array by a set of 20 oligonucleotide probes (25
mers) matching the gene sequence. To control the specificity of
hybridization, the same probes are synthesized with a single nucleotide
mismatch in a central position. As such, each gene is represented by 20
probe pairs comprised of a perfect match and a mismatch oligo. The
difference between the perfect match hybridization signal and the
mismatch signal is proportional to the abundance of a given transcript
( 4). Drosophila genes that were not unambiguously
represented by a probe set of 20 probe pairs on the array were excluded
from further analysis (23 probe sets were not used). The
oligonucleotide probe selection corresponding to each
Drosophila gene and the array fabrication was performed by
Affymetrix. Hybridization and Scanning. Gene chips were prehybridized with 220 μl hybridization buffer (1×
Mes (pH 6.7)/1 M NaCl/0.01% triton/0.5 μg/μl acetylated
BSA/0.5 μg/μl sonicated herring sperm DNA) for 15 min at 45°C
on a REAX 2 rotisserie at 60 rpm (Heidolph, Swabach, Germany).
Hybridization was done in a final volume of 220 μl hybridization
buffer, containing 40 μg fragmented biotinylated cRNA. The
samples were heated to 95°C for 5 min and briefly spun down.
Hybridizations were carried out for 16 h at 45°C with mixing on
a rotisserie at 60 rpm. After hybridization, the solutions were
removed, arrays were briefly rinsed with 6× SSPE-T buffer (0.9 M
NaCl/0.06 M NaH 2PO 4/6
mM EDTA/0.01% triton) and washed on a Fluidics station (Affymetrix).
Hybridized arrays were stained with 220 μl detection solution (1×
Mes buffer containing 2.5 μl streptavidin-R phycoerythrin conjugate
(1 mg/ml) (Molecular Probes) and 2.0 mg/ml acetylated BSA (Sigma)
at 40°C for 15 min and washed again ( 13). Data Analysis. Probe arrays were scanned with a commercial confocal laser scanner
(Hewlett–Packard). Pixel intensities were measured, and expression
signals were analyzed with commercial software (genechip
3.1, Affymetrix). Detailed data analysis was carried out by using
RACE-A (F. Hoffmann–La Roche), access 97,
and excel 97 (Microsoft) software. For
quantification of relative transcript abundance, the average difference
value (Avg Diff) was used. Four replicates for wild type (condition 1)
as well as heat-shock-treated wild type (condition 2) embryos were
carried out. All chips were normalized against the mean of the total
sums of Avg Diff values across all eight chips. For the analysis of
expression profiling of condition 1 embryos, two filter operations were
combined. First, all genes with a mean Avg Diff over the four replicate
chips that was below 50 were excluded from further analysis. Second, a
transcript was judged as present only if the standard deviation of its
mean Avg Diff value over the four replicate chips was below 25% of its
mean Avg Diff. For differential transcript imaging, only genes with a
change factor quality above 1 were considered in this analysis, meaning
that the difference of the means of the Avg Diff values over the four
replicates between condition 1 and condition 2 was larger than the sum
of the standard deviations of the mean Avg Diff values of condition 1
and condition 2 (race-a software, M. Neeb and C.
