![]() | ![]() |
Formats:
|
||||||||||||||
Copyright © 2002, Cold Spring Harbor Laboratory Press Novel Fluorescence Labeling and High-Throughput Assay Technologies for In Vitro Analysis of Protein Interactions 1Department of Applied Chemistry, Faculty of Science and Technology, Keio University, Yokohama 223-8522, Japan; 2Mitsubishi Kagaku Institute of Life Sciences, Machida 194-8511, Japan; 3Research Institute for Electronic Science, Hokkaido University, Sapporo 060-0812, Japan; 4Tsukuba Technical Center, Ikeda Scientific Corporation, Tsukuba 305-0062, Japan; 5 Department of Applied Chemistry, Faculty of Engineering, Ehime University, Matsuyama 790-8577, Japan 6Corresponding author. Received October 11, 2001; Accepted December 14, 2001. This article has been cited by other articles in PMC.Abstract We developed and tested a simple method for fluorescence labeling and interaction analysis of proteins based on a highly efficient in vitro translation system combined with high-throughput technologies such as microarrays and fluorescence cross-correlation spectroscopy (FCCS). By use of puromycin analogs linked to various fluorophores through a deoxycytidylic acid linker, a single fluorophore can be efficiently incorporated into a protein at the carboxyl terminus during in vitro translation. We confirmed that the resulting fluorescently labeled proteins are useful for probing protein–protein and protein–DNA interactions by means of pulldown assay, DNA microarrays, and FCCS in model experiments. These fluorescence assay systems can be easily extended to highly parallel analysis of protein interactions in studies of functional genomics. [Online supplementary material available at http://www.genome.org.] The draft sequences of the human genome appear to contain about 30,000–40,000 protein-coding genes (Lander et al. 2001; Venter et al. 2001). For most of them, full-length cDNAs may soon be available (Strausberg et al. 1999; Wiemann et al. 2001), and thus the large-scale analysis of protein interactions (i.e., protein–protein, protein–DNA, and protein–substrate interactions) will become possible. In recent years, fluorescence assay technologies have played an increasing role in the high-throughput analysis of protein interactions. In microarray technologies, for example, >10,000 DNAs or proteins can be arrayed on a single slide glass and probed with fluorescently labeled proteins for the large-scale analysis of protein–DNA and protein–protein interactions (Schena et al. 1995; Bulyk et al. 1999; MacBeath and Schreiber 2000; Haab et al. 2001; Zhu et al. 2001). In contrast to the microarray analyses that detect protein interactions on a solid phase, fluorescence cross-correlation spectroscopy (FCCS) made it possible to monitor interactions of fluorescent molecules in liquid solution (Schwille et al. 1997; Kettling et al. 1998; Koltermann et al. 1998; Bieschke et al. 2000; Rippe 2000). In the FCCS analysis, the sample volume is quite small (~1 fL) and analysis rates of 10,000 samples per day can potentially be achieved (Koltermann et al. 1998). These miniaturized assay systems based on fluorescence are expected to facilitate the in vitro analysis of protein interactions on a genome-wide level. One of the most crucial and laborious steps in such fluorescence assay systems is obtaining the protein samples labeled with fluorescent dyes. Most frequently, the proteins have been expressed in living cells, purified to homogeneity, and then fluorescently labeled by chemical modification of the amino, sulfhydryl, and hydroxyl groups of side chains of amino acids such as lysine, cysteine, serine, and threonine. Applying these procedures to thousands of proteins is a daunting task and also has several other demerits. Bacterial expression of eukaryotic genes can produce only those proteins that do not affect cellular metabolism and often fails to yield correctly folded proteins. Moreover, chemical modifications of amino acid side chains often affect the enzymatic or binding activities of the proteins. To overcome these limitations, a simple method for the fluorescence labeling of proteins has been developed, in which the target cDNA product is synthesized in vitro and its carboxyl terminus is simultaneously labeled with a puromycin–fluorophore conjugate on the ribosome (Nemoto et al. 1999; Miyamoto-Sato et al. 2000). This method can be performed in one step (the expression and labeling steps are synchronized and a purification step before labeling is unnecessary) and is thus suitable for the large-scale analysis of proteins. By use of a highly efficient cell-free protein synthesis system (Madin et al. 2000), large amounts of active proteins, high-molecular-weight proteins, and even harmful proteins are expected to be obtainable in labeled form with this method. Furthermore, carboxy-terminal labeling would be much less perturbative for the protein function than chemical modification of internal residues, because the protein terminal regions have large flexibility in general and tend to be located far from the active site (Thornton and Sibanda 1983). Here we describe the establishment of a fluorescence assay system for in vitro analysis of protein interactions by combining a simple protein labeling method, an efficient cell-free protein synthesis system, and miniaturized assay systems such as microarray and FCCS technologies. We have used classical oncogenes, Fos and Jun, as model proteins, because they are known to form a heterodimer that specifically binds to a DNA sequence (Angel and Karin 1991) and thus they can be used to examine both protein–protein and protein–DNA interactions. RESULTS AND DISCUSSION Fluorescence Labeling with Puromycin AnalogsPuromycin is an antibiotic that mimics the aminoacyl end of tRNA and acts as a translation inhibitor by being linked to the nascent peptide by the peptidyl transferase activity of the ribosome. Recently, it has been shown that puromycin and its derivatives at low concentrations can bind to the carboxyl terminus of full-length proteins (Miyamoto-Sato et al. 2000) and that a fluorescein–puromycin conjugate was successfully used for the fluorescein labeling of proteins (Nemoto et al. 1999). To confirm the general utility of this labeling method, we chemically synthesized various puromycin analogs containing a different fluorophore such as fluorescein, rhodamine green (RhG), tetramethyl-rhodamine (TAMRA), Cy3, or Cy5. Further, one or two (deoxy-)cytidylic acid(s) (i.e., dC, dCdC, rC, or rCrC) was inserted between fluorophore and puromycin as a linker (Fig. (Fig.1A)1
The Fos and Jun proteins were labeled with all the fluorophores. A typical result for RhG-dC-puromycin is shown in Figure Figure1C.1 Figure Figure22
Detecting Protein–Protein Interactions by Pulldown AssayAs the bait protein, Fos was fused with the IgG-binding domain of protein A (ZZ domain) and calmodulin-binding peptide (CBP) for a tandem affinity purification method (Rigaut et al. 1999; Fig. Fig.3A).3
Detecting Protein–DNA Interactions with DNA MicroarraysDNA microarrays have been used widely for monitoring gene expression patterns (Schena et al. 1995) but also can potentially be used for studying sequence-specific protein–DNA interactions (Bulyk et al. 1999; Iyer et al. 2001). We have tested this application by using as probes Fos/Jun proteins carboxy-terminally labeled with TAMRA-conjugated puromycin. The Fos–Jun heterodimer is known to bind to DNA containing a TGA(G/C)TCA consensus sequence (Angel and Karin 1991). We arrayed Cy5-labeled DNA containing or not containing the target sequence on poly-L-lysine-coated slides using commercially available arrayers (Fig. (Fig.4A).4
Kinetic Analysis of Protein Interactions with FCCSFluorescence correlation spectroscopy (FCS) is a new, highly sensitive method that can, in principle, detect the motion or fluctuation of a single fluorescent molecule in a solution volume of <1 fL (Eigen and Rigler 1994; Rigler 1995; Maiti et al. 1997). By autocorrelation function analysis of the fluorescence fluctuations, the diffusion time and the molecular weight of the fluorescent molecule can be determined. Although FCS was invented >25 years ago, it has been applied only recently in the field of biology; for example, in vitro studies of DNA hybridization (Schwille et al. 1997), DNA amplification (Kinjo 1998), protein–protein interaction (Pack et al. 2000), protein aggregation (Pitschke et al. 1998; Bieschke et al. 2000), and protein dynamics (Haupts et al. 1998), and in vivo studies of protein transport (Terada et al. 2000) and flagellum rotation (Cluzel et al. 2000). The detection of protein interactions with single-color FCS requires drastic changes of the size or shape of the protein complex (Pack et al. 2000). In contrast, the FCCS (dual-color FCS) analysis is independent of the size and shape of the fluorescent molecule, but rather is based on the identification of fluctuations that occur simultaneously in two detected channels (Schwille et al. 1997). Hence, this method makes it possible to monitor whether two molecules labeled with different fluorophores bind or not, with higher sensitivity, specificity, and speed than those of single-color FCS. Here we have shown the quantitative analysis of protein–DNA interactions with FCCS (Fig. (Fig.5).5
In summary, we have established a simple method for fluorescence labeling of proteins and confirmed that the resulting fluorescently labeled proteins are useful for probing protein–protein and protein–DNA interactions by means of pulldown assay, DNA microarrays, and FCCS measurements. To our knowledge, this work is the first to describe the successful detection of protein–DNA interactions with FCCS and DNA microarray by using fluorescently labeled proteins. These assay systems should also be applicable to the detection of protein–protein interactions. Our labeling method is so simple that it can easily be extended to the large-scale analysis of proteins, and, hence, we believe that these technologies will contribute greatly to studies of genomic function. METHODS Synthesis of Fluorescent Puromycin DerivativesProtected nucleoside phosphoramidites, fluorophore phosphoramidites, 5′-amino-modifier C6 phosphoramidite, and Poly-pak II cartridges were purchased from Glen Research. Rhodamine green succinimidyl ester (RhG-OSu) was purchased from Molecular Probes. N-Fluorenylmethoxycarbonylpuromycin and N-t-butyloxycarbonylpuromycin attached to controlled pore glass supports [Puromycin(Fmoc)-CPG and Puromycin(Boc)-CPG] were synthesized according to the published procedure (Ikeda et al. 1998). Fluorescein–[X]–puromycin, Cy5–[X]–puromycin and TAMRA–dC–puromycin were synthesized from Puromycin(Fmoc)-CPG according to the standard solid-phase phosphoramidite method (Ikeda et al. 1998). After deprotection according to the recommended protocol (Glen Research) for nucleosides and fluorophores, fluorescent puromycin analogs were purified by reverse-phase HPLC on a YMC-Pack ODS-A column (2 cm × 30 cm, YMC, Kyoto, Japan) with 0.1 M triethylammonium acetate (pH 7.0) as solvent A and acetonitrile as solvent B at a flow rate of 10 mL/min. A linear gradient of 10%–60% solvent B over 30 min was used for elution. The 5′-amino-modifier C6–[X]–puromycin(Boc) was synthesized from Puromycin(Boc)-CPG according to the standard solid-phase phosphoramidite method. After deprotection according to the recommended protocol for each nucleoside, the puromycin analogs were purified by reverse-phase HPLC under the elution condition described above. The 5′-amino-modifier C6–[X]–puromycin(Boc) was then reacted with RhG-OSu (5 equivalent) in 0.1 M NaHCO3 (pH 8.3)/dimethylformamide (1:1, vol/vol) at 25°C for 2 h. Desalting by the Poly-pak II cartridge, acid treatment (60% CF3COOH-H2O, 25°C, 30 min), and following HPLC purification under the elution condition described above gave RhG-[X]-puromycin. The structures of fluorescent puromycin analogs were confirmed by MALDI-TOF mass spectrometry (Lasermat 2000, Thermo Finnigan). A list of structures (Supplementary Fig. 1), and UV and Mass spectral data (Supplementary Table 1) of fluorescent puromycin analogs were provided as supplemental data on the web site. Fluorescence Labeling of ProteinsThe template DNAs encoding c-Fos (118–211 amino acids) and c-Jun (216–318 amino acids) genes (Fig. (Fig.1B)1 Pulldown Assay A tandem affinity purification method (Rigaut et al. 1999) was used. A c-fos gene fused with a tandem affinity tag, that is, the ZZ domain from pEZZ18 (Amersham Pharmacia Biotech) and synthesized CBP gene, was constructed by PCR (see supplemental data on the web site). The ZZ–CBP–Fos fusion protein was synthesized by use of the wheat cell-free dialysis system (Madin et al. 2000) and incubated with the fluorescently labeled Jun or Fos (negative control) in