![]() | ![]() |
Formats:
|
||||||||||||||||||||||||||
Copyright © 2006, American Society for Microbiology Disruption of Ledgf/Psip1 Results in Perinatal Mortality and Homeotic Skeletal Transformations MRC Human Genetics Unit, Crewe Road, Edinburgh EH4 2XU, United Kingdom,1 Research Animal Pathology Core Facility, Queen's Medical Research Institute, Edinburgh University, Edinburgh EH16 4TJ, United Kingdom,2 Endocrinology Unit, Centre for Cardiovascular Science, Queen's Medical Research Institute, Edinburgh University, Edinburgh EH16 4TJ, United Kingdom3 *Corresponding author. Mailing address: MRC Human Genetics Unit, Crewe Road, Edinburgh EH4 2XU, United Kingdom. Phone: (44) 131 332 2471. Fax: (44) 131 467 8456. E-mail: H.Sutherland/at/hgu.mrc.ac.uk. †Present address: Clinical Research Division, Fred Hutchinson Cancer Research Center, Seattle, WA 98109. Received March 16, 2006; Revised April 25, 2006; Accepted June 24, 2006. This article has been cited by other articles in PMC.Abstract PC4- and SF2-interacting protein 1 (Psip1)—also known as lens epithelium-derived growth factor (Ledgf)—is a chromatin-associated protein that has been implicated in transcriptional regulation, mRNA splicing, and cell survival in vitro, but its biological function in vivo is unknown. We identified an embryonic stem cell clone with disrupted Psip1 in a gene trap screen. The resulting Psip1-βgeo fusion protein retains chromatin-binding activity and the PWWP and AT hook domains of the wild-type protein but is missing the highly conserved C terminus. The majority of mice homozygous for the disrupted Psip1 gene died perinatally, but some survived to adulthood and displayed a range of phenotypic abnormalities, including low fertility, an absence of epididymal fat pads, and a tendency to develop blepharitis. However, contrary to expectations, the lens epithelium was normal. The mutant mice also exhibited motor and/or behavioral defects such as hind limb clenching, reduced grip strength, and reduced locomotor activity. Finally, both Psip1−/− neonates and surviving adults had craniofacial and skeletal abnormalities. They had brachycephaly, small rib cages, and homeotic skeletal transformations with incomplete penetrance. The latter phenotypes suggest a role for Psip1 in the control of Hox expression and may also explain why PSIP1 (LEDGF) is found as a fusion partner with NUP98 in myeloid leukemias. PC4- and SF2-interacting protein 1 (Psip1) has been isolated in a number of independent experimental settings and has been assigned a variety of names and putative functions. Psip1 encodes two protein isoforms with molecular masses of 52 and 75 kDa. p52 and p75 were identified as interacting with transcription factor PC4 and shown to act as transcriptional coactivators (8). p75 is also referred to as lens epithelium-derived growth factor (LEDGF) since it was identified as a cell survival factor under a variety of conditions of environmental stress, and it has been implicated as a transcriptional regulator of stress-related genes (32). PSIP1 (LEDGF) is also a nuclear autoantigen targeted by autoantibodies in some patients with atopic dermatitis and other inflammatory conditions involving dysregulated apoptosis. It is thought to exert an antiapoptotic effect by transcriptional activation of stress-related genes (7), and it is cleaved by caspases (38). Psip1 has been reported to localize to chromatin in both interphase and mitotic chromosomes (27, 28, 35, 37). The N-terminal domain of Psip1 contains a PWWP domain (Fig. (Fig.1B),1B
Apart from its suggested role as a transcriptional regulator (21, 32), an integrase-binding domain (IBD) in p75/PSIP1 tethers human immunodeficiency virus type 1 integrase to host chromosomes and so prevents integrase degradation (3, 4, 23, 37) (Fig. (Fig.1B).1B Most assays for normal Psip1 function have involved overexpression of the protein in cultured cells. Apart from the role in tethering viral integrase, depletion of PSIP1 from cells in culture by RNA interference reveals no obvious cellular phenotype (5, 6, 22); therefore, the biological function of PSIP1 remains unknown. We originally identified Psip1 as a chromosomally associated protein during the course of a gene trap screen to identify novel murine nuclear and chromosomal proteins (35). Two independent gene-trapped clones were obtained, one in mouse F9 embryonal carcinoma cells and the other in mouse embryonic stem (ES) cells (Fig. (Fig.1).1 MATERIALS AND METHODS Cell culture and immunostaining. The F9 and ES cell Psip1 gene trap lines (WF9/3G5 and ES149) were generated, maintained, and immunostained with an antibody against β-galactosidase (β-gal; Europa) as previously described (35). Generation of p75 antibodies. A fragment of human p75/Psip1 from amino acid 326 to amino acid 529 encompassing the whole of the p75-specific region (Fig. (Fig.1B)1B Generation and genotyping of Psip1 mutant mice. The ES149 cell line was a gene trap of E14 ES cells (35), which are derived from the mouse substrain 129/Ola. ES149 cells were passaged the day before injection into blastocysts collected at 3.5 days postcoitum (dpc) from superovulated C57BL/6 females and transferred into pseudopregnant recipient females. Chimeric pups were identified by their agouti coat color and, when mature, were mated to both MF1 outbred and C57BL/6 mice. Two male chimeras yielded germ line transmission, and heterozygotes for the Psip1 mutation were identified by Southern blot analysis for presence of the lacZ portion of the gene trap vector. Heterozygotes obtained from crosses with either MF1 or C57BL/6 mice (termed first backcross) were backcrossed with wild-type (WT) mice from each respective strain at least three more times before matings between heterozygotes