Broger, personal communication). In addition, for
down-regulation, the mean Avg Diff value of a gene had to be above
or equal to 50 in condition 1; for up-regulation, the mean Avg Diff
value of a gene had to be above or equal to 50 in condition 2. Whole-Mount in Situ Hybridization. Digoxigenin (DIG)-labeled sense and antisense RNA probes were
generated in vitro with a DIG labeling kit (Roche
Diagnostics), by using commercially available templates (Research
Genetics, Huntsville, AL) and hybridized to Drosophila
whole-mount embryos following standard procedures ( 14). Hybridized
transcripts were detected with an alkaline phosphatase-conjugated
anti-DIG Fab fragment (Roche Diagnostics) by using Nitro blue
tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma) as
chromogenic substrates. Embryos were mounted in Canada balsam (Serva)
and photographed with a Prog/Res/3008 digital camera (Kontron,
Zurich) on a Zeiss Axioskop microscope with differential
interference contrast optics. Reverse Transcriptase–PCR (RT-PCR). Three hundred nanograms of poly(A)+ RNA, isolated from
heat-shocked embryos and from embryos that were raised under standard
conditions (mRNA isolation kit; Roche Diagnostics), was reverse
transcribed with AMV-RT and random hexamers (first-strand cDNA
synthesis kit for RT-PCR; Roche Diagnostics). PCR was performed with
100 pg template DNA and gene-specific primers (seq web,
Wisconsin Package Ver. 10.0, GCG) on a light cycler (LightCycler, Roche
Diagnostics). Continuous fluorescence observation of amplifying DNA was
possible by using SYBR Green I (LightCycler-FastStart DNA master SYBR
Green I; Roche Diagnostics). After cycling, a melting curve was
produced by slow denaturation of the PCR end products to validate the
specificity of amplification. To compare the relative amounts of PCR
products, we monitored the amplification profile on a graph, displaying
the log of the fluorescence against the number of cycles. Relative
change folds for a given gene under both conditions (standard vs. heat
shock) were calculated by using the fit point method (LightCycler
operator's manual Ver. 3.0; Roche Diagnostics). Functional Classification and Data Presentation. The Drosophila genes represented on the high-density
oligonucleotide array were classified into 14 functional classes
according to the function of the gene product and currently available
genetic data. For this, notations in Flybase, Interactive Fly, and
SwissProt/Tr EMBL databases were used. These functional classes are
signal transduction, transcriptional regulation, cell cycle,
cytoskeleton/structural proteins, metabolism, translation, heat-shock
proteins, transcription/replication/repair, proteolytic
systems/apoptosis, cell surface receptors/cell adhesion
molecules/ion channels, transposable elements, chromatin structure,
RNA-binding proteins and secreted proteins. A comprehensive
presentation of all the genes represented on the oligonucleotide array
as well as their attribution to the 14 functional classes is given in
the supplemental data ( www.pnas.org). This web site also presents all
of the original expression data from the experiments on which this
report is based. For each gene characterized, Avg Diff values, change
fold, and change fold quality are given. Quantitative Transcript Imaging of Genes Expressed in
Postgastrulation Embryogenesis Under Standard Conditions. The oligonucleotide array used contains probe sets that are
complementary to 1,519 identified sequenced Drosophila
genes. Most of these genes (96%) can be grouped into 14 functional
categories according to the nature of the encoded protein. In a first
set of experiments, we used this oligonucleotide array to identify
transcripts expressed in wild-type embryos raised under standard
conditions (25°C). Transcript imaging revealed a total of 563 (37%)
of the 1,519 Drosophila genes as expressed in embryonic
stages 10–17. To document the quantitative reproducibility of the
relative expression levels, Avg Diff (see Materials and
Methods) and corresponding standard deviations for the detected
transcripts were determined over four experimental replicates (Fig.
).
Over two-thirds of the detected transcript types encode proteins
involved in metabolism (19.8%), transcriptional regulation (13.1%),
cell-surface receptors/cell adhesion molecules/ion channels
(11.1%), translation (9.2%) cytoskeleton/cell structure (8.5%), or
signal transduction (7.2%) (Table 1).
Marked differences were observed in the range of relative expression
levels for the different functional categories (Fig.
). Highest expression levels were seen
for specific genes encoding proteins involved in translation. Thus, of
the 21 transcripts with Avg Diff >5,000, 18 encode ribosomal proteins.
High expression levels with Avg Diff >4,000 are also seen for specific
individual transcripts encoding proteins involved in chromatin
structure and protein degradation. For example, the highest Avg Diff in
the functional class protein degradation/apoptosis is the
transcript encoding the Cystatin-like protein (Avg Diff 4,792). Some
transcripts for proteins involved in signal transduction, DNA
transcription/replication/repair, metabolism, as well as the
transcript encoding the heat-shock cognate protein 70–4 have maximal
Avg Diff in the 3,000–4,000 range. Surprisingly elevated expression
levels are observed for transcripts encoded by specific transposable
elements; in three cases, Avg Diff were above 2,000, namely for two
open reading frames encoded by the transposon I element and for a
putative reverse transcriptase encoded by an F element. Remarkably
elevated expression levels are also seen for the transcription factor
Box B-binding factor 1 (1,315); for other genes encoding transcription
factors such as snail (Avg Diff 394), glial cells
missing (237), islet (136), and paired (64)
transcript levels were in the intermediate to low range (Avg Diff
<550).
| Table 1Drosophila oligonucleotide array: Expression
data for wild-type embryos |
Quantitative Transcript Imaging of Heat-Shocked Compared with
Non-Heat-Shocked Embryos. Oligonucleotide arrays were next used to determine transcript profile
changes after heat-shock exposure. For this, transcript imaging was
carried out on stage 10–17 embryos subjected to a 36°C heat shock
for 25 min (see Materials and Methods). The expression
profile from embryonically expressed genes after heat shock was
quantitatively compared with the expression profile from embryos raised
under standard conditions. Comparative transcript imaging identified 74
genes, distributed among 12 functional classes, whose relative
expression level changed in response to heat shock; 36 genes had
increased and 38 genes had decreased expression levels (Fig.
).
Heat shock is known to induce the expression of an evolutionary
conserved family of genes encoding the heat-shock proteins (Hsps) ( 10,
15, 16). Accordingly, in our comparative screen, we observed a
prominent increase in relative transcript abundances for all genes
encoding Hsps represented on the chip and that have been reported to be
highly up-regulated by heat shock. Transcript imaging detected
increases above 3-fold in relative expression levels for 9 genes
encoding Drosophila heat-shock proteins: Hsp22, Hsp26,
Hsp27, Hsp23, DnaJ-1, Hsp67Bc, Hsp83, Hsp70Ab, and
Hsp70Bb ( 17, 18). The largest changes (>10-fold) were
observed for Hsp22, Hsp26, Hsp27, and
Hsp23, in accordance with several studies that report that
these four small Hsps are expressed during normal fly development and
are up-regulated under heat shock ( 19, 20). For five other genes known
to encode heat-shock proteins, DnaJ-1, Hsp67Bc, Hsp83,
Hsp70Ab, and Hsp70Bb, we detect an increase in
expression in the 3- to 6-fold range. All of these genes are known to
be responsive to heat shock ( 20). The heat-shock cognate genes (Hsc)
have been reported to be expressed at normal temperatures but are not
further induced by heat shock ( 21, 22). In accordance with this, we
observed no marked change in expression level for Hsc70–1,
Hsc70–4, and Hsc70–5. We did, however, detect a small
increase in expression level for Hsc70–3. Two other genes with increases in relative expression levels above
3-fold are Shark, involved in a signaling pathway for
epithelial cell polarity ( 23), and anon-23Da, encoding a
protein with currently unknown function. Twenty-five other genes show
increased expression levels in the 1.5- to 3-fold range.
Heat-shock-induced expression of these genes in Drosophila
has not been reported before. However, Cdc37 is known to
interact genetically with Hsp83 in a common signaling
pathway in Drosophila ( 24), and in several other cases,
homologous genes in other eukaryotes are known to be stress inducible.