a buffer (10 mM Tris-HCl at pH 8.0, 150 mM NaCl, and 0.1% NP-40) at 37°C for 30 min. According to the protocol described previously (Rigaut et al. 1999), the ZZ–CBP–Fos–Jun complex was captured on IgG Sepharose (Amersham Pharmacia Biotech), digested with TEV protease (Invitrogen), and captured on calmodulin beads (Stratagene). Each of the flowthrough and eluate fractions was analyzed by Tricine-SDS-PAGE with a Molecular Imager FX. DNA Microarrays The 1.9-kb fragments of double-stranded DNA (dsDNA) were prepared by PCR with Cy5-labeled primers from pET20b (Novagen) or from its plasmid derivative, pET20-FJ, containing a Fos/Jun bound sequence, TGA(G/C)TCA, in a XhoI site of pET20b. Similarly, nonlabeled competitive dsDNA (0.3 kb) with the target sequence was prepared. The PCR products were purified with a QIAquick PCR purification kit (QIAGEN) and the Cy5-labeled DNAs (0.4 mg/mL) were printed on commercially available poly-L-lysine-coated glass slides (DNA-Ready Type II slides, Clontech) with a MicroGrid arrayer (BioRobotics). The slides were subjected to heating, UV cross-linking, and blocking according to the recommended protocols (Clontech) and then treated with a PBS solution containing 3% skim milk and 0.02% sodium azide at 4°C overnight and washed twice with PBS. As the fluorescent probe, in vitro translation reaction solution containing TAMRA-labeled Fos or Jun (10 nM) and unlabeled Fos or Jun (1 μM) was taken up in a buffer [50 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 1 mM EDTA, 1 mM DTT, 20% glycerol, 0.01% NP-40, 50 mM NaCl, and 10 μg/mL poly(dIdC)] and applied to the DNA-arrayed slides. After a 10-min incubation at room temperature, the slides were washed twice with the previous buffer, twice with PBS, and then centrifuged at 200g for 1 min to remove excess buffer. The slides were scanned with a laser fluorescence scanner GenePix 4000A (Axon Instruments) to detect the interaction signals from the TAMRA-labeled Jun proteins (excited at 532 nm) and the Cy5-labeled DNA (excited at 635 nm). Fluorescence Cross-Correlation SpectroscopyThe RhG-labeled Fos and Jun with carboxy-terminal His6-tag were purified on a Ni-NTA affinity column (QIAGEN), followed by size exclusion chromatography on a PD-10 column (Amersham Pharmacia Biotech) twice. The Cy5-labeled dsDNA was prepared by the hybridization of two complementary 20-nucleotide ssDNAs (TTCTCCTATGACTCATCCAT and AATGGATGAGTCATA-GGAGA, Fos/Jun-binding sequence in italics), which were synthesized with Cy5-label at their 5′-ends and HPLC-purified by Sigma Genosys Japan. Unlabeled Fos and Jun proteins were synthesized by use of the wheat cell-free dialysis system (Madin et al. 2000). Dual-color FCCS measurements and data analysis were carried out on a ConfoCor 2 fluorescence correlation microscope (Jankowski and Janka 2001) according to manufacturer's manual (Carl Zeiss). The details of the measurement setup have been described earlier (Schwille et al. 1997; Kettling et al. 1998; Koltermann et al. 1998). The RhG-labeled Fos or Jun, the Cy5-labeled dsDNA, and unlabeled Fos or Jun were immediately mixed in a buffer (10 mM Tris-HCl at pH 7.5, and 0.1 M NaCl) and incubated at 37°C for 30 min. Samples of 10 μL were applied to a coverglass chamber (Nalge Nunc), which was set on an objective lens (C-Apochromat 40× 1.2W; Carl Zeiss). The samples were excited by two laser beams at 488 nm (RhG) and 633 nm (Cy5) in the femtoliter focal volume positioned 200 μm above the surface of the glass. All measurements were performed at room temperature (23°C). Acknowledgments We thank Yoko Ogawa and Masato Yonezawa for assistance in the preparation of wheat germ extracts. This work was supported in part by Special Coordination Funds of the Science and Technology Agency (Ministry of Education, Culture, Sports, Science and Technology) of the Japanese Government. The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC section 1734 solely to indicate this fact. Footnotes E-MAIL hyana/at/applc.keio.ac.jp.; FAX 81-45-566-1440. Article and publication are at http://www.genome.org/cgi/doi/10.1101/gr.218802. Article published online before print in February 2002. REFERENCES
|
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||
Nature. 2001 Feb 15; 409(6822):860-921.
