![]() | ![]() |
Formats:
|
||||||||||||||||||||||
Copyright © 2006, American Society for Microbiology A Conserved Myc Protein Domain, MBIV, Regulates DNA Binding, Apoptosis, Transformation, and G2 Arrest† Departments of Pharmacology,1 Genetics, Norris Cotton Cancer Center, Dartmouth Medical School, One Medical Center Drive, Lebanon, New Hampshire 03756,2 Department of Molecular Biology, Princeton University, Princeton, New Jersey 085403 *Corresponding author. Mailing address: Department of Pharmacology, Norris Cotton Cancer Center, Dartmouth Medical School, One Medical Center Drive, Lebanon, NH 03756. Phone: (603) 653-9975. Fax: (603) 653-9952. E-mail: mcole/at/dartmouth.edu. Received October 6, 2005; Revised December 12, 2005; Accepted March 12, 2006. This article has been corrected. See Mol Cell Biol. 2006 July; 26(13): 5201. This article has been cited by other articles in PMC.Abstract The myc family of oncogenes is well conserved throughout evolution. Here we present the characterization of a domain conserved in c-, N-, and L-Myc from fish to humans, N-Myc317-337, designated Myc box IV (MBIV). A deletion of this domain leads to a defect in Myc-induced apoptosis and in some transformation assays but not in cell proliferation. Unlike other Myc mutants, MycΔMBIV is not a simple loss-of-function mutant because it is hyperactive for G2 arrest in primary cells. Microarray analysis of genes regulated by N-MycΔMBIV reveals that it is weakened for transactivation and repression but not nearly as defective as N-MycΔMBII. Although the mutated region is not part of the previously defined DNA binding domain, we find that N-MycΔMBIV has a significantly lower affinity for DNA than the wild-type protein in vitro. Furthermore, chromatin immunoprecipitation shows reduced binding of N-MycΔMBIV to some target genes in vivo, which correlates with the defect in transactivation. Thus, this conserved domain has an unexpected role in Myc DNA binding activity. These data also provide a novel separation of Myc functions linked to the modulation of DNA binding activity. Myc proteins drive a range of cellular responses, depending on the cellular context. Myc is an essential conduit for growth factors to induce proliferation, and ectopic expression of Myc can drive cells into cycle independently of growth factors (1, 17). Myc was first isolated as an oncogene, and supraphysiological expression of Myc drives tumorigenesis and cell transformation (11). The transformed phenotype is restricted by at least two other cellular responses to aberrant myc expression, apoptosis and growth arrest. In the absence of sufficient growth/survival factors, constitutive Myc expression induces apoptosis (2, 18), whereas some primary cells arrest in G2 phase in response to Myc overexpression (19). The molecular basis for these grossly different Myc activities remains unresolved. Myc is a basic helix-loop-helix (bHLH)/leucine zipper transcription factor that operates as a heterodimer with Max. Myc transactivates in part by binding to the TRRAP complex, recruiting histone acetylase activity to cellular promoters (7, 22, 39, 40). There is also evidence that Myc activates genes using CBP and Skp2 as cofactors (30, 55, 56), and Myc may also promote transcriptional elongation through recruitment of the positive transcription elongation factor b (16). Whole-genome array analysis has revealed that Myc binds to a large fraction of cellular promoters, activating around 5 to 15% of genes weakly depending on the cellular context and experimental system (6, 12, 20, 24, 27, 33, 37, 46, 50, 57). Defining which genes are responsible for driving the different Myc phenotypes continues to be a challenge. The Myc family members, c-Myc, N-Myc, and L-Myc, all function as oncogenes in different tumors and have a high degree of sequence conservation (11). c-Myc and N-Myc are particularly well conserved and have equivalent oncogenic activities (43). Furthermore, their coding regions can substitute for each other in mouse development (36). Myc proteins are also well conserved across species, which is reflected in the observation that the Drosophila myc gene, dmyc, can functionally substitute for mammalian c-Myc (49, 54). Characterization of the Myc protein has revealed several domains that are critical for different activities. The DNA binding domain was established by comparison to other bHLH proteins and found to be essential for gene activation (4, 5). In the N terminus, the prominent evolutionarily conserved domains are called Myc homology boxes (MBs). Of particular note