were set up. DNA for genotyping of mice was obtained from tail tips or ear punches. To detect the presence of the gene trap vector (SA-βgeo construct) by Southern blotting, genomic DNA was digested with EcoRI and hybridized with a dCTP-p32-labeled probe 3-kb BamHI fragment encompassing lacZ. More routinely, mice were genotyped by testing for lacZ by PCR with primers 5′ GTTGCGCAGCCTGAATGGCG 3′ and 5′ GCCGTCACTCCAACGCAGCA 3′, which generate a 432-bp PCR fragment. To genotype offspring from Psip1 heterozygous (+/−) crosses, HindIII-digested genomic DNA was analyzed by Southern blotting with a 223-bp PCR product generated from exon 9 of Psip1 (5′ GGTTATTGATGAAGATAAAAG 3′ and 5′ TTCACCCTCTTGATCGTCTTC 3′). Alternatively, genomic DNA was analyzed by PCR for the presence of both lacZ as described above and the endogenous Psip1 locus with primers from introns 8 and 9 (5′ CTGATGAGAGATTGGAGGAGG 3′ and 5′ CTGCAAATGCCAAGGGACATG 3′) into which the gene trap construct was inserted. An 860-bp PCR product is generated from the WT locus, but no product is obtained from the gene-trapped locus. Analysis of Psip1 expression in mice generated from the ES149 gene trap line. Embryos obtained at 14.5 dpc from a cross between male and female Psip1+/− mice were stored at −80°C after a biopsy was taken for genotyping each individual. For analyzing mRNA, half of an embryo for each genotype was homogenized in TriReagent (Sigma) and the RNA was extracted according to the manufacturer's instructions. After DNase I treatment of the RNA, reverse transcription (RT)-PCRs were performed with primers for Psip1 (5′ AGATGCATAGAGGCCCTGGATG 3′ and 5′ ACATCTGAAGCTGCCGACCTAG 3′), which generate a 499-bp product from beyond the site of gene trap integration in the transcript, and Snapc3 (5′ TGAGCACATCAGCAAAGACCTC 3′ and 5′ AGGTTCCTGGGTCAACATAAGG 3′), which generate a 511-bp product—to check the transcript from the opposite strand, and a 70-bp product of Gapdh (5′ CTCAAGATTGTCAGCAATGCA 3′ and 5′ CCTTCCACAATGCCAAAGTT 3′) was used as a positive control. For protein analysis, the other half of the embryo was homogenized in sodium dodecyl sulfate loading buffer and the samples were boiled and sonicated. Aliquots were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Coomassie staining to estimate protein concentrations. Samples with equal amounts of protein were run and transferred to HybondP (Amersham) membranes. Immunodetection was performed with the sheep p75-specific antibody described above (1:1,000 dilution), an anti-sheep antibody-horseradish peroxidase conjugate (Jackson Labs), and chemiluminescence. Embryos from timed matings were harvested and stained with 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) as described elsewhere (26). Pathology and histochemistry. Neonatal mice were humanely killed by decapitation, and thoracoabdominal organs and heads were fixed in 10% neutral buffered formalin and processed for histopathology. Thoracoabdominal organ blocks were serially sectioned parallel to the sagittal plane at 4 μm. Fifty evenly spaced sections spanning the entire block were stained with hematoxylin and eosin (H&E). Heads were serially sectioned transversely, and 25 evenly spaced sections spanning the entire block were stained with H&E. Adult mice were humanely killed with CO2 gas. The initial group (two Psip1−/− and four Psip1+/− mice) received detailed gross and histopathological examination of all organ systems. A second group (two Psip1−/−, two Psip1+/−, and two WT mice) received a detailed gross examination and histopathological examination of the adrenal gland, kidney, eyelid, and stomach. Tissues were fixed in 10% neutral buffered formalin and wax embedded, and 4-μm sections were stained with H&E. Alizarin red-alcian blue staining of adult and newborn mice was performed as described previously (29). Briefly, animals were skinned, eviscerated, and fixed in 95% ethanol. They were then transferred to acetone for 2 days and then stained with alizarin red-alcian blue (Sigma) for 3 days at room temperature, subsequently cleared with 1% KOH, and finally stored in glycerol. Behavioral and motor function studies. In hind limb extension tests, mice were suspended by their tails and the extent of hind limb extension was observed. If both hind limbs showed the extension reflex, including splayed toes, the mouse was considered normal. If the toes and one or two hind limbs were clenched to the body, the mouse was considered to fail the test. In grip strength tests, mice were suspended from a pencil with their forepaws. A mouse that was not able to suspend itself for any amount of time was considered to fail this test. In open-field tests, mice were placed in an open-field box (60 by 60 cm) marked off into 25 equal squares. Tests were videotaped or captured by a computer tracking program (Limelight; Actimetrics) to allow full analysis. The outer row of squares adjacent to the walls of the field are considered less anxiogenic than the inner squares. For 5 min, the number of crossings, time, and distance (movement of all four legs into a new square) into each square was noted together with other ethological parameters such as the numbers of rearings and fecal boli. Total movement in the field reflects general activity, and relative movement into the inner zone correlates with the anxiety state of the mouse. RESULTS Gene-trapped forms of Psip1 are missing conserved domains of the protein but still retain chromatin-binding activity. We previously performed a gene trap screening of mouse cells to identify nuclear proteins and characterize their distribution within the nucleus (35). We obtained a number of clones in which the resulting βgeo fusion protein was found to associate with chromosomes. In two independent clones obtained (one in F9 embryonal carcinoma cells and the other in E14 ES cells), the gene that had been trapped was identified as Psip1. The sites of integration of the gene trap vector in the F9/3G5 and ES149 cell lines are shown in Fig. Fig.1A.1A Psip1 is highly conserved among vertebrates over the known protein motifs shared by both the p52 and p75 isoforms but also the IBD and other p75-specific sequences in the C-terminal end of the protein that are lost in the F9/3G5 and ES149 gene traps. Hence, it is likely that the gene-trapped proteins have perturbed function. With an antibody against β-gal that detects the βgeo portion of the gene-trapped proteins, we found that the Psip1 fusion proteins in both gene trap clones localize to interphase nuclei and to mitotic chromosomes (Fig. (Fig.2).2
Generation of mice with disrupted Psip1. To investigate the phenotype of Psip1 mutation, we generated chimeras from the ES149 cell line by blastocyst injection. Of the three chimeras obtained, two transmitted the transgene through the germ line. Heterozygous Psip1 gene trap mouse lines from each were established in both inbred C57BL/6 and outbred MF1 backgrounds, and in most subsequent experiments mice backcrossed at least five times into each respective background were used. The presence of the gene trap vector in genomic DNA from these mice was detected by Southern blotting or by PCR with lacZ-specific primers that amplify a 432-bp fragment (Fig. (Fig.3A).3A
Expression of Psip1 during development. As gene-trapped Psip1-βgeo is under the control of the endogenous promoter, we analyzed its expression during embryonic development by X-Gal staining. While no expression was detected in preimplantation embryos (0 or 2.5 dpc), ubiquitous expression was observed in heterozygous embryos at 7.5 dpc and then throughout gestation (Fig. (Fig.4A).4A
Alternative splicing around gene trap integrations can sometimes result in the production of WT mRNAs from the trapped gene (25). We confirmed that full-length p75/Psip1 mRNA is not produced from the gene-trapped locus by RT-PCR with primers downstream of the gene trap site in RNA prepared from 14.5-dpc embryos of each genotype. p75/Psip1 mRNA is detected in RNA from +/+ or +/− embryos but absent from −/− embryos (Fig. (Fig.4B4B A recent analysis of the mouse transcriptome revealed that a large proportion of mouse genes have antisense transcripts (19). Indeed, Psip1 partially overlaps the Snapc3 gene on the opposite strand and the ES149 gene trap insertion site is within an intron in the 3′ untranslated region of Snapc3 (Fig. (Fig.1A).1A Psip1 expression was also assessed in protein extracts prepared from 14.5-dpc embryos. The p75 isoform was detected in extracts from +/+ and +/− embryos but not in samples from Psip1−/− embryos (Fig. (Fig.4C).4C Perinatal lethality of homozygous Psip1 mutant mice in a C57BL/6 background. In the outbred background, Psip1+/− mice were physically indistinguishable from WT littermates and were obtained at the expected frequency (Table 1). However, in an inbred (C57BL/6) background there was a small but significant deficit of heterozygous animals (χ2 = 4.33, df = 1) (Table 1).
In crosses between heterozygotes, there was no deficit of Psip1−/− embryos at various stages of development (Table 2) and they were indistinguishable from +/+ and +/− embryos. Psip1−/− pups were also present immediately after birth, in numbers compatible with normal Mendelian ratios (Table 2). However, we noticed that many pups from both C57BL/6 and MF1 breeding pairs died just after birth. The majority of these were Psip1−/− (χ2 = 7.74, df = 2) (Table 2), suggesting that there is significant perinatal lethality of Psip1−/− mice.
There were no external abnormalities in these Psip1−/− pups. Histopathology of serial sections of three −/− neonates revealed no structural abnormalities in heads, brain, thoracic organs, or abdominal organs. All had empty stomachs and intestinal tracts, atrophic spleens, and scattered petechiae in the wall of the bladder near the dome. Stomachs and intestinal tracts were full in two Psip1+/− and two WT littermates which had normal spleens and no periurachal hemorrhage. The empty gastrointestinal tracts of the three null mice suggested a failure to nurse. Atrophy of the spleens was interpreted as stress related. Periurachal hemorrhage was mild and its significance questionable. On the rare occasion that litters were actually observed being born, a couple of pups (which when subsequently genotyped were Psip1−/−) appeared to gasp, suggesting that they had trouble breathing, but the majority did not die immediately after birth but survived for up to the first day. As histological examination had revealed minimal structural abnormalities (including normal lungs, diaphragms, and palates) but empty stomachs, death of Psip1−/− neonates appears to be mainly the result of a failure to nurse. Inanition could be due to an inability of mutants to compete with littermates for teats, abnormal or absent nursing behavior, orrejection by the mother because of behavioral abnormalities. Survival of a subset of homozygous mutants in a 129/Ola-C57BL/6 hybrid or outbred MF1 background. Only one homozygous animal in the C57BL/6 background survived to weaning at 4 weeks (Table 3). From Psip1+/− intercrosses of mice from either the first backcross into the C57BL/6 background or in the outbred MF1 background, the majority of homozygous mutant offspring also died just after birth and showed a failure to nurse. However, of those that were present after weaning (χ2 = 21.3 and 121.8) (Table 3), the majority then survived for >6 months, although a number of subtle differences between Psip1−/− adults and their WT and heterozygous littermates were detected.
