• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of aacPermissionsJournals.ASM.orgJournalAAC ArticleJournal InfoAuthorsReviewers
Antimicrob Agents Chemother. Oct 2006; 50(10): 3460–3463.
PMCID: PMC1610100

Method for Regulated Expression of Single-Copy Efflux Pump Genes in a Surrogate Pseudomonas aeruginosa Strain: Identification of the BpeEF-OprC Chloramphenicol and Trimethoprim Efflux Pump of Burkholderia pseudomallei 1026b

Abstract

Construction and integration of recombinant mini-Tn7 expression vectors into the chromosome of a surrogate, efflux-sensitized, and biosafe Pseudomonas aeruginosa host was validated as a generally applicable method for studies of uncharacterized bacterial efflux pumps. Using this method, the Burkholderia pseudomallei bpeEF-oprC operon was shown to encode a chloramphenicol and trimethoprim efflux pump.

Multidrug resistance pumps play major roles in intrinsic and acquired bacterial antibiotic resistance and also in bacterial pathogenicity (13). A major handicap associated with the characterization of bacterial efflux pumps is that they are under very tight regulatory control and thus considered “silent” in wild-type strains because inducing conditions are usually unknown. For this reason, such endeavors are restricted to clinical or laboratory-induced mutants overexpressing these pumps, but such mutants are scarce in many bacterial species, especially those whose use is restricted or those that are difficult to cultivate and genetically modify. In this study, we describe a method that may have widespread use in the study of uncharacterized bacterial efflux pumps. The method employs a novel mini-Tn7-based gene integration system developed in our laboratory (3) and a surrogate, drug-susceptible Pseudomonas aeruginosa strain which allows regulated gene expression from an unmarked, single-copy, chromosomally integrated recombinant construct. Here, we test the method by cloning, expressing, and functionally characterizing a new resistance nodulation cell division (RND) chloramphenicol and trimethoprim efflux pump of Burkholderia pseudomallei 1026b. In strain K96243, this pump is encoded by the BPSS0292-BPSS0293-BPSS0294 genes, and in 1710b, a strain more closely related to 1026b than K96243, the same pump is encoded by the genes annotated as ceoA-ceoB-BURPS1710b_A1842 (Fig. (Fig.1).1). In both strains, these genes are located on chromosome II, albeit in two different regions of the chromosome. These RND efflux pump genes are parts of operons which also contain genes encoding lipase-like proteins, BPSS0291 in K96243 and llpE in 1710b (Fig. (Fig.1).1). Upstream of these operons, and transcribed divergently from them, are BPSS0290 and ceoR, respectively, which encode LysR type regulatory proteins. The transcriptional organization of this region of B. pseudomallei K29243 chromosome II is reminiscent of the Burkholderia cenocepacia ceoAB-opcM efflux pump genes, which are part of a transcriptional unit with the upstream, lipase-like-protein-encoding llpE gene (11). Expression of the llpE-ceoAB-opcM operon is believed to be under the transcriptional control of a LysR type regulator encoded by the upstream and divergently transcribed ceoR gene. It is therefore likely that the BPSS0292-BPSS0293-BPSS0294 genes and ceoA-ceoB-BURPS1710b_A1842 encode a drug efflux pump, which will hereafter be named BpeEF-OprC for all B. pseudomallei strains to comply with established B. pseudomallei efflux pump nomenclature.

FIG. 1.
Organization of the regions containing the bpeEF-oprC genes in different B. pseudomallei strains. In both strains analyzed, the bpeEF-oprC genes are located on chromosome II (Chr II), albeit in two different regions of the chromosomes. The indicated coordinates ...

The bacterial strains and plasmids used in this study are listed in Table Table1.1. All bacterial strains were routinely grown in Luria-Bertani (LB) medium (EM Sciences, Gibbstown, NJ). Growth medium was supplemented with ampicillin (Sigma, St. Louis, MO) (100 μg/ml) for the selection of Escherichia coli strains containing plasmids carrying the ampicillin resistance marker. Fosmid-containing E. coli strains were grown in LB broth supplemented with 12 μg/ml of chloramphenicol (Sigma). Induction of fosmids to attain multiple copies was performed by adding 0.2% l-arabinose (Eastman Chemicals, Rochester, NY) to the growth medium. Gentamicin (Gm)-resistant P. aeruginosa strains were selected on LB plates containing 15 μg/ml Gm (Sigma) (LB+Gm15 plates).

TABLE 1.
Bacterial strains and plasmids used in this study

Fosmid clones of a B. pseudomallei 1026b library containing contigs corresponding to the location for bpeEF-oprC on B. pseudomallei K96243 were obtained from the University of Washington Genome Sequencing Center and used for PCR amplification of portions of the bpeEF-oprC operon. PCR primers were designed based on the B. pseudomallei K96243 sequence available from GenBank. The following primers were used to introduce the restriction sites, indicated by underlined bases and denoted in parentheses (base changes introduced to generate new restriction sites are lowercase): BpeEFEc (CATCCGAATTCAGAACAACCG) (EcoRI), BpeEFCR (GCCGCCGaAgcTTCAACGCG) (HindIII), BpeBgF (CGACACGATGCAGATCTACC) (BglII), and BpeBgR (GGTAGATCTGCATCGTGTCG) (BglII). Under standard PCR conditions for G+C-rich DNA (7), primer sets BpeEFEc and BpeBgR and BpeEFCR and BpeBgF were used to amplify two fragments of 3,632 bp and 2,479 bp, respectively. The 3,632-bp fragment contained the membrane fusion protein-encoding gene, bpeE, and a portion of the RND pump-encoding gene, bpeF, while the 2,479-bp fragment contained the remainder of the bpeF gene and the outer membrane component-encoding gene, oprC. Both fragments were cloned into the pCR2.1 vector (Invitrogen, Carlsbad, CA) by utilizing E. coli Top10F′ as the host, following the manufacturer's instructions. The bpeEF-oprC operon was then assembled in its entirety in the cloning vector pUCP20 (14) to yield pPS1679 (bacterial strains and plasmids are listed in Table Table1).1). The complete bpeEF-oprC operon was isolated from pPS1679 by digestion with EcoRI (blunt ended with T4 polymerase [NEB, Beverly, MA]) and HindIII, and the resulting fragment was subsequently ligated into the SmaI/HindIII-digested pUC18-mini-Tn7T-LAC vector to yield pPS1738 (Fig. (Fig.2).2). In this plasmid, expression of the bpeEF-oprC operon is driven from the tac promoter, which is controlled by the lacIq-encoded Lac repressor and therefore inducible by addition of IPTG (isopropyl-β-d-thiogalactopyranoside) (Gold Biotechnology, St. Louis, MO) to the growth medium. The integrity of the entire bpeEF-oprC operon was determined by sequencing at the Colorado State University Macromoleular Resources core facility. Sequence alignments showed that the B. pseudomallei 1026b bpeEF-oprC sequence is nearly identical (with a difference in 19 out of 6,020 nucleotides within the sequenced DNA) to the bpeEF-oprC operon of strain K96243. Open reading frame predictions showed that only 3 of the 19 base changes resulted in amino acid changes.

FIG. 2.
Single-copy integration of the B. pseudomallei bpeEF-oprC operon into the genome of a surrogate P. aeruginosa strain. The mini-Tn7 suicide delivery plasmid (double line) harboring the recombinant mini-Tn7 element (bold line) flanked by the left and right ...