is MBII, which is necessary for full transcriptional activation and repression. Mutation of this domain inhibits the binding of most Myc coactivators and also inhibits most Myc phenotypes (13, 18, 23, 43, 47, 53). In fact, the MBII deletion phenotype is so severe that MBII may be interpreted to be necessary for the integrity of the N terminus as a whole rather than as a distinct domain. The MBI domain has a more complex phenotype which is dependent on the extent of the mutation. MBI is a site of phosphorylation and is the only consistent site of Myc protein mutation found in some tumors (3, 35). MBI mutations can affect Myc protein turnover (26, 51), and larger deletions indicate that this domain is necessary for full activity in transformation assays (30, 53). Recent work has defined a third region of the Myc N terminus, MBIII, as a mediator of apoptosis, transformation, and tumorigenesis (28). Here we report the first characterization of a conserved domain within the N-Myc protein, Myc317-337, designated MBIV. Deletions within this domain cause unique changes in the induction of apoptosis, transformation, and G2 arrest that are reflective of an unexpected defect in Myc DNA binding activity. These data suggest novel conformational and/or cofactor requirements that mediate Myc biological activity. MATERIALS AND METHODS Mutations, cell maintenance, transfection, and retroviral infection. The mouse N-MycΔMBIV mutant was created using standard techniques and verified by sequencing. The mouse N-MycΔMBII mutant was previously described (43). Rat c-myc null fibroblasts (HO15.19 cells), human embryonic kidney 293 cells, human primary fibroblast BJ cells, RK3E cells, Rat-1a fibroblasts, rat embryo fibroblasts (REFs), mouse embryo fibroblasts (MEFs), and retroviral producer PhoeNX cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS). PhoeNX cells were transfected by using Fugene (Roche) according to the manufacturer's instructions, and infections were performed using standard protocols. Cells were maintained in 150 μg/ml hygromycin (Calbiochem) to select for cells containing LXSH-based constructs and 0.5 mg/ml G418 (Sigma) to select for pcDNA3.1-based constructs. Cell counts. Cells (2 × 104) were plated in six-well plates. Cells were trypsinized each day and counted using a hemocytometer, with at least 100 cells being counted. Cell counts were normalized to cells counted on the first day after seeding for each cell line. The experiment was performed twice. CFSE staining. Cells (106) were trypsinized, resuspended in 1 ml of 0.1% FCS-phosphate-buffered saline containing 5 μM, 5 (and 6)-carboxyfluorescein diacetate (CFDA) succinimidyl ester (SE) (CFSE; Molecular Probes catalog no. of C1157), and incubated for 10 min at 37°C. Cells were washed three times in phosphate-buffered saline and plated onto three 10-cm-diameter plates. Cells were trypsinized on days 1, 2, and 3 and analyzed by fluorescence-activated cell sorter (FACS) using a FACScan. Mean fluorescence intensity values were measured, and differences between measurements on subsequent days were calculated. Apoptosis. Cells maintained in 0.1% serum for 24 h were ethanol fixed and incubated overnight in 8 μg/ml propidium iodide (PI; Sigma) and 40 μg/ml RNase H (Sigma). PI content was analyzed using FACScan. Transformation and soft agar assays. REFs were extracted from day-15 rat embryos. Two days after extraction, 70% confluent 10-cm-diameter plates were transfected with 1 μg human H-RasG12V and 1 μg CβF (vector), CβF N-MycWT, N-MycΔMBII, N-MycΔMBIV, and 0.1 μg pcDNA3.1 (G418 resistance). For each transfection, three plates were maintained for 10 days in DMEM-5% FCS, and one plate was selected with G418. After 10 days, foci were counted and normalized to G418-resistant colonies. Foci formed relative to N-MycWT were calculated. For soft agar, Rat-1a fibroblasts were infected with LXSH N-MycWT, N-MycΔMBII, N-MycΔMBIV, or vector control, and pools were drug selected with hygromycin. Cells were plated in soft agar in triplicate in six-well plates. The bottom layer consisted of 0.6% noble agar-DMEM-10% FCS, and the upper layer consisted of 1 × 104 cells suspended in 0.3% noble agar-DMEM-10% FCS. After 12 days, the number of foci larger than 50 μm was counted in five fields from each well. Foci formed relative to N-MycWT were calculated. For focus formation, 104 cells of the same Rat-1a lines above were mixed with 2 × 106 Rat-1a cells and plated. Cells were maintained for 10 days, fixed in methanol, and stained with 0.1% methylene blue. Foci were counted for cultