![]() | ![]() |
Formats:
|
||||||||||||||||
Copyright © 2006, American Society for Microbiology The Bad Guy Cooperates with Good Cop p53: Bad Is Transcriptionally Up-Regulated by p53 and Forms a Bad/p53 Complex at the Mitochondria To Induce Apoptosis Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230026, People's Republic of China,1 Department of Molecular and Cell Biology, School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551, Singapore2 *Corresponding author. Mailing address: School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027, People's Republic of China. Phone: 86-551-3607324. Fax: 86-551-3606264. E-mail: wumian/at/ustc.edu.cn. †These authors contributed equally to this work. Received June 8, 2006; Revised July 7, 2006; Accepted September 8, 2006. This article has been cited by other articles in PMC.Abstract Although the regulation of several Bcl-2 family molecules, including Puma, Noxa, Bax, and Bid, by p53 has been studied intensively, the interplay between Bad (Bcl-2 antagonist of cell death) and p53 has not yet been reported thus far. Here, we report that p53 activates Bad transcription and expression through binding to a short conserved sequence located approximately 6.6 kb upstream of the translation start point. We also demonstrate that Bad physically interacts with cytoplasmic p53, thereby preventing p53 from entering the nucleus and resulting in reduced transcription of Bad. Moreover, Bad is able to direct p53 to the mitochondria and forms a p53/Bad complex at the mitochondria. Two lines of evidences support this hypothesis: first, when mitochondria purified from p53-deficient H1299 cells are incubated with p53 and either wild-type (wt) Bad or mutant Bad (this mutant binds p53 yet is unable to migrate to mitochondria), p53 can be detected only in mitochondria incubated with wt Bad and not in those incubated with mutant Bad; second, knockdown of Bad expression reduces mitochondrial localization of p53. The mitochondrial p53/Bad complex promotes apoptosis via activation and oligomerization of Bak. Elimination of Bad expression by RNA interference notably attenuates apoptosis induced by etoposide. Hence, our collective data provide the first evidence that Bad plays dual roles in both p53 transcription-dependent and -independent pathways. Bad (Bcl-2 antagonist of cell death), a member of the Bcl-2 protein family, is a positive regulator of cell death and is localized in the cytoplasm under physiological conditions. Like other BH3-only proteins, Bad selectively displaces Bax to heterodimerize with Bcl-2 or Bcl-xL while promoting apoptosis (5, 25). The apoptotic activity of Bad is determined largely by its phosphorylation status at serine 112 (Ser112), Ser136, and Ser155 (5). In unstressed cells, Bad is hyperphosphorylated by several protein kinases, including protein kinase A and protein kinase B (AKT), and as a result is held onto by 14-3-3 (7, 11). However, in response to apoptotic stimuli, Bad is rapidly dephosphorylated and migrates to the mitochondria, where it induces cell death. The p53 tumor suppressor is a pivotal mediator of cell cycle arrest and apoptosis in response to diverse stress stimuli. It transactivates various target genes, including those for p21waf1 (9), Bax (16), p53DINP1 (18), Bid (20), Puma (17), and many other proteins (21, 24). However, a steady input of evidence for the transcription-independent function of p53 in apoptosis has been accumulating recently (13, 15). Although a detailed mechanism has not yet been determined, recent data have revealed that upon an apoptotic stimulus, p53 translocates into mitochondria to interact directly with Bcl-2 or Bcl-xL to displace and activate proapoptotic Bax signaling (6, 15). Similarly, disruption of the association complex between Bak/Mcl-1 or Bak/Bcl-2 by p53 is also related to p53-dependent but transcription-independent apoptosis (14). In this study, we have identified a p53-responsive element located approximately 6.6 kb upstream of the ATG translational start codon of the Bad gene and have shown that p53 transcriptionally activates Bad expression through binding to this region. We provide evidence that Bad is part of a negative feedback loop control system serving to maintain the equilibrium level of Bad by reducing p53 nuclear entry. Excess Bad binds to p53 within the cytosol, preventing p53 from entering the nucleus for further transcription of bad. Moreover, we demonstrate that Bad is able to direct p53 to the mitochondria and facilitates the intrinsic mitochondrion-mediated apoptosis through activation and oligomerization of Bak. MATERIALS AND METHODS Reagents and antibodies. The following antibodies were used in this study: monoclonal antibodies anti-Bad, anti-Bax, and anti-Bcl-xL (Santa Cruz Biotechnology, Santa Cruz, CA); anti-p53 (Oncogene, Manhasset, NY); anti-green fluorescent protein (GFP) (BD Biosciences, Palo Alto, CA); anti-Flag (Sigma, St Louis, MO); anti-cytochrome c (R&D Systems, Inc., Minneapolis, MN); anti-β-actin (Abcam, Cambridge, United Kingdom); anti-OxPhosComplex IV subunit IV antibody (COX IV; Molecular Probes, Eugene, Oregon); and anti-β-tubulin (Santa Cruz) and polyclonal antibody anti-Max (Santa Cruz). Hoechst 33342 and etoposide were purchased from Sigma, and 1,6-bismaleimidohexane (BMH) was purchased from Pierce Biotechnology (Rockford, IL). RNA interference (RNAi) and apoptosis assays. A549 (p53+/+) cells were cultured in 12-well plates to subconfluence (3 × 105 cells) and transiently transfected with small interfering RNA (siRNA) against Bad (Cell Signaling Technology, Danvers, Massachusetts) by using Oligofectamine (Invitrogen Cergy Pontoise, France). At 24 h posttransfection, the culture medium was replaced with fresh medium, followed by addition of etoposide at 50 μg/ml. After 24 h and 48 h of incubation, both floating and adherent cells were stained with Hoechst 33342 (2 μg/ml). Microscopic fields were selected randomly, and 10 fields were observed for each slide at a magnification of ×400. The percentages of apoptotic cells among the total number of cells were counted based on the numbers of apoptotic cells characteristic for DNA fragmentation and/or chromatin condensation under fluorescence microscopy. The data collected are the averages and standard deviations from three independent experiments. Subcellular fractionation. Cell fractionation was carried out using a protocol described previously (10). Briefly, cells were homogenized in 20 mM HEPES-KOH (pH 7.5), 10 mM KCl, 1.5 mM MgCl2, 1 mM sodium EDTA, 1 mM sodium EGTA, and 1 mM dithiothreitol in the presence of 250 mM sucrose and protease inhibitor cocktail (Roche Diagnostics, Meylan, France). Homogenates were centrifuged at 500 × g for 5 min at 4°C, and the supernatant was collected and centrifuged again at 10,000 × g for 20 min to obtain cytoplasmic and mitochondrial fractions. The mitochondrial pellet was washed and solubilized in TNC buffer (10 mM Tris acetate [pH 8.0], 0.5% Nonidet P-40, 5 mM CaCl2) containing protease inhibitors. The protein concentration was determined with a Micro-BCA kit (Pierce). ChIP assay. Chromatin immunoprecipitation (ChIP) assay was carried out essentially as described previously (12, 20). Briefly, A549 (p53+/+) (or HeLa) cells were first cross-linked with formaldehyde (final concentration, 1%) for 10 min at room temperature, and then the reaction was stopped with glycine (0.125 M). Nuclei were then isolated and resuspended in lysis buffer (50 mM Tris [pH 8.1], 10 mM EDTA, 1% sodium dodecyl sulfate, and protease inhibitors). The resulting chromatin was mixed with protein A/G-Sepharose beads conjugated either with anti-p53 antibody (Ab-2), or with anti-E2F1 antibody as a negative control. The bound DNA fragments were eluted as described by Hershko and Ginsberg (12) and amplified by PCR. Luciferase reporter gene assay. HeLa cells were transiently transfected with the indicated plasmids by using Lipofectamine 2000 (Invitrogen). A 422-bp DNA fragment containing the potential p53-binding sequence (ACCCAGGCCCTGGCTGGTCCT) was amplified by PCR with primers used in the ChIP assay and was cloned into pGL3-Basic vector (Promega). To construct a mutant vector, six bases (bases 8 to13) starting from the fourth nucleotide (C) within the putative 21-bp p53-binding region (p53-BR) were deleted by PCR-mediated site-directed mutagenesis as described by Song et al. (21a) The luciferase reporter assay was performed according to the manufacturer's instructions (Promega). The quantification of luciferase activities and calculation of relative ratios were carried out manually with a luminometer (Junior LB9509; Berthold Technologies). Transfection efficiency was normalized on the basis of the Renilla luciferase activity. RESULTS p53 transactivates Bad expression. To determine whether p53 regulates the expression of the proapoptotic BH3-only protein Bad, reverse transcription-PCR (RT-PCR) and Western blot analyses were performed to examine the effects of endogenous p53 on Bad expression in A549 (p53+/+) cells treated with etoposide (50 μg/ml). When cells were treated with increasing amount of etoposide (0 to 4 μg/ml), a p53-induced increase in both Bad mRNA and protein levels were found in A549 cells (Fig. 1a and b
p53 directly binds to the upstream region of Bad gene. To understand the mechanism through which the Bad gene is up-regulated by p53, the Genomatix Promoter Inspector software was utilized. Inspection of the Bad promoter with the MatInspector (Genomatrix Inc, Munich, Germany) software revealed a potential 21-bp p53-binding sequence (ACCCAGGCCCTGGCTGGTCCT) located 6,613 bp upstream of the Bad translational start site (Fig. (Fig.2a2a
To test whether p53 can truly bind to this putative response element, a ChIP assay was performed. As shown in Fig. Fig.2b,2b Bad physically interacts with p53. Whether p53 physically interacts with Bad has not yet been reported thus far. We therefore performed coimmunoprecipitation experiments, and the results are shown in Fig. Fig.3a.3a
Bad regulates a negative feedback loop for p53. We next inquired whether a negative feedback loop existed for maintaining a proper balance between the levels of the transcription factor p53 and its transcriptional target Bad. If this feedback regulation was indeed present, we would expect that with increasing accumulation of Bad in the cytoplasm, more p53 should end up retained in the cytoplasm by binding to Bad, which would thus prevent p53 from entering the nucleus for further transcription of Bad. Nuclear fractions were prepared from H1299 (p53−/−) cells cotransfected with an equal amount of p53 and increasing amounts of GFP-Bad. The Western blotting results in Fig. Fig.4a4a
To confirm the inhibitory effects of Bad on p53 transactivation activity, H1299 (p53−/−) cells were transiently cotransfected with a constant amount of the expression plasmid pcDNA3-p53 together with p53-responsive Bad-luciferase (Fig. (Fig.4b),4b Bad directs p53 to mitochondria. To examine whether p53 and Bad colocalize to the mitochondria in response to apoptotic stimuli, plasmids pDsRed-p53, pEGFP-Bad, and pDsRed-p53 plus pEGFP-Bad were transfected into H1299 (p53−/−) cells separately, and their fluorescence distribution patterns were compared. p53 is normally localized in the nucleus, whereas Bad is mainly found diffused across the cytoplasm. However, coexpression of p53 and Bad gave rise to a merged image characteristic of mitochondrial punctiform particles formed at an early apoptotic stage (Fig. 5a and b
To validate whether Bad is truly able to direct p53 to mitochondria, H1299 (p53−/−) cells were cotransfected with a fixed amount of pcDNA3-p53 and an increasing amount of pEGFP-Bad. Nuclear, cytosolic, and mitochondrial fractions were prepared for Western blot analyses. As shown in Fig. Fig.5d,5d To further confirm that Bad-dependent translocation of p53 relies on the mitochondrial targeting of Bad, we constructed a BadΔBH3 mutant, which is known to lose the capability to localize to mitochondria (1, 25). Applying the GST pull-down method, we proved that BadΔBH3 is able to interact with p53 (Fig. (Fig.5e).5e An in vitro experiment was also performed to validate that Bad is able to direct p53 onto the mitochondria. Equal amounts of total isolated mitochondria from p53-deficient H1299 cells were incubated separately with purified Flag-p53 and either Flag-Bad or Flag-BadΔBH3 (which is competent in binding p53 yet is unable to migrate to mitochondria). After incubation, the mixtures were centrifuged, and the resulting soluble and pellet fractions were used for Western blot analysis. As shown in Fig. 5g and h Knockdown of Bad reduces mitochondrial localization of p53 and Bak oligomerization. To verify that endogenous p53 and Bad accumulate on the mitochondria upon etoposide treatment under nonoverexpressing condition, A549 (p53+/+) cells were left untreated or treated with etoposide to allow for the up-regulation of p53, followed by preparation of cytoplasmic, nuclear, and mitochondrial fractions. As indicated in Fig. Fig.6a,6a
We also examined whether the Bad/p53-promoted apoptosis involves Bak oligomerization. A549 (p53+/+) cells were transfected with control siRNA or Bad-specific siRNA duplexes and further treated with or without etoposide (50 μg/ml). Isolated mitochondria were incubated with 1 mM BMH cross-linker and analyzed by Western blot analysis using an anti-Bak antibody. Cells transfected with Bad-specific siRNA displayed considerably less Bak-induced oligomerization than cells transfected with control siRNA (Fig. (Fig.6c,6c Reduction of either p53 or Bad attenuates apoptosis induced by etoposide. In order to evaluate the effects of Bad on p53-induced apoptosis, we eliminated Bad expression in A549 (p53+/+) cells by RNAi (Fig. (Fig.6d).6d DISCUSSION The tumor suppressor p53 regulates the cell cycle and promotes apoptosis in response to cellular stresses through transcription-dependent and transcription-independent mechanisms. Transcriptional activation by p53 is critical for the induction of apoptosis (4). Numerous p53-inducible genes have been identified, such as the Bax (16), Puma (17), Bid (20), and p21waf1 (9) genes and many others. However, none of these candidate effectors alone can account for the complicated mechanisms underlying p53 transcription-dependent apoptotic signaling. It has been demonstrated that p53 was able to translocate from the nucleus into the cytoplasm and even onto the mitochondria during DNA damage-induced and p53-dependent apoptosis in a variety of human and mouse cell systems. The p53 protein can associate with Bcl-xL to release Bid from the Bcl-xL/Bid complex and thereby indirectly activate Bax (1). Moreover, it has been reported that p53 can directly activate Bax to promote mitochondrion-mediated apoptosis (6). Previous data suggest that Bad may contribute to p53-induced mitochondrion-mediated apoptosis, yet no known molecular mechanism has so far been proposed for those observations (2, 3). We have shown here that the proapoptotic gene bad is transcriptionally regulated by p53. Levels of Bad mRNA and protein are increased in response to the up-regulated expression of wt p53 but not with the mutant p53G279E, indicating that Bad induction requires a transactivation-competent p53. We have also noticed that in H1299 (p53−/−) cells, relatively lower levels of both Bad mRNA and protein can be detected. This may suggest