A surrogate, drug-susceptible, and biosafe P. aeruginosa strain was constructed by transforming PAO397 with a suicide plasmid containing the previously described unmarked ΔpscC allele (15) with a rapid electroporation method (4). Chromosomal plasmid integration events were selected by plating the transformation mixture on LB+Gm15 plates, and the resulting merodiploids were resolved by streaking transformants on LB plates supplemented with 5% sucrose. Gm-susceptible colonies were then analyzed for the deletion of the pscC gene by colony PCR (7) with primers PscB-F (ATGGATCATCTGTTGAGCGG) and PscC-R (ACCAGGCGCCGTCTTTGGGA). The PCR fragment of expected size from one of the colonies was sequenced to confirm the deletion of 1,673 bp from the pscC gene. One strain containing the correct ΔpscC allele was retained and named PAO750. This strain is highly drug susceptible by virtue of deletions of five operons encoding RND pumps as well as the opmH gene encoding the P. aeruginosa TolC homolog that was shown to function with various RND pumps (6, 8). Deletion of the pscC gene, which encodes the outer membrane component of the sole P. aeruginosa type III secretion system, renders the organism avirulent (15) and makes it thus a suitable biosafe host strain for the cloning of DNA segments from a category B pathogen.

Insertion of bpeEF-oprC into the PAO750 genome was performed using the mini-Tn7 system as previously described (3, 5) and is illustrated in Fig. Fig.2.2. Briefly, competent PAO750 cells were electroporated with 50 ng each of pPS1738 and the helper plasmid pTNS2. Transformants were selected on LB+Gm15 plates, and the Gm marker was subsequently deleted using Flp recombinase (5), yielding PAO789. The drug susceptibility pattern of PAO789 was assessed by determining MICs on Mueller-Hinton broth (Difco, Becton-Dickinson, Sparks, MD)-grown cells with the twofold broth microdilution technique, following National Committee for Clinical Laboratory Standards (NCCLS) guidelines (12) or by the Etest method (AB Biodisk, Piscataway, NJ) (ciprofloxacin only). Induction of BpeEF-OprC expression in PAO789 with 1 mM IPTG resulted in a significant (fourfold) increase in the MICs for chloramphenicol and trimethoprim, but no change was observed in MICs for the other antibiotics and antimicrobials tested (Table (Table2).2). Addition of the known RND efflux pump inhibitor Phe-Arg-β-naphthylamide dichloride (Sigma) (9) to IPTG-induced cells at a final concentration of 10 μg/ml caused an 8- to 16-fold decrease in the MICs for chloramphenicol and trimethoprim. These data indicate that BpeEF-OprC is a chloramphenicol and trimethoprim efflux pump of possible clinical significance because both of these antibiotics have been used, for eradication and acute-phase melioidosis therapies, respectively (2).

TABLE 2.
MICs of different antibiotics for PAO789a

The method described in this study may have widespread use in the characterization of efflux pumps from bacterial pathogens. To avoid interference between resistance determinants contained on the mini-Tn7 elements and those provided by the RND pumps, several mini-Tn7-LAC expression vectors with diverse selection markers were constructed (data not shown). Single-copy insertion and inducible efflux pump expression are desirable features since the presence of RND efflux operons on multicopy plasmids is often not well tolerated by bacteria. Expression from a regulated promoter also circumvents the reliance on clinical or laboratory-induced-pump-overexpressing mutants for characterization of the substrate profiles and possible clinical significance of uncharacterized pumps. This method may also be used for rapid characterization of clinical isolates that exhibit multidrug resistance phenotypes, by matching the antibiotic resistance profile of the clinical isolates with those established for different pumps of that organism. By using a panel of strains expressing different pumps, one pump at a time, the method may also be applicable to the screening and identification of broad-spectrum efflux pump inhibitors. One possible drawback of using the testing and screening approach with a surrogate P. aeruginosa strain may be the inability to correctly identify peptide substrates and inhibitors that actually work in strains which are naturally resistant to peptide antibiotics, e.g., polymyxin-resistant Burkholderia spp. Lastly, the data obtained in this study further increase our understanding of the role that RND pumps play in clinically significant intrinsic and acquired B. pseudomallei antibiotic resistance, a step towards development of sorely needed improved therapies for melioidosis. In addition to AmrAB-OprA (10) and BpeAB-OprB (1), which export aminoglycosides and macrolides, BpeEF-OprC is the third example of a B. pseudomallei RND pump exporting clinically significant antibiotics.

Acknowledgments

This work was supported by NIH grant AI065357.