The gene kayak ( kay), for example, is the
Drosophila homologue of the mammalian c-fos.
c-fos mRNA is induced after exposure to noxious stimuli such as
heat, arsenite, and heavy metals, and recently it has been reported
that the human and rodent c-fos promoters contain heat-shock
element consensus sequences that enhance transcription in response to
heat ( 25). A second example is Tenascin major
( Ten-m), encoding a protein implicated in patterning the
early fly embryo. The mammalian homologue of Tenascin major
is the gene DOC4, known to act downstream
of CHOP, a small nuclear protein that mediates
changes in cell phenotype in response to stress ( 26). Heat-shock-induced decreases in relative expression levels greater than
3-fold are seen for mus210, the Drosophila
homologue of the xeroderma pigmentosum complementation group C gene,
which is involved in DNA repair, and for anon-X, which
encodes a novel WD repeat protein of unknown function ( 27, 28). The
remaining 36 genes with decreased relative expression levels are in the
1.5- to 3-fold range. A decrease in relative expression in response to
heat shock has not been reported previously for any of these genes in
Drosophila. For most of the 74 identified genes, which show differential expression
levels in response to heat shock, changes are in the 1.5- to 3-fold
range. It was not possible to unambiguously reveal these small
quantitative changes by using qualitative detection techniques such as
in situ hybridization. Changes in gene expression that are
in higher ranges can, however, be detected with in situ
hybridization. To document this, whole-mount in situ
hybridization was carried out for transcripts of Hsp22
(19-fold increase), Hsp26 (14-fold increase), and
DnaJ-1 (6-fold increase) (Fig.
). In all three cases, in
situ hybridization revealed clear increases in hybridization
signal after heat shock.
To verify the differential expression levels in response to heat shock
and also to confirm differential expression values in the 1.5- to
3-fold range, semiquantitative RT-PCR was performed on selected genes.
Changes in expression levels were determined for eight genes that
showed differences in expression level after heat shock, namely
Hsp67Bc, Hsp27, anon-23Da,
kay, Ten-m, Cdc37, kiwi,
and FK506-bp2 and also, as a control, for the gene
Rac2, which is not heat shock regulated. These experiments
show that the changes in relative expression level as measured by
RT-PCR are comparable to the data obtained with oligonucleotide arrays
(Table 2).
| Table 2Comparison of change folds between oligonucleotide arrays
and
RT-PCR |
Taken together, these results demonstrate that oligonucleotide arrays
have the potential to analyze the relative expression levels of
hundreds of known genes in a complex RNA sample of the multicellular
Drosophila embryo. In addition, they allow a quantitative
assessment of differential gene expression under normal vs. heat-shock
conditions. Thus, the oligonucleotide probe arrays used in our study
establish highly reproducible transcript images of
Drosophila embryos and allow accurate comparisons of changes
in gene expression under different environmental conditions. In this
respect, they complement the DNA microarray technique that has recently
been used to study gene expression during metamorphosis in
Drosophila ( 29). With the completion of whole genome
sequence data for Drosophila ( 2), it will now be possible to
expand quantitative transcript imaging to include all functional genes
and set the stage for a complete genomic analysis of expression
profiles in normal and environmentally or genetically manipulated
Drosophila embryos. We thank Jan Mous, Adrian Roth, Michel Tessier, Monika Seiler, and
Reto Brem for essential contributions and helpful advice. We are
particularly grateful to Clemens Broger and Martin Neeb (F.