the existence of yet unidentified transcriptional factors for regulating Bad expression. In addition, we identified a functional p53-binding element at the human bad genomic loci, residing roughly 6.6 kb upstream of the Bad translation start site ATG. The far-upstream position of the p53-binding element along the Bad promoter could be the reason for its unrecognized status as a potential p53-BR until now. Furthermore, we also found similar well-conserved p53-BRs approximately 7 kb upstream within the murine Bad gene locus (data not shown). Of note, it has been reported that in the human Bid gene, the p53-binding site also resides approximately 6 kb upstream of its ATG translational start site (20). More importantly, we have found that Bad can directly associate with p53. Our unpublished data reveal that, unlike the case for 14-3-3, the p53/Bad interaction appears to be independent of phosphorylation of Bad on Ser112, Ser136, and Ser155 (P. Jiang and M. Wu, unpublished result). Overexpression of Bad in p53-transfected H1299 (p53−/−) cells not only reduces the level of nuclear p53 but also decreases the transcription of Bad mRNA. This negative feedback loop maintains the Bad protein at a physiological level to avoid unnecessary apoptosis in healthy cells. We have also validated that p53 and Bad can cooperatively promote apoptosis induced by the DNA-damaging agent etoposide. Inhibition of Bad expression in A549 (p53+/+) cells by RNA interference results in reduced mitochondrial p53 and an increased resistance to etoposide. Ranger et al. had reported previously that upon treatment with etoposide, Bad+/− mouse embryo fibroblast cells showed much more pronounced apoptosis than Bad−/− mouse embryo fibroblast cells (19). However, they had not indicated that p53 is involved in this process. Thus, our data partially suggest, for the first time, the possible underlying mechanism. In summary, we suggest a novel link between the nuclear transcriptional and cytoplasmic proapoptotic functions of p53, which are important for both p53- and Bad-mediated mitochondrial apoptotic signaling (Fig. (Fig.6e).6e Acknowledgments We are grateful to Shamini Ayyadhury for editorial assistance. We thank Jörg Kobarg for supplying the GST-p53 plasmid and Ratna B. Ray for providing the pGL3-13-p53-LUC plasmid. We thank Wafik S. El-Deiry for his valuable suggestions on this study. This research was supported by a 973 grant (2002CB713702) from the Ministry of Science and Technology of China, by grants from the National Natural Science Foundation of China (30530200, 30370308, 90208027, and 30121001), and by an ARC grant (ARC-3/05-M45080006) to K.H. from the Ministry of Education, Singapore. Footnotes Published ahead of print on 25 September 2006.REFERENCES 1. Baptiste, N., and C. Prives. 2004. p53 in the cytoplasm: a question of overkill? Cell 116:487-489. [PubMed] 2. Biswas, G., M. Guha, and N. G. Avadnoni. 2005. Mitochondria-to nucleus stress signaling in mammalian cells: nature of nuclear gene targets, transcription regulation, and induced resistance to apoptosis. Gene 354:132-139. [PubMed] 3. Bonini, P., S. Cicconi, A. Cardinale, C. Vitale, A. L. Serafino, M. T. Ciotti, and L. N. Marlier. 2004. Oxidative stress induces p53-mediated apoptosis in glia: p53 transcription-independent way to die. J. Neurosci. Res. 75:83-95. [PubMed] 4. Chao, C., S. Saito, J. Kang, C. W. Anderson, E. Appella, and Y. Xu. 2000. p53 transcriptional activity is essential for p53-dependent apoptosis following DNA damage. EMBO J. 19:4967-4975. [PubMed] 5. Chattopadhyay, A., C. W. Chiang, and E. Yang. 2001. BAD/BCL-xL heterodimerization leads to by pass of G0/G1 arrest. Oncogene 20:4507-4518. [PubMed] 6. Chipuk, J. E., T. Kuwana, L. Bouchier-Hayes, N. M. Droin, D. D. Newmeyer, M. Schuler, and D. R. Green. 2004. Direct activation of Bax by p53 mediates mitochondrial membrane permeabilization and apoptosis. Science 303:1010-1014. [PubMed] 7. Datta, S. R., A. Katsove, L. Hu, A. Petros, S. W. Fesik, M. B. Yaffe, and M. E. Greenberg. 2000. 14-3-3 proteins and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol. Cell 6:41-51. [PubMed] 8. Desagher, S., and J. C. Martinou. 2000. Mitochondria as the central control point of apoptosis. Trends Cell Biol. 10:369-377. [PubMed] 9. el-Deiry, W. S., T. Tokino, V. E. Velculescu, D. B. Levy, R. Parsons, J. M. Trent, D. Lin, W. E. Mercer, K. W. Kinzler, and B. Vogelstein. 1993. WAF1, a potential mediator of p53 tumor suppression. Cell 75:817-825. [PubMed] 10. Gottfried, Y., A. Rotm, R. Lotan, H. Steller, and S. Larisch. 2004. The mitochondrial ARTS protein promotes apoptosis through targeting XIAP. EMBO J. 23:1627-1635. [PubMed] 11. Harada, H., B. Becknell, M. Wilm, M. Mann, L. J. Huang, S. S. Taylor, J. D. Scott, and S. J. Korsmeyer. 1999. Phosphorylation and inactivation of BAD by mitochondria-anchored protein kinase A. Mol. Cell 3:413-422. [PubMed] 12. Hershko, T., and D. Ginsberg. 2004. Up-regulation of Bcl-2 homology 3 (BH3)-only proteins by E2F1 mediates apoptosis. J. Biol. Chem. 279:8627-8634. [PubMed] 13. Kokontis, J. M., A. J. Wagner, M. O'Leary, S. Liao, and N. Hay. 2001. A transcriptional activation function of p53 is dispensable for and inhibitory of its apoptotic function. Oncogene 20:659-668. [PubMed] 14. Leu, J. I., P. Dumont, M. Hafey, M. E. Murphy, and D. L. George. 2004. Mitochondrial p53 activates Bak and causes disruption of a Bak-Mcl1 complex. Nat. Cell Biol. 6:443-450. [PubMed] 15. Mihara, M., S. Erster, A. Zaika, O. Petrenko, T. Chittenden, P. Pancoska, and U. M. Moll. 2003. p53 has a direct apoptogenic role at the mitochondria. Mol. Cell 11:577-590. [PubMed] 16. Miyashita, T., and J. C. Reed. 1995. The tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80:293-299. [PubMed] 17. Nakano, K., and K. H. Vousden. 2001. PUMA, a novel proapoptotic gene, is induced by p53. Mol. Cell 7:683-694. [PubMed] 18. Okamura, S., H. Arakawa, T. Tanaka, H. Nakanishi, C. C. Ng, Y. Taya, M. Monden, and Y. Nakamura. 2001. p53DINP1, a p53-inducible gene, regulates p53-dependent apoptosis. Mol. Cell 8:85-94. [PubMed] 19. Ranger, A. M., J. Zha, H. Harada, S. R. Datta, N. N. Danial, A. P. Gilmore, J. L. Kutok, M. M. Le Beau, M. E. Greenberg, and S. J. Korsmeyer. 2003. Bad-deficient mice develop diffuse large B cell lymphoma. Proc. Natl. Acad. Sci. USA 100:9324-9329. [PubMed] 20. Sax, J. K., P. Fei, M. E. Murphy, E. Bernhard, S. J. Korsmeyer, and W. S. El-Deiry. 2002. BID regulation by p53 contributes to chemosensitivity. Nat. Cell Biol. 4:842-849. [PubMed] 21. Schuler, M., and D. R. Green. 2005. Transcription, apoptosis and p53: catch-22. Trends Genet. 21:182-187. [PubMed] 21a. Song, Z. Y., X. B. Yao, and M. Wu. 2003. Direct interaction between Survivin and Smac is essential for the anti-apoptotic activity of Survivin during Taxol-induced apoptosis. J. Biol. Chem. 278:23130-23140. [PubMed] 22. Tan, K. O., N. Y. Fu, S. K. Sukumaran, S. Chan, J. H. Kang, K. L. Poon, B. S. Chen, and V. C. Yu. 2005. MAP-1 is a mitochondrial effector of Bax. Proc. Natl. Acad. Sci. USA 102:14623-14628. [PubMed] 23. Tomso, D. J., A. Inga, D. Menendez, G. S. Pittman, M. R. Campbell, F. Storici, D. A. Bell, and M. A. Resnick. 2005. Functionally distinct polymorphic sequences in the human genome that are targets for p53 transactivation. Proc. Natl. Acad. Sci. USA 102:6431-6436. [PubMed] 24. Vousden, K. H., and X. Lu. 2002. Live or let die: the cell's response to p53. Nat. Rev. Cancer 2:594-604. [PubMed] 25. Yang, E., J. Zha, J. Jockel, L. H. Boise, C. B. Thompson, and S. J. Korsmeyer. 1995. Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death. Cell 80:285-291. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||
Oncogene. 2001 Jul 27; 20(33):4507-18.
