• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of neoplasiaLink to Publisher's site
Neoplasia. Oct 2006; 8(10): 843–850.
PMCID: PMC1715926

Expression of Calcium-Binding Proteins S100A2 and S100A4 in Barrett's Adenocarcinomas1,2

Abstract

In this study, we investigated the mRNA and protein expression of S100A2 and S100A4 in adenocarcinomas of the stomach and esophagus. Real-time reverse transcription-polymerase reaction analysis on 72 tumors revealed frequent overexpression of S100A2 and S100A4 in Barrett's adenocarcinomas (BAs) (P < .01). Immunohistochemical analysis on tumor tissue microarrays that contained 187 tumors showed absent to weak staining for S100A2 in all normal gastric mucosa samples, whereas normal esophageal mucosa samples demonstrated moderate to strong nuclear staining. Contrary to the nuclear expression of S100A2 in normal esophageal mucosa, two thirds of Barrett's dysplasia and BAs that overexpressed S100A2 demonstrated stronger cytosolic staining than nuclear staining (P < .001). Overexpression of S100A2 protein was more frequently seen in well-differentiated tumors than in others (P = .02). Moderate to strong staining of S100A4 was detected in two thirds of tumors and was frequently observed in the presence of Barrett's esophagus (P = .02). Similar to S100A2, the expression of S100A4 was predominantly cytosolic in two thirds of the tumors (P = .001). There was a significant correlation between S100A4 overexpression and lymph node metastasis (N2–N4) (P = .027). These results demonstrate frequent cytosolic overexpression of S100A2 and S100A4 in BAs. Further studies are ongoing to understand the biological significance of these S100A proteins in Barrett's tumorigenesis.

Keywords: S100A proteins, Barrett's, stomach, adenocarcinomas, overexpression

Introduction

A sharp increase in the incidence of gastroesophageal and lower esophageal adenocarcinomas has been observed over the past three decades [1]. Gastroesophageal reflux disease (GERD) is a major health problem, with a prevalence of 5% to 7% in the general population [2,3]. Approximately 10% of patients with chronic GERD develop a metaplastic condition in which the normal squamous epithelium of the distal esophagus is replaced by a columnar epithelium with goblet cells, known as Barrett's esophagus (BE). In the setting of continued injury as a result of GERD, BE is a serious premalignant lesion that can ultimately progress from metaplasia to dysplasia and, subsequently, to Barrett's adenocarcinoma (BA), which affects the lower esophagus and can extend to the gastroesophageal junction (GEJ) [4–6]. Over the past few years, BA has shown the fastest rising incidence among all cancers in the western world [7–12]. These tumors are characterized by complex molecular alterations and chromosomal instability [13,14].

S100 proteins regulate intracellular processes such as cell growth and motility, cell cycle regulation, transcription, and differentiation [15]. A unique feature of these proteins is that individual members are localized in specific cellular compartments from which some are able to relocate on Ca2+ activation, transducing Ca2+ signal in a temporal and spatial manner by interacting with different targets specific for each S100 protein [15–17]. Some members are even secreted from cells exerting extracellular cytokine-like activities, in part through the surface receptor RAGE (receptor for advanced glycation end products), with paracrine effects (e.g., on neurons), promoting their survival during development or after injury [18]. Many S100 proteins show remarkably cell-specific and tissue-specific expression patterns, pointing toward high specification. S100 calcium-binding proteins are of major interest because of their deregulated expression in human diseases. The cluster organization of S100 genes is located on human chromosome 1q21. We and others have shown frequent rearrangement of 1q21 in several tumors, including adenocarcinomas of the stomach and esophagus [13–15,18–20].

In this study, we have analyzed the mRNA and protein expression of S100A2 and S100A4 genes in a large number of tumors, which included adenocarcinomas of the stomach and lower esophagus.

Materials and Methods

Tissue Samples

Paraffin-embedded tissue blocks from 187 patients with lower esophageal, GEJ, gastric (antrum, body, and cardia), and upper gastrointestinal carcinomas (UGCs) were available for immunohistochemistry (IHC) analysis. In addition, six samples with Barrett's dysplasia were also available. The average age of patients was 61.7 years (range, 25–86 years), and the male/female sex ratio was 3.18:1. In addition, frozen tissue samples from 72 gastric, GEJ, and lower esophageal tumors, and from 20 normal gastric epithelial samples were dissected for optimal tissue content (> 70%) and used for mRNA extraction, cDNA synthesis, and subsequent quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) assays. All tissue samples were collected in accordance with Institutional Review Board-approved protocols. Tumor grading was performed according to World Health Organization standards. All cases were reviewed by our pathologists (S.M.H. and C.A.M.).

Tissue Microarrays

Tissues were stained with hematoxylin and eosin, and representative regions were selected for inclusion in a tissue array. Four cores from each case were of a diameter of 0.6 mm and were retrieved from selected regions of donor blocks and punched to the recipient block using a manual tissue array instrument (Beecher Instruments, Silver Spring, MD). Control samples from normal epithelial specimens were punched in each sample row. A tissue microarray of normal samples was also constructed. Specimens for controls consisted of 9 normal esophageal squamous samples and 10 glandular epithelial samples. The resulting tissue microarray was used for IHC analysis. All tumors and normal gastric mucosal epithelial tissues were histologically verified. The adenocarcinomas were collected from the stomach, GEJ, and lower esophagus; ranged from well-differentiated to poorly differentiated; and ranged from stages I to IV, with a mix of intestinal and diffuse-type tumors.

IHC

Tissue microarray sections cut at 5 µm were transferred to polylysine-coated slides (SuperFrostPlus; Menzel-Gläser, Braunschweig, Germany) and incubated at 37°C for 2 hours. Slides were deparaffinized and rehydrated through xylenes and descending concentrations of ethanol/water. All slides were quenched for 5 minutes in a 3% hydrogen peroxide solution in methanol to block endogenous peroxidase. The slides were immersed in 10mMcitrate buffer (pH6.0) and heated in a 1200-W microwave oven at the highest power setting. Evaporated liquid was replenished at 5 minutes and then heated on high for an additional 5 minutes. The slides were left in the buffer for an additional 10 minutes before removal. The antibodies used were mouse monoclonal antibody to S100A2 (DAK-S100A2/1; DAKO, Glostrup, Denmark) and rabbit polyclonal antibody to S100A4 (S100A4 Ab-8; Neomarkers, Inc., Fremont, CA). Immunostaining was performed by a Ventana ES automated slide stainer (Ventana Medical Systems, Inc., Tucson, AZ) using diluted antibody solution (1:50 for S100A2; 1:200 for S100A4) during a 32-minute incubation at 37°C. Antibody binding was visualized using the streptavidin-peroxidase technique (Ventana iVIEW DAB detection kit; Ventana Medical Systems, Inc.) followed by incubation with 3,3′-diaminobenzidine tetrahydrochloride. The slides were counterstained with hematoxylin and mounted with DEPEX. Negative controls consisted of identically treated histologic sections, except for the addition of primary antibody. All stains were evaluated independently by two authors who were blinded to the clinicopathological features associated with the specimen. Cases with discordant results were reviewed simultaneously for consensus opinion. For all antibodies used in this study, a case was considered negative on tumor tissue microarray only if all four cores were negative. Cores with no evidence of nuclear or cytosolic staining, or those with evidence of only rare scattered positive cells (< 3%) were recorded as negative. Immunohistochemical results were evaluated for the intensity and frequency of staining of nuclear and cytosolic components, and for the intensity and frequency of staining as a whole. The intensity of staining was graded as 0 = negative, 1 = weak, 2 = moderate, and 3 = strong. The frequency was graded from 0 to 4 by the percentage of positive cells, as follows: grade 0, < 3%; grade 1, 3% to 25%; grade 2, 25% to 50%; grade 3, 50% to 75%; grade 4, > 75%. The index score is the product of the intensity and frequency grades, which was then binned into a four-point scale: index score 0 = product 0; index score 1 = products 1 and 2; index score 2 = products 3 and 4; index score 3 = products 6 to 12. Index score 2 or 3 was determined as the overexpression of proteins. Immunohistochemically stained tumor tissue microarrays were analyzed under a digital microscope (Nikon Instech Co., Ltd, Tokyo, Japan).

Quantitative Real-Time RT-PCR

mRNA was isolated using the RNeasy kit (Qiagen Gmbh, Hilden, Germany), then single-stranded cDNA was subsequently synthesized using the Advantage RT-for-PCR Kit (Clontech, Palo Alto, CA). Quantitative real-time RT-PCR was performed using 72 frozen tissue samples of lower esophageal, GEJ, and gastric adenocarcinoma samples, and 20 normal gastric mucosal samples, using an iCycler (Bio-Rad, Hercules, CA). Threshold cycle number was determined using iCycler software (version 3.0; Bio-Rad), as described earlier [21]. The primers used for real-time RT-PCR were obtained from GeneLink (Hawthorne, NY). The sequences for the S100A2 primers are 5′ GAACTTCTGCACAAGGAGCTG 3′ (forward) and 5′ GACAGTGATGAGTGCCAGGA 3′ (reverse). The sequences for the S100A4 primers are 5′ CCACAAGTACTCGGGCAAAG 3′ (forward) and 5′ GTCCCTGTTGCTGTCCAAGT 3′ (reverse). Reactions were performed in duplicate, and threshold cycle numbers were averaged. A single melt curve peak was observed for each sample used in data analysis, thus confirming the purity and specificity of all amplified products. The results for S100A2 and S100A4 were normalized to HPRT1, which had minimal variation in all normal and neoplastic gastric samples tested. The fold expression in tumors (compared with that in normal samples) was calculated and normalized with HPRT1 values according to the formula: 2(Rt - Et)/2(Rn - En), as described elsewhere [21], where Rt is the threshold cycle number for the reference gene observed in the tumor, Et is the threshold cycle number for the experimental gene observed in the tumor, Rn is the threshold cycle number for the reference gene observed in the normal sample, and En is the threshold cycle number for the experimental gene observed in the normal sample. Rn and En values were averaged from the 20 normal mucosa samples. Each tumor sample was compared to the 20 normal samples. The relative fold expression in tumors with a standard error of themean (± SEM) is shown in Figure 1.

Figure 1
High levels of (A) S100A2 and (B) S100A4 mRNA expression in esophageal, GEJ, and gastric adenocarcinomas. Quantitative real-time RT-PCR analysis was performed on 72 lower esophageal, GEJ, and gastric adenocarcinoma samples using iCycler (Bio-Rad), in ...

Statistical Analysis

Frequencies and other summary statistics were calculated. Chi-square tests of association were performed to examine potential relationships between expression levels through PCR and IHC, and between parameters of demographic, clinical, or pathological nature.

Results

Overexpression of S100A2 and S100A4 mRNA in Tumors Versus Normal Mucosa

Quantitative real-time PCR analysis revealed mRNA overexpression of S100A2 in 54% (39 of 72) and overexpression of S100A4 in 28% of all tumors (Figure 1). The overexpression of S100A2 and S100A4 was more frequently seen in BAs of the GEJ and lower esophagus than in stomach tumors (74% vs 41%, P = .01; and 39% vs 19%, P = .069, respectively). Interestingly, most of the tumors that overexpressed S100A4 also overexpressed S100A2 (16 of 19, 84%) (P < .01) (Figure 1).

Overexpression of S100A2 and S100A4 Proteins in Tumors

The IHC for S100A2 showed moderate to strong immunostaining in normal esophageal squamous epithelium samples. S100A2 immunoreactivity was observed homogenously in all cells throughout the epithelium, including basal layer cells, and staining intensity was stronger in nuclei. The normal glandular epithelium of the stomach had absent to low immunostaining for S100A2, and the expression was mainly in the deeper—not in the superficial—glandular epithelium. The IHC indicated the absence of S100A4 protein expression in all normal squamous or glandular epithelia (Figures 2 and and33).

Figure 2
Immunohistochemical analysis for the S100A2 protein. (A) Normal gastric glandular epithelium shows no immunoreactivity. (B) Normal esophageal squamous epithelium shows moderate staining (score 2) with predominant nuclear localization (inset: original ...
Figure 3
Immunohistochemical analysis for the S100A4 protein. (A and B) Immunostaining for S100A4 shows no immunoreactivity in normal esophageal squamous epithelium (A: original magnification, x100; B: original magnification, x200). (C and D) Normal gastric glandular ...

Six of seven Barrett's dysplasia samples showed moderate to strong immunoreactivity for S100A2, with a predominant cytosolic expression pattern similar to that seen in BAs (Figure 2, C and D). Moderate to strong immunostaining of S100A2 protein was observed in 122 of 187 (65%) of UGCs (Figure 2). There was no statistically significant relationship between the immunostaining of S100A2 and clinicopathological variables, including gender, tumor location, presence of BE, histologic grade, involvement of lymph node, or tumor stage (Table 1). Together, these results may indicate that expression of S100A2 may be an important and early step in UGC tumorigenesis. Interestingly, there was a translocation of S100A2 expression from a predominantly nuclear staining in normal esophageal tissues to a strong cytosolic staining in the majority of adenocarcinomas. Although all normal esophageal mucosae revealed a nuclear predominance of S100A2 protein expression (Figure 2B), only 11% of BAs showed nuclear predominance. Almost all tumors overexpressing S100A2 (89%) showed equivalent cytosolic and nuclear expressions or cytosolic predominance. Predominant cytosolic expression was observed in 65% of BAs that showed S100A2 overexpression (P < .01) (Figure 2). The S100A4 protein was not expressed in normal squamous or columnar epithelia, except for focal weak nuclear and/or cytosolic staining of some scattered stromal and inflammatory cells (Figure 3). Unlike normal mucosa samples, UGCs demonstrated moderate to strong staining in 67% (124 of 185) of tumors. The overexpression of S100A4 was more frequently observed in BAs than in gastric (antrum, body, and cardia) adenocarcinomas (P = .013) (Table 1 and Figure 3).

Table 1
Summary of the IHC Analysis of S100A2 and S100A4 in 187 Tumors.

Discussion

Several pathological disorders, including cancer, are linked to altered Ca2+ homeostasis and might involve multifunctional S100 proteins, which are expressed in a cell-specific and tissue-specific manner. The role of calcium-binding proteins in carcinogenesis has drawn a complex picture showing downregulation or overexpression in different tumors [15, 17,22–24]. The biologic function of several S100A proteins in carcinogenesis has not been fully elucidated to date. In this study, we have shown frequent mRNA and protein overexpression of S100A2 and S100A4 in BAs of the GEJ and lower esophagus. The mechanisms by which S100 proteins act as tumor promoters or suppressors differ widely. In particular, the role of S100A2 in carcinogenesis draws a more complex picture. S100A2 was originally described as a tumor suppressor because reduced levels of S100A2 were detected in squamous cell lung carcinoma and breast cancer [25–27]. However, several studies have shown that S100A2 is highly expressed in tumors such as ovarian cancer, esophageal squamous cell carcinoma, and non-small cell lung cancer [22,23,28,29]. We have detected S100A2 overexpression at both mRNA and protein levels in lower esophageal, GEJ, and gastric adenocarcinomas. A recent study has shown that S100A2 is a novel downstream mediator of DeltaNp63 oncogenic activity [30]. However, in most cases, the function of S100 proteins in cancer cells is still unknown, and specific expression patterns of these proteins can be used as a valuable prognostic tool. We have found overexpression of the S100A2 protein in almost all samples of Barrett's dysplasia. We could not observe a trend for lymph node involvement in adenocarcinomas overexpressing S100A2. A study of S100A2-overexpressing esophageal squamous cell carcinoma showed a similar trend toward preferentially developing lymph node metastases and distant metastases (P = .111 and .178, respectively) [23]. Similarly, immunohistochemical analyses of 94 primary lung adenocarcinomas showed that positive S100A2 expression was significantly associated with lymphatic invasion (P = .0233) [31]. The S100A2 expression was predominantly cytosolic in Barrett's dysplasia and adenocarcinoma. In contrast, we noted a predominant nuclear localization of the S100A2 protein in normal squamous epithelial cells. This finding is also supported by other immunolocalization studies showing that the S100A2 protein is preferably located in the nucleus in normal tissues [17,32,33]. A similar relocation of S100A2 from the nucleus to the cytoplasm was observed in cultured normal human keratinocytes when cells were treated with H2O2 or exposed to an ionophore-dependent increase in intracellular calcium [34]. The interaction between nuclear S100A2 and p53 has been recently reported, where overexpression of S100A2 increases the transcriptional activity of p53 [35]. The observed translocation of S100A2 from the nucleus to the cytoplasm in Barrett's dysplasia and adenocarcinomas may indicate a change in the level of the S100A2-mediated transcription activity of p53 and suggest an oncogenic potential of cytoplasmic S100A2. Therefore, the change of localization of the S100A2 protein may be a reflection of a change in function and biological outcome that needs to be investigated further.

We found that overexpression of the S100A4 protein was significantly related to GEJ and lower esophageal BAs. IHC staining for S100A4 was absent in both normal esophageal squamous epithelium and normal gastric columnar epithelium. We also observed a predominant cytosolic localization of the S100A4 protein in GEJ and lower esophageal adenocarcinomas. Interestingly, there was a strong statistical correlation (P = .03) between overexpression of S100A4 protein and advanced lymph node metastasis (N2–N4). These tumors, compared with other histologic subtypes, are characterized by poor outcome. A number of clinical studies showed a correlation between S100A4 expression and worse prognostic outcome in a variety of human cancers, confirming the importance of S100A4 in cancer progression [16,29,36–40]. Overexpression of S100A4 correlates with lymph node metastasis in colorectal cancers [36]. In breast cancer, S100A4 expression is a potential predictor of metastasis and survival in early-stage tumors [35]. As a typical member of the S100 protein family, S100A4 exhibits dual extracellular and intracellular functions. The intracellular S100A4 protein could interfere with vital cellular functions such as cell motility, invasion, cell division, and survival [41,42]. Interestingly, a strong inverse relationship was found between S100A4 and p53 expression [31]. Despite the relationship between the expression of S100A4 and the poor outcome, the actual mechanism of S100A4's tumor-promoting function remains poorly investigated [18].

In summary, we have demonstrated high mRNA and protein expression levels of S100A2 and S100A4 in BAs. Our results suggest that the cytosolic localization of S100A proteins in adenocarcinomas may reflect a change of Ca2+ homeostasis that occurs in connection with BE and tumor differentiation. The frequent overexpression of these proteins, together with a change in their cellular localization, indicates that these proteins may play a critical role during Barrett's tumorigenesis.

Footnotes

1This work was supported by National Cancer Institute grants R01CA106176 (W.E.) and R01CA93999 (W.E.) and Digestive Disease Research Center (DK058404).

2The contents of this work are solely the responsibility of the authors and do not necessarily represent the official views of the National Cancer Institute or the University of Vanderbilt.