Hoffmann–La Roche) for allowing us to use their race-a
chip analysis software before publication and to Volker Schmid
and Nathalie Yanze for help with the light cycler. This research was
funded by grants from the Swiss National Science Foundation and
European Union Biotech (to H.R.) and by Hoffmann–La Roche. | | RT-PCR | reverse transcriptase–PCR | | | Avg Diff | average
difference value |
1. The C. elegans Consortium. Science. 1998;282:2012–2018. [PubMed] 2. Adams M D, Celniker S E, Holt R H, Evans C A, Gocayne J D, Amanatides P G, Scherer S E, Li P W, Hoskins R A, Galle R F. Science. 2000;287:2185–2195. [PubMed] 3. Granjeaud S, Bertucci F, Jordan B R. BioEssays. 1999;21:781–790. [PubMed] 4. Lipshutz R J, Fodor S P, Gingeras T R, Lockhart D J. Nat Genet. 1999;21:20–24. [PubMed] 5. Lockhart D J, Dong H, Byrne M C, Follettie M T, Gallo M V, Chee M S, Mittmann M, Wang C, Kobayashi M, Horton H. Nat Biotechnol. 1996;14:1675–1680. [PubMed] 6. Lashkari D A, DeRisi J L, McCusker J H, Namath A F, Gentile C, Hwang S Y, Brown P O, Davis R W. Proc Natl Acad Sci USA. 1997;94:13057–13062. [PubMed] 7. Akam M. Development (Cambridge, UK). 1987;101:1–22. [PubMed] 8. Pankratz M J, Jäckle H. In: The Development of Drosophila melanogaster. Bate M, Martinez-Arias A, editors. Vol. 1. Plainview, New York: Cold Spring Harbor Lab. Press; 1993. pp. 467–516. 9. Campos-Ortega J, Hartenstein V. The Embryonic Development of Drosophila melanogaster. Heidelberg: Springer; 1997. pp. 9–102. 10. Nover L, Scharf K D. Cell Mol Life Sci. 1997;53:80–103. [PubMed] 11. Walter M F, Petersen N S, Biessmann H. Dev Genet. 1990;11:270–279. [PubMed] 12. Mahadevappa M, Warrington J A. Nat Biotechnol. 1999;17:1134–1136. [PubMed] 13. Certa, U., de Saizieu, A. & Mous, J. (2000) Methods Mol.
Biol., in press. 14. Tautz D, Pfeifle C. Chromosoma. 1989;98:81–85. [PubMed] 15. Lindquist S, Craig E A. Annu Rev Genet. 1988;22:631–677. [PubMed] 16. Schlesinger M J. J Biol Chem. 1990;265:12111–12114. [PubMed] 17. Pauli D, Tissières A. In: Stress Proteins in Biology and Medicine. Morimoto R, Tissières A, Georgopoulos C, editors. Plainview, New York: Cold Spring Harbor Lab. Press; 1990. pp. 361–378. 18. Michaud S, Marin R, Tanguay R M. Cell Mol Life Sci. 1997;53:104–113. [PubMed] 19. Haass C, Klein U, Kloetzel P M. J Cell Sci. 1990;96:413–418. [PubMed] 20. Vazquez J, Pauli D, Tissières A. Chromosoma. 1993;102:233–248. [PubMed] 21. Craig E A, Ingolia T D, Manseau L J. Dev Biol. 1983;99:418–426. [PubMed] 22. Rubin D M, Mehta A D, Zhu J, Shoham S, Chen X, Wells Q R, Palter K B. Gene. 1993;128:155–163. [PubMed] 23. Ferrante A W, Jr, Reinke R, Stanley E R. Proc Natl Acad Sci USA. 1995;92:1911–1915. [PubMed] 24. Cutforth T, Rubin G M. Cell. 1994;77:1027–1036. [PubMed] 25. Ishikawa T, Igarashi T, Hata K, Fujita T. Biochem Biophys Res Commun. 1999;254:566–571. [PubMed] 26. Wang X Z, Kuroda M, Sok J, Batchvarova N, Kimmel R, Chung P, Zinszner H, Ron D. EMBO J. 1998;17:3619–3630. [PubMed] 27. Henning K A, Peterson C, Legerski R, Friedberg E C. Nucleic Acids Res. 1994;22:257–261. [PubMed] 28. Kraemer C, Weil B, Christmann M, Schmidt E R. Gene. 1998;216:267–276. [PubMed] 29. White K P, Rifkin S A, Hurban P, Hogness D S. Science. 1999;286:2179–2184. [PubMed]
|
This article has been 