[Oncogene. 2001]Cell. 1995 Jan 27; 80(2):285-91.
[Cell. 1995]Mol Cell. 2000 Jul; 6(1):41-51.
[Mol Cell. 2000]Mol Cell. 1999 Apr; 3(4):413-22.
[Mol Cell. 1999]Cell. 1993 Nov 19; 75(4):817-25.
[Cell. 1993]Cell. 1995 Jan 27; 80(2):293-9.
[Cell. 1995]Mol Cell. 2001 Jul; 8(1):85-94.
[Mol Cell. 2001]Nat Cell Biol. 2002 Nov; 4(11):842-9.
[Nat Cell Biol. 2002]Mol Cell. 2001 Mar; 7(3):683-94.
[Mol Cell. 2001]EMBO J. 2004 Apr 7; 23(7):1627-35.
[EMBO J. 2004]J Biol Chem. 2004 Mar 5; 279(10):8627-34.
[J Biol Chem. 2004]Nat Cell Biol. 2002 Nov; 4(11):842-9.
[Nat Cell Biol. 2002]Trends Genet. 2005 Mar; 21(3):182-7.
[Trends Genet. 2005]Proc Natl Acad Sci U S A. 2005 May 3; 102(18):6431-6.
[Proc Natl Acad Sci U S A. 2005]Trends Cell Biol. 2000 Sep; 10(9):369-77.
[Trends Cell Biol. 2000]Cell. 2004 Feb 20; 116(4):487-9.
[Cell. 2004]Cell. 1995 Jan 27; 80(2):285-91.
[Cell. 1995]EMBO J. 2000 Sep 15; 19(18):4967-75.
[EMBO J. 2000]Cell. 1995 Jan 27; 80(2):293-9.
[Cell. 1995]Mol Cell. 2001 Mar; 7(3):683-94.
[Mol Cell. 2001]Nat Cell Biol. 2002 Nov; 4(11):842-9.
[Nat Cell Biol. 2002]Cell. 1993 Nov 19; 75(4):817-25.
[Cell. 1993]Cell. 2004 Feb 20; 116(4):487-9.
[Cell. 2004]Science. 2004 Feb 13; 303(5660):1010-4.
[Science. 2004]Gene. 2005 Jul 18; 354():132-9.
[Gene. 2005]J Neurosci Res. 2004 Jan 1; 75(1):83-95.
[J Neurosci Res. 2004]Nat Cell Biol. 2002 Nov; 4(11):842-9.
[Nat Cell Biol. 2002]Proc Natl Acad Sci U S A. 2003 Aug 5; 100(16):9324-9.
[Proc Natl Acad Sci U S A. 2003]Nat Cell Biol. 2002 Nov; 4(11):842-9.
[Nat Cell Biol. 2002]EMBO J. 2004 Apr 7; 23(7):1627-35.
[EMBO J. 2004]Proc Natl Acad Sci U S A. 2005 Oct 11; 102(41):14623-8.
[Proc Natl Acad Sci U S A. 2005]Science. 2004 Feb 13; 303(5660):1010-4.
[Science. 2004]