We thank M. Jacobs from the University of Washington Genome Sequencing Center for providing fosmids containing B. pseudomallei genomic DNA.

REFERENCES

1. Chan, Y. Y., T. M. C. Tan, Y. M. Ong, and K. L. Chua. 2004. BpeAB-OprB, a multidrug efflux pump in Burkholderia pseudomallei. Antimicrob. Agents Chemother. 48:1128-1135. [PMC free article] [PubMed]
2. Cheng, A. C., and B. J. Currie. 2005. Melioidosis: epidemiology, pathophysiology, and management. Clin. Microbiol. Rev. 18:383-416. [PMC free article] [PubMed]
3. Choi, K.-H., J. B. Gaynor, K. G. White, C. Lopez, C. M. Bosio, R. R. Karkhoff-Schweizer, and H. P. Schweizer. 2005. A Tn7-based broad-range bacterial cloning and expression system. Nat. Methods 2:443-448. [PubMed]
4. Choi, K.-H., A. Kumar, and H. P. Schweizer. 2006. A 10 min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer between chromosomes and plasmid transformation. J. Microbiol. Methods 64:391-397. [PubMed]
5. Choi, K.-H., and H. P. Schweizer. 2006. mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa. Nat. Protocols 1:153-161. [PubMed]
6. Chuanchuen, R., T. Murata, N. Gotoh, and H. P. Schweizer. 2005. Substrate-dependent utilization of OprM or OpmH by the Pseudomonas aeruginosa MexJK efflux pump. Antimicrob. Agents Chemother. 49:2133-2136. [PMC free article] [PubMed]
7. Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchma, and H. P. Schweizer. 1998. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77-86. [PubMed]
8. Jo, J. T. H., F. S. Brinkman, and R. E. W. Hancock. 2003. Aminoglycoside efflux in Pseudomonas aeruginosa: involvement of novel outer membrane proteins. Antimicrob. Agents Chemother. 47:1101-1111. [PMC free article] [PubMed]
9. Lomovskaya, O., M. S. Warren, A. Lee, J. Galazzo, R. Fronko, M. Lee, J. Blais, D. Cho, S. Chamberland, T. Renau, R. Leger, S. Hecker, W. Watkins, K. Hoshino, H. Ishida, and V. J. Lee. 2001. Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: novel agents for combination therapy. Antimicrob. Agents Chemother. 45:105-116. [PMC free article] [PubMed]
10. Moore, R. A., D. DeShazer, S. Reckseidler, A. Weissman, and D. E. Woods. 1999. Efflux-mediated aminoglycoside and macrolide resistance in Burkholderia pseudomallei. Antimicrob. Agents Chemother. 43:465-470. [PMC free article] [PubMed]
11. Nair, B. M., K. J. Cheung, Jr., A. Griffith, and J. L. Burns. 2004. Salicylate induces an antibiotic efflux pump in Burkholderia cepacia complex genomovar III (B. cenocepacia). J. Clin. Investig. 113:464-473. [PMC free article] [PubMed]
12. National Committee for Clinical Laboratory Standards. 2003. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A6 and MIC testing supplemental tables M100-S13, 6th ed., vol. 23, no. 2. National Committee for Clinical laboratory Standards, Wayne, Pa.
13. Piddock, L. J. 2006. Multidrug-resistance efflux pumps—not just for resistance. Nat. Rev. Microbiol. 4:629-636. [PubMed]
14. West, S. E. H., H. P. Schweizer, C. Dall, A. K. Sample, and L. J. Runyen-Janecky. 1994. Construction of improved Escherichia-Pseudomonas shuttle vectors derived from pUC18/19 and the sequence of the region required for their replication in Pseudomonas aeruginosa. Gene 128:81-86. [PubMed]
15. Wolfgang, M. C., V. T. Lee, M. E. Gilmore, and S. Lory. 2003. Coordinate regulation of bacterial virulence genes by a novel adenylate cyclase-dependent signaling pathway. Dev. Cell 4:253-263. [PubMed]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...