Psip1−/− mice were very lean, with reduced intraabdominal fat and a complete absence of epididymal fat pads (Table 4 and Fig. Fig.5A).5A
Eye phenotypes in homozygous mutant mice. Psip1 (LEDGF) was originally described as a growth factor produced by lens epithelial cells and has been reported to function in the survival of lens epithelial cells (34). Immunostaining showed that, in Psip1+/+ mice, p75/Psip1 was expressed in nuclei of lens epithelial cells and in cells of the cornea, sclera, uvea, and retina (data not shown). However, after H&E staining, the lens epithelium appeared to be normal in Psip1−/− mice, suggesting that, in vivo, Psip1 (Ledgf) does not function to promote the survival or growth of the lens epithelium (Fig. (Fig.5C5C The majority of Psip1−/− mice did develop persistent inflammation of the eyelids of one or both orbits (Fig. (Fig.5D),5D Motor and behavioral abnormalities in Psip1 mutants. Survivor Psip1−/− mice and their +/+ and +/− littermates were tested for basic motor functions. Hind limb extension and splaying of toes are natural reflexes for a mouse suspended by its tail, but Psip1−/− mice had a tendency to clench their toes and their hind limbs to their bodies (Table 4 and Fig. Fig.5F).5F In an open-field test, the total number of squares visited by Psip1−/− mice was significantly reduced (Table 5). A one-way analysis of variance [(F2,32) = 10.62 and P = 0.003] demonstrated a highly significant difference between the genotypes. Post hoc analysis by Dunnett's test showed that the significance lies in homozygous mutant mice being significantly different (P < 0.05) from both WT and heterozygous mice. There was no difference in these parameters between +/+ and +/− mice. Decreased movement by Psip1−/− mice could be because they find it difficult or painful to move or because they are anxious or inhibited. The latter explanation is less likely, as the proportions of crossings in the more anxiogenic inner zones are similar among all of the genotypes (Table 5). Furthermore, rearing on the hind legs is also significantly reduced, which may reflect the general problems observed with movement in Psip1−/− mice.
The motor abnormalities of Psip1−/− mice will affect behavior and could explain why the majority of mutants fail to nurse. They may either have difficulty in, or be uninterested in, feeding, or they may be rejected by their mothers because of their abnormal movement or behavior. Brachycephaly and skeletal homeotic transformations in Psip1 mutants. Surviving Psip1−/− mice tend to have broad, shortened faces and jaws and often a slightly hunched appearance (Fig. (Fig.5G).5G
Skeletal abnormalities were also found in Psip1−/− newborns and adults (Fig. (Fig.6),6 Some −/− animals exhibited skeletal alterations along the anterior-posterior axis that were consistent with homeotic transformations. Figure Figure6D6D Most Psip1−/− mice also show homeotic transformations in the lumbar region, with only five lumbar vertebrae (Fig. (Fig.6F,6F Evidence for upregulation of Hox genes in the absence of Psip1 (LEDGF). Posterior transformation of cervical vertebra C7 to thoracic vertebra T1 is a phenotype also seen in mice mutant for Hoxa4 (14), Hoxa5 (18), and Hoxa6 (20). Therefore, Psip1 may be involved either in the control of Hox gene expression or as a downstream effector of Hox function. To find evidence for Hox gene deregulation in the absence of Psip1, mouse embryonic fibroblasts (MEFs) were derived from the bodies of genotyped embryos at 11.5 dpc, a stage when there appears to be widespread Psip1 expression (Fig. (Fig.4A).4A However, analysis of the results of transcriptional profiling of human embryonic kidney (HEK) 293 cells subjected to small interfering (siRNA) for p75/PSIP1 does support the hypothesis that PSIP1 can be involved in the regulation of HOX gene expression (5). Compared to control cells (with scrambled siRNAs), global levels of gene expression were unaltered in knockdown cells (mean ratio of p75/PSIP1 siRNA expression to scrambled control expression = 0.96) (http://www.ncbi.nlm.nih.gov/geo/; accession no. GSE3485). For each probe's signal deemed “present” in this analysis, we calculated the mean value and standard deviation across the four knockdown and the four control arrays. Probes significantly (P < 0.01) up- or down-regulated in the knockdown were then identified with an unpaired t test. This gave 358 significantly up-regulated and 479 down-regulated probes, mapping to 268 and 342 Ensembl genes, respectively. Among these up-regulated