[Nature. 2001]Science. 2001 Feb 16; 291(5507):1304-51.
[Science. 2001]Science. 1999 Oct 15; 286(5439):455-7.
[Science. 1999]Genome Res. 2001 Mar; 11(3):422-35.
[Genome Res. 2001]Science. 1995 Oct 20; 270(5235):467-70.
[Science. 1995]FEBS Lett. 1999 Nov 26; 462(1-2):43-6.
[FEBS Lett. 1999]Nucleic Acids Res. 2000 Mar 1; 28(5):1176-82.
[Nucleic Acids Res. 2000]Proc Natl Acad Sci U S A. 2000 Jan 18; 97(2):559-64.
[Proc Natl Acad Sci U S A. 2000]J Mol Biol. 1983 Jun 25; 167(2):443-60.
[J Mol Biol. 1983]Biochim Biophys Acta. 1991 Dec 10; 1072(2-3):129-57.
[Biochim Biophys Acta. 1991]Nucleic Acids Res. 2000 Mar 1; 28(5):1176-82.
[Nucleic Acids Res. 2000]FEBS Lett. 1999 Nov 26; 462(1-2):43-6.
[FEBS Lett. 1999]Proc Natl Acad Sci U S A. 2000 Jan 18; 97(2):559-64.
[Proc Natl Acad Sci U S A. 2000]Nat Biotechnol. 1999 Oct; 17(10):1030-2.
[Nat Biotechnol. 1999]Science. 1995 Oct 20; 270(5235):467-70.
[Science. 1995]Nat Biotechnol. 1999 Jun; 17(6):573-7.
[Nat Biotechnol. 1999]Nature. 2001 Jan 25; 409(6819):533-8.
[Nature. 2001]Biochim Biophys Acta. 1991 Dec 10; 1072(2-3):129-57.
[Biochim Biophys Acta. 1991]Proc Natl Acad Sci U S A. 1994 Jun 21; 91(13):5740-7.
[Proc Natl Acad Sci U S A. 1994]J Biotechnol. 1995 Jul 31; 41(2-3):177-86.
[J Biotechnol. 1995]Proc Natl Acad Sci U S A. 1997 Oct 28; 94(22):11753-7.
[Proc Natl Acad Sci U S A. 1997]Biophys J. 1997 Apr; 72(4):1878-86.
[Biophys J. 1997]Biotechniques. 1998 Oct; 25(4):706-12, 714-5.
[Biotechniques. 1998]Nucleic Acids Res. 1996 Nov 15; 24(22):4487-94.
[Nucleic Acids Res. 1996]Proc Natl Acad Sci U S A. 2000 Jan 18; 97(2):559-64.
[Proc Natl Acad Sci U S A. 2000]Anal Biochem. 1987 Nov 1; 166(2):368-79.
[Anal Biochem. 1987]Nat Biotechnol. 1999 Oct; 17(10):1030-2.
[Nat Biotechnol. 1999]Proc Natl Acad Sci U S A. 2000 Jan 18; 97(2):559-64.
[Proc Natl Acad Sci U S A. 2000]Proc Natl Acad Sci U S A. 2000 Jan 18; 97(2):559-64.
[Proc Natl Acad Sci U S A. 2000]Biophys J. 1997 Apr; 72(4):1878-86.
[Biophys J. 1997]Proc Natl Acad Sci U S A. 1998 Feb 17; 95(4):1416-20.
[Proc Natl Acad Sci U S A. 1998]Proc Natl Acad Sci U S A. 1998 Feb 17; 95(4):1421-6.
[Proc Natl Acad Sci U S A. 1998]J Biol Chem. 1999 Jul 16; 274(29):20688-92.
[J Biol Chem. 1999]Nature. 1987 Feb 12-18; 325(6105):622-5.
[Nature. 1987]Cell. 1986 Jan 31; 44(2):283-92.
[Cell. 1986]Nucleic Acids Res. 1988 Feb 11; 16(3):883-93.
[Nucleic Acids Res. 1988]