References

1. Devesa SS, Blot WJ, Fraumeni JF., Jr Changing patterns in the incidence of esophageal and gastric carcinoma in the United States. Cancer. 1998;83:2049–2053. [PubMed]
2. Dulai GS, Guha S, Kahn KL, Gornbein J, Weinstein WM. Preoperative prevalence of Barrett's esophagus in esophageal adenocarcinoma: a systematic review. Gastroenterology. 2002;122:26–33. [PubMed]
3. Cameron AJ, Lagergren J, Henriksson C, Nyren O, Locke GR, III, Pedersen NL. Gastroesophageal reflux disease in monozygotic and dizygotic twins. Gastroenterology. 2002;122:55–59. [PubMed]
4. Rana PS, Johnston DA. Incidence of adenocarcinoma and mortality in patients with Barrett's oesophagus diagnosed between 1976 and 1986: implications for endoscopic surveillance. Dis Esophagus. 2000;13:28–31. [PubMed]
5. O'Connor JB, Falk GW, Richter JE. The incidence of adenocarcinoma and dysplasia in Barrett's esophagus: report on the Cleveland Clinic Barrett's Esophagus Registry. Am J Gastroenterol. 1999;94:2037–2042. [PubMed]
6. Ferraris R, Bonelli L, Conio M, Fracchia M, Lapertosa G, Aste H. Incidence of Barrett's adenocarcinoma in an Italian population: an endoscopic surveillance programme. Gruppo Operativo per lo Studio delle Precancerosi Esofagee (GOSPE) Eur J Gastroenterol Hepatol. 1997;9:881–885. [PubMed]
7. el-Serag HB. The epidemic of esophageal adenocarcinoma. Gastroenterol Clin North Am. 2002;31:421–440. (viii) [PubMed]
8. Todd JA, Johnston DA, Dillon JF. The changing spectrum of gastroesophageal reflux disease. Eur J Cancer Prev. 2002;11:215–219. [PubMed]
9. van Soest EM, Dieleman JP, Siersema PD, Sturkenboom MC, Kuipers EJ. Increasing incidence of Barrett's oesophagus in the general population. Gut. 2005;54:1062–1066. [PMC free article] [PubMed]
10. Hamilton SR, Smith RR, Cameron JL. Prevalence and characteristics of Barrett esophagus in patients with adenocarcinoma of the esophagus or esophagogastric junction. Hum Pathol. 1988;19:942–948. [PubMed]
11. Phillips RW, Wong RK. Barrett's esophagus. Natural history, incidence, etiology, and complications. Gastroenterol Clin North Am. 1991;20:791–816. [PubMed]
12. Blot WJ, Devesa SS, Fraumeni JF., Jr Continuing climb in rates of esophageal adenocarcinoma: an update. JAMA. 1993;270:1320. [PubMed]
13. El-Rifai W, Frierson HJ, Moskaluk C, Harper J, Petroni G, Bissonette E, Knuutila S, Powell S. Genetic differences between adenocarcinomas arising in Barrett's esophagus and gastric mucosa. Gastroenterology. 2001;121:592–598. [PubMed]
14. El-Rifai W, Powell S. Molecular and biologic basis of upper gastrointestinal malignancy gastric carcinoma. Surg Oncol Clin North Am. 2002;11:273–291. [PubMed]
15. Heizmann CW, Fritz G, Schafer BW. S100 proteins: structure, functions and pathology. Front Biosci. 2002;7:d1356–d1368. [PubMed]
16. Mazzucchelli L. Protein S100A4: too long overlooked by pathologists? Am J Pathol. 2002;160:7–13. [PMC free article] [PubMed]
17. Mueller A, Bachi T, Hochli M, Schafer BW, Heizmann CW. Subcellular distribution of S100 proteins in tumor cells and their relocation in response to calcium activation. Histochem Cell Biol. 1999;111:453–459. [PubMed]
18. Marenholz I, Heizmann CW, Fritz G. S100 proteins in mouse and man: from evolution to function and pathology (including an update of the nomenclature) Biochem Biophys Res Commun. 2004;322:1111–1122. [PubMed]
19. Schafer BW, Wicki R, Engelkamp D, Mattei MG, Heizmann CW. Isolation of a YAC clone covering a cluster of nine S100 genes on human chromosome 1q21: rationale for a new nomenclature of the S100 calcium-binding protein family. Genomics. 1995;25:638–643. [PubMed]
20. Watson PH, Leygue ER, Murphy LC. Psoriasin (S100A7) Int J Biochem Cell Biol. 1998;30:567–571. [PubMed]
21. El-Rifai W, Moskaluk CA, Abdrabbo MK, Harper J, Yoshida C, Riggins GJ, Frierson HF, Jr, Powell SM. Gastric cancers overexpress S100A calcium-binding proteins. Cancer Res. 2002;62:6823–6826. [PubMed]
22. Heighway J, Knapp T, Boyce L, Brennand S, Field JK, Betticher DC, Ratschiller D, Gugger M, Donovan M, Lasek A, et al. Expression profiling of primary non-small cell lung cancer for target identification. Oncogene. 2002;21:7749–7763. [PubMed]
23. Imazawa M, Hibi K, Fujitake S, Kodera Y, Ito K, Akiyama S, Nakao A. S100A2 overexpression is frequently observed in esophageal squamous cell carcinoma. Anticancer Res. 2005;25:1247–1250. [PubMed]
24. Kao JP, Alderton JM, Tsien RY, Steinhardt RA. Active involvement of Ca2+ in mitotic progression of Swiss 3T3 fibroblasts. J Cell Biol. 1990;111:183–196. [PMC free article] [PubMed]
25. Feng G, Xu X, Youssef EM, Lotan R. Diminished expression of S100A2, a putative tumor suppressor, at early stage of human lung carcinogenesis. Cancer Res. 2001;61:7999–8004. [PubMed]
26. Nagy N, Brenner C, Markadieu N, Chaboteaux C, Camby I, Schafer BW, Pochet R, Heizmann CW, Salmon I, et al. S100A2, a putative tumor suppressor gene, regulates in vitro squamous cell carcinoma migration. Lab Invest. 2001;81:599–612. [PubMed]
27. Nagy N, Hoyaux D, Gielen I, Schafer BW, Pochet R, Heizmann CW, Kiss R, Salmon I, Decaestecker C. The Ca2+-binding S100A2 protein is differentially expressed in epithelial tissue of glandular or squamous origin. Histol Histopathol. 2002;17:123–130. [PubMed]
28. Hough CD, Cho KR, Zonderman AB, Schwartz DR, Morin PJ. Coordinately up-regulated genes in ovarian cancer. Cancer Res. 2001;61:3869–3876. [PubMed]
29. Rudland PS, Platt-Higgins A, Renshaw C, West CR, Winstanley JH, Robertson L, Barraclough R. Prognostic significance of the metastasis-inducing protein S100A4 (p9Ka) in human breast cancer. Cancer Res. 2000;60:1595–1603. [PubMed]
30. Hibi K, Fujitake S, Takase T, Kodera Y, Ito K, Akiyama S, Shirane M, Nakao A. Identification of S100A2 as a target of the DeltaNp63 oncogenic pathway. Clin Cancer Res. 2003;9:4282–4285. [PubMed]
31. Matsubara D, Niki T, Ishikawa S, Goto A, Ohara E, Yokomizo T, Heizmann CW, Aburatani H, Moriyama S, et al. Differential expression of S100A2 and S100A4 in lung adenocarcinomas: clinicopathological significance, relationship to p53 and identification of their target genes. Cancer Sci. 2005;96:844–857. [PubMed]
32. Deshpande R, Woods TL, Fu J, Zhang T, Stoll SW, Elder JT. Biochemical characterization of S100A2 in human keratinocytes: subcellular localization, dimerization, and oxidative cross-linking. J Invest Dermatol. 2000;115:477–485. [PubMed]
33. Mandinova A, Atar D, Schafer BW, Spiess M, Aebi U, Heizmann CW. Distinct subcellular localization of calcium binding S100 proteins in human smooth muscle cells and their relocation in response to rises in intracellular calcium. J Cell Sci. 1998;111((Pt 14)):2043–2054. [PubMed]
34. Moore BW. A soluble protein characteristic of the nervous system. Biochem Biophys Res Commun. 1965;19:739–744. [PubMed]
35. Mueller A, Schafer BW, Ferrari S, Weibel M, Makek M, Hochli M, Heizmann CW. The calcium-binding protein S100A2 interacts with p53 and modulates its transcriptional activity. J Biol Chem. 2005;280:29186–29193. [PubMed]
36. Cho YG, Nam SW, Kim TY, Kim YS, Kim CJ, Park JY, Lee JH, Kim HS, Lee JW, et al. Overexpression of S100A4 is closely related to the aggressiveness of gastric cancer. APMIS. 2003;111:539–545. [PubMed]
37. Lee WY, Su WC, Lin PW, Guo HR, Chang TW, Chen HH. Expression of S100A4 and Met: potential predictors for metastasis and survival in early-stage breast cancer. Oncology. 2004;66:429–438. [PubMed]
38. Gongoll S, Peters G, Mengel M, Piso P, Klempnauer J, Kreipe H, von Wasielewski R. Prognostic significance of calcium-binding protein S100A4 in colorectal cancer. Gastroenterology. 2002;123:1478–1484. [PubMed]
39. Kimura K, Endo Y, Yonemura Y, Heizmann CW, Schafer BW, Watanabe Y, Sasaki T. Clinical significance of S100A4 and E-cadherin-related adhesion molecules in non-small cell lung cancer. Int J Oncol. 2000;16:1125–1131. [PubMed]
40. Nakamura T, Ajiki T, Murao S, Kamigaki T, Maeda S, Ku Y, Kuroda Y. Prognostic significance of S100A4 expression in gallbladder cancer. Int J Oncol. 2002;20:937–941. [PubMed]
41. Grigorian M, Andresen S, Tulchinsky E, Kriajevska M, Carlberg C, Kruse C, Cohn M, Ambartsumian N, Christensen A, et al. Tumor suppressor p53 protein is a new target for the metastasis-associated Mts1/S100A4 protein: functional consequences of their interaction. J Biol Chem. 2001;276:22699–22708. [PubMed]
42. Kriajevska MV, Cardenas MN, Grigorian MS, Ambartsumian NS, Georgiev GP, Lukanidin EM. Non-muscle myosin heavy chain as a possible target for protein encoded by metastasis-related mts-1 gene. J Biol Chem. 1994;269:19679–19682. [PubMed]

Articles from Neoplasia (New York, N.Y.) are provided here courtesy of Neoplasia Press
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...