genes were HOXA5, HOXA6 HOXA9, HOXA10, and HOXA13. Genes from other HOX clusters were generally found not to be expressed in HEK 293 cells, but HOXD8 was found to be down-regulated in the knockdown cells. Although established by adenovirus transformation of primary HEK cells, subsequent microarray analysis has indicated that HEK 293 cells are of neuronal origin (31). These data therefore indicate that loss of PSIP1 can lead to dysregulation of HOX genes in some cell types. DISCUSSION We have used gene trap mutagenesis to investigate the biological function of Psip1 in the mouse. Psip1 is a ubiquitous chromatin-associated protein, isoforms of which have been variously implicated in transcriptional regulation, mRNA splicing, and cell survival in vitro (7, 8, 32). Gene trap insertion into Psip1 abrogates expression of both isoforms of the normal Psip1 protein (Fig. (Fig.11 Psip1 (LEDGF) was originally described as a growth factor produced by lens epithelial cells and has been reported to function in the survival of lens epithelial cells in vitro (34). It has also been suggested to play a protective role against stress in corneal keratinocytes (21). We found that p75/Psip1 is expressed in nuclei of lens epithelial cells and in cells of the cornea, sclera, uvea, and retina. However, the lens epithelium and cornea appear to be normal in Psip1−/− mutant mice (Fig. (Fig.5C),5C The most dramatic aspect of the Psip1−/− phenotype is that the majority of pups died during the first day after birth. However, a subset of Psip1−/− mutant mice survived and these displayed skeletal abnormalities reminiscent of homeotic transformations. The ectopic ribs seen on cervical vertebra C7 are consistent with a posterior homeotic transformation to thoracic vertebra T1 (Fig. 6D and E We therefore considered the possibility that Psip1 is involved either in the control of Hox gene expression or as a downstream effector of Hox function. Although we found no evidence for misregulation of Hox gene expression in MEFs derived from Psip1−/− embryos, we did find it in a microarray data set of transcriptional profiling of HEK 293 cells subjected to siRNA for p75/PSIP1 (5). Almost 2% of the genes most significantly (P < 0.01) up-regulated in the knockdown cells were genes from the 5′ end of the HOXA cluster (HOXA5, HOXA6 HOXA9, HOXA10, and HOXA13). The upregulation of these “posterior” members of the HOXA cluster in cultured cells deficient in p75/PSIP1 would be consistent with the posterior homeotic transformations in our Psip1−/− mice. As well as a role in transcriptional regulation, the p52 isoform of Psip1 has been shown to interact with the splicing factor SF2 and to modulate its activity (9). It is therefore intriguing that animals heterozygous for mutation in an essential splicing factor, SF3b1, a component of the U2 snRNP, showed posterior homeotic transformations similar to those seen in Psip1−/− mutant mice, including ectopic ribs on C7 and L6-to-S1 transformation (17). We suggest that Psip1 may have an unexpected function in the transcriptional repression of homeotic genes and the specification of identity along the axial skeleton. In this regard, it is interesting that human PSIP1 (LEDGF) is found as a translocation-induced fusion partner with NUP98 in acute and chronic myeloid leukemias (11, 15). In these cases, the part of PSIP1 that is retained in the fusion protein (beyond exon 7) is the part that is missing in our mutant mice. The other recurrent leukemia-associated fusion partners with NUP98 are encoded by the HOX genes themselves (1). Further investigation of the interactions between Hox genes and Psip1 may help to elucidate the molecular etiology of these leukemias. Lastly, knocking minigenes for the different Psip1 isoforms back into our mutant mice may help to dissect the different functions of the alternatively spliced isoforms of Psip1. Acknowledgments H.G.S. was supported by fellowships from European Molecular Biology Organization and the Association for International Cancer Research. W.A.B. is a Centennial Fellow of the James S. McDonnell Foundation, and this work was supported by the Medical Research Council, UK, and in part by FP6 through funding for the Epigenome Network of Excellence under contract LSHG-CT-2004-503433. We thank Phillipe Gautier (MRC HGU) for help with the bioinformatics, Sandy Bruce for photography, and Bob Hill for critical reading of the manuscript. We are grateful to Toshimichi Shinohara (Boston, MA) for the human LEDGF cDNA. REFERENCES 1. Abramovich, C., N. Pineault, H. Ohta, and R. K. Humphries. 2005. Hox genes: from leukemia to hematopoietic stem cell expansion. Ann. N. Y. Acad. Sci. 1044:109-116. [PubMed] 2. Chen, T., N. Tsujimoto, and E. Li. 2004. The PWWP domain of Dnmt3a and Dnmt3b is required for directing DNA methylation to the major satellite repeats at pericentric heterochromatin. Mol. Cell. Biol. 24:9048-9058. [PubMed] 3. Cherepanov, P., A. L. Ambrosio, S. Rahman, T. Ellenberger, and A. Engelman. 2005. Structural basis for the recognition between HIV-1 integrase and transcriptional coactivator p75. Proc. Natl. Acad. Sci. USA 102:17308-17313. [PubMed] 4. Cherepanov, P., E. Devroe, P. A. Silver, and A. Engelman. 2004. Identification of an evolutionarily conserved domain in human lens epithelium-derived growth factor/transcriptional co-activator p75 (LEDGF/p75) that binds HIV-1 integrase. J. Biol. Chem. 279:48883-48892. [PubMed] 5. Ciuffi, A., M. Llano, E. Poeschla, C. Hoffmann, J. Leipzig, P. Shinn, J. R. Ecker, and F. Bushman. 2005. A role for LEDGF/p75 in targeting HIV DNA integration. Nat. Med. 11:1287-1289. [PubMed] 6. Emiliani, S., A. Mousnier, K. Busschots, M. Maroun, B. Van Maele, D. Tempe, L. Vandekerckhove, F. Moisant, L. Ben Slama, M. Witvrouw, F. Christ, J. C. Rain, C. Dargemont, Z. Debyser, and R. Benarous. 2005. Integrase mutants defective for interaction with LEDGF/p75 are impaired in chromosome tethering and HIV-1 replication. J. Biol. Chem. 280:25517-25523. [PubMed] 7. Ganapathy, V., T. Daniels, and C. A. Casiano. 2003. LEDGF/p75: a novel nuclear autoantigen at the crossroads of cell survival and apoptosis. Autoimmun. Rev. 2:290-297. [PubMed] 8. Ge, H., Y. Si, and R. G. Roeder. 1998. Isolation of cDNAs encoding novel transcription coactivators p52 and p75 reveals an alternate regulatory mechanism of transcriptional activation. EMBO J. 17:6723-6729. [PubMed] 9. Ge, H., Y. Si, and A. P. Wolffe. 1998. A novel transcriptional coactivator, p52, functionally interacts with the essential splicing factor ASF/SF2. Mol. Cell 2:751-759. [PubMed] 10. Ge, Y. Z., M. T. Pu, H. Gowher, H. P. Wu, J. P. Ding, A. Jeltsch, and G. L. Xu. 2004. Chromatin targeting of de novo DNA methyltransferases by the PWWP domain. J. Biol. Chem. 279:25447-25454. [PubMed] 11. Grand, F. H., P. Koduru, N. C. Cross, and S. L. Allen. 2005. NUP98-LEDGF fusion and t(9;11) in transformed chronic myeloid leukemia. Leuk. Res. 29:1469-1472. [PubMed] 12. Harrer, M., H. Luhrs, M. Bustin, U. Scheer, and R. Hock. 2004. Dynamic interaction of HMGA1a proteins with chromatin. J. Cell Sci. 117:3459-3471. [PubMed] 13. Henry, R. W., B. Ma, C. L. Sadowski, R. Kobayashi, and N. Hernandez. 1996. Cloning and characterization of SNAP50, a subunit of the snRNA-activating protein complex SNAPc. EMBO J. 15:7129-7136. [PubMed] 14. Horan, G. S., K. Wu, D. J. Wolgemuth, and R. R. Behringer. 1994. Homeotic transformation of cervical vertebrae in Hoxa-4 mutant mice. Proc. Natl. Acad. Sci. USA 91:12644-12648. [PubMed] 15. Hussey, D. J., S. Moore, M. Nicola, and A. Dobrovic. 2001. Fusion of the NUP98 gene with the LEDGF/p52 gene defines a recurrent acute myeloid leukemia translocation. BMC Genet. 2:20. [PubMed] 16. Isaac, C., K. L. Marsh, W. A. Paznekas, J. Dixon, M. J. Dixon, E. W. Jabs, and U. T. Meier. 2000. Characterization of the nucleolar gene product, treacle, in Treacher Collins syndrome. Mol. Biol. Cell 11:3061-3071. [PubMed] 17. Isono, K., Y. Mizutani-Koseki, T. Komori, M. S. Schmidt-Zachmann, and H. Koseki. 2005. Mammalian polycomb-mediated repression of Hox genes requires the essential spliceosomal protein Sf3b1. Genes Dev. 19:536-541. [PubMed] 18. Jeannotte, L., M. Lemieux, J. Charron, F. Poirier, and E. J. Robertson. 1993. Specification of axial identity in the mouse: role of the Hoxa-5 (Hox1.3) gene. Genes Dev. 7:2085-2096. [PubMed] 19. Katayama, S., Y. Tomaru, T. Kasukawa, K. Waki, M. Nakanishi, M. Nakamura, H. Nishida, C. C. Yap, M. Suzuki, J. Kawai, H. Suzuki, P. Carninci, Y. Hayashizaki, C. Wells, M. Frith, T. Ravasi, K. C. Pang, J. Hallinan, J. Mattick, D. A. Hume, L. Lipovich, S. Batalov, P. G. Engstrom, Y. Mizuno, M. A. Faghihi, A. Sandelin, A. M. Chalk, S. Mottagui-Tabar, Z. Liang, B. Lenhard, and C. Wahlestedt. 2005. Antisense transcription in the mammalian transcriptome. Science 309:1564-1566. [PubMed] 20. Kostic, D., and M. R. Capecchi. 1994. Targeted disruptions of the murine Hoxa-4 and Hoxa-6 genes result in homeotic transformations of components of the vertebral column. Mech. Dev. 46:231-247. [PubMed] 21. Kubo, E., N. Fatma, P. Sharma, T. Shinohara, L. T. Chylack, Jr., Y. Akagi, and D. P. Singh. 2002. Transactivation of involucrin, a marker of differentiation in keratinocytes, by lens epithelium-derived growth factor (LEDGF). J. Mol. Biol. 320:1053-1063. [PubMed] 22. Llano, M., S. Delgado, M. Vanegas, and E. M. Poeschla. 2004. Lens epithelium-derived growth factor/p75 prevents proteasomal degradation of HIV-1 integrase. J. Biol. Chem. 279:55570-55577. [PubMed] 23. Maertens, G., P. Cherepanov, W. Pluymers, K. Busschots, E. De Clercq, Z. Debyser, and Y. Engelborghs. 2003. LEDGF/p75 is essential for nuclear and chromosomal targeting of HIV-1 integrase in human cells. J. Biol. Chem. 278:33528-33539. [PubMed] 24. Maurer-Stroh, S., N. J. Dickens, L. Hughes-Davies, T. Kouzarides, F. Eisenhaber, and C. P. Ponting. 2003. The Tudor domain ‘Royal Family’: Tudor, plant Agenet, Chromo, PWWP and MBT domains. Trends Biochem. Sci. 28:69-74. [PubMed] 25. McClive, P., G. Pall, K. Newton, M. Lee, J. Mullins, and L. Forrester. 1998. Gene trap integrations expressed in the developing heart: insertion site affects splicing of the PT1-ATG vector. Dev. Dyn. 212:267-276. [PubMed] 26. Newton, K., E. Petfalski, D. Tollervey, and J. F. Caceres. 2003. Fibrillarin is essential for early development and required for accumulation of an intron-encoded small nucleolar RNA in the mouse. Mol. Cell. Biol. 23:8519-8527. [PubMed] 27. Nishizawa, Y., J. Usukura, D. P. Singh, L. T. Chylack, Jr., and T. Shinohara. 2001. Spatial and temporal dynamics of two alternatively spliced regulatory factors, lens epithelium-derived growth factor (ledgf/p75) and p52, in the nucleus. Cell Tissue Res. 305:107-114. [PubMed] 28. Ochs, R. L., Y. Muro, Y. Si, H. Ge, E. K. Chan, and E. M. Tan. 2000. Autoantibodies to DFS 70 kd/transcription coactivator p75 in atopic dermatitis and other conditions. J. Allergy Clin. Immunol. 105:1211-1220. [PubMed] 29. Patton, J. T., and M. H. Kaufman. 1995. The timing of ossification of the limb bones, and growth rates of various long bones of the fore and hind limbs of the prenatal and early postnatal laboratory mouse. J. Anat. 186(Pt. 1):175-185. [PubMed] 30. Saegusa, H., N. Takahashi, S. Noguchi, and H. Suemori. 1996. Targeted disruption in the mouse Hoxc-4 locus results in axial skeleton homeosis and malformation of the xiphoid process. Dev. Biol. 174:55-64. [PubMed] 31. Shaw, G., S. Morse, M. Ararat, and F. L. Graham. 2002. Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells. FASEB J. 16:869-871. [PubMed] 32. Shinohara, T., D. P. Singh, and N. Fatma. 2002. LEDGF, a survival factor, activates stress-related genes. Prog. Retinal Eye Res. 21:341-358. 33. Singh, D. P., E. Kubo, Y. Takamura, T. Shinohara, A. Kumar, L. T. Chylack, Jr., and N. Fatma. 2006. DNA binding domains and nuclear localization signal of LEDGF: contribution of two helix-turn-helix (HTH)-like domains and a stretch of 58 amino acids of the N-terminal to the trans-activation potential of LEDGF. J. Mol. Biol. 355:379-394. [PubMed] 34. Singh, D. P., N. Ohguro, T. Kikuchi, T. Sueno, V. N. Reddy, K. Yuge, L. T. Chylack, Jr., and T. Shinohara. 2000. Lens epithelium-derived growth factor: effects on growth and survival of lens epithelial cells, keratinocytes, and fibroblasts. Biochem. Biophys. Res. Commun. 267:373-381. [PubMed] 35. Sutherland, H. G., G. K. Mumford, K. Newton, L. V. Ford, R. Farrall, G. Dellaire, J. F. Caceres, and W. A. Bickmore. 2001. Large-scale identification of mammalian proteins localized to nuclear sub-compartments. Hum. Mol. Genet. 10:1995-2011. [PubMed] 36. Turlure, F., G. Maertens, S. Rahman, P. Cherepanov, and A. Engelman. 2006. A tripartite DNA-binding element, comprised of the nuclear localization signal and two AT-hook motifs, mediates the association of LEDGF/p75 with chromatin in vivo. Nucleic Acids Res. 34:1663-1675. [PubMed] 37. Vanegas, M., M. Llano, S. Delgado, D. Thompson, M. Peretz, and E. Poeschla. 2005. Identification of the LEDGF/p75 HIV-1 integrase-interaction domain and NLS reveals NLS-independent chromatin tethering. J. Cell Sci. 118:1733-1743. [PubMed] 38. Wu, X., T. Daniels, C. Molinaro, M. B. Lilly, and C. A. Casiano. 2002. Caspase cleavage of the nuclear autoantigen LEDGF/p75 abrogates its prosurvival function: implications for autoimmunity in atopic disorders. Cell Death Differ. 9:915-925. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||||||
EMBO J. 1998 Nov 16; 17(22):6723-9.
[EMBO J. 1998]Autoimmun Rev. 2003 Sep; 2(5):290-7.
[Autoimmun Rev. 2003]Cell Death Differ. 2002 Sep; 9(9):915-25.
[Cell Death Differ. 2002]Cell Tissue Res. 2001 Jul; 305(1):107-14.
[Cell Tissue Res. 2001]J Allergy Clin Immunol. 2000 Jun; 105(6 Pt 1):1211-20.
[J Allergy Clin Immunol. 2000]Hum Mol Genet. 2001 Sep 1; 10(18):1995-2011.
[Hum Mol Genet. 2001]J Cell Sci. 2005 Apr 15; 118(Pt 8):1733-43.
[J Cell Sci. 2005]Trends Biochem Sci. 2003 Feb; 28(2):69-74.
[Trends Biochem Sci. 2003]J Mol Biol. 2002 Jul 26; 320(5):1053-63.
[J Mol Biol. 2002]Proc Natl Acad Sci U S A. 2005 Nov 29; 102(48):17308-13.
[Proc Natl Acad Sci U S A. 2005]J Biol Chem. 2004 Nov 19; 279(47):48883-92.
[J Biol Chem. 2004]J Biol Chem. 2003 Aug 29; 278(35):33528-39.
[J Biol Chem. 2003]J Cell Sci. 2005 Apr 15; 118(Pt 8):1733-43.
[J Cell Sci. 2005]Nat Med. 2005 Dec; 11(12):1287-9.
[Nat Med. 2005]J Biol Chem. 2005 Jul 8; 280(27):25517-23.
[J Biol Chem. 2005]J Biol Chem. 2004 Dec 31; 279(53):55570-7.
[J Biol Chem. 2004]Hum Mol Genet. 2001 Sep 1; 10(18):1995-2011.
[Hum Mol Genet. 2001]Leuk Res. 2005 Dec; 29(12):1469-72.
[Leuk Res. 2005]BMC Genet. 2001; 2():20.
[BMC Genet. 2001]Ann N Y Acad Sci. 2005 Jun; 1044():109-16.
[Ann N Y Acad Sci. 2005]Hum Mol Genet. 2001 Sep 1; 10(18):1995-2011.
[Hum Mol Genet. 2001]Hum Mol Genet. 2001 Sep 1; 10(18):1995-2011.
[Hum Mol Genet. 2001]Mol Cell Biol. 2003 Dec; 23(23):8519-27.
[Mol Cell Biol. 2003]J Anat. 1995 Feb; 186 ( Pt 1)():175-85.
[J Anat. 1995]Hum Mol Genet. 2001 Sep 1; 10(18):1995-2011.
[Hum Mol Genet. 2001]Mol Biol Cell. 2000 Sep; 11(9):3061-71.
[Mol Biol Cell. 2000]Hum Mol Genet. 2001 Sep 1; 10(18):1995-2011.
[Hum Mol Genet. 2001]J Cell Sci. 2004 Jul 15; 117(Pt 16):3459-71.
[J Cell Sci. 2004]Nat Med. 2005 Dec; 11(12):1287-9.
[Nat Med. 2005]Dev Dyn. 1998 Jun; 212(2):267-76.
[Dev Dyn. 1998]Science. 2005 Sep 2; 309(5740):1564-6.
[Science. 2005]EMBO J. 1996 Dec 16; 15(24):7129-36.
[EMBO J. 1996]Biochem Biophys Res Commun. 2000 Jan 7; 267(1):373-81.
[Biochem Biophys Res Commun. 2000]Proc Natl Acad Sci U S A. 1994 Dec 20; 91(26):12644-8.
[Proc Natl Acad Sci U S A. 1994]Genes Dev. 1993 Nov; 7(11):2085-96.
[Genes Dev. 1993]Mech Dev. 1994 Jun; 46(3):231-47.
[Mech Dev. 1994]Nat Med. 2005 Dec; 11(12):1287-9.
[Nat Med. 2005]FASEB J. 2002 Jun; 16(8):869-71.
[FASEB J. 2002]Autoimmun Rev. 2003 Sep; 2(5):290-7.
[Autoimmun Rev. 2003]EMBO J. 1998 Nov 16; 17(22):6723-9.
[EMBO J. 1998]Biochem Biophys Res Commun. 2000 Jan 7; 267(1):373-81.
[Biochem Biophys Res Commun. 2000]J Mol Biol. 2002 Jul 26; 320(5):1053-63.
[J Mol Biol. 2002]Proc Natl Acad Sci U S A. 1994 Dec 20; 91(26):12644-8.
[Proc Natl Acad Sci U S A. 1994]Genes Dev. 1993 Nov; 7(11):2085-96.
[Genes Dev. 1993]Mech Dev. 1994 Jun; 46(3):231-47.
[Mech Dev. 1994]Dev Biol. 1996 Feb 25; 174(1):55-64.
[Dev Biol. 1996]Nat Med. 2005 Dec; 11(12):1287-9.
[Nat Med. 2005]Mol Cell. 1998 Dec; 2(6):751-9.
[Mol Cell. 1998]Genes Dev. 2005 Mar 1; 19(5):536-41.
[Genes Dev. 2005]Leuk Res. 2005 Dec; 29(12):1469-72.
[Leuk Res. 2005]BMC Genet. 2001; 2():20.
[BMC Genet. 2001]Ann N Y Acad Sci. 2005 Jun; 1044():109-16.
[Ann N Y Acad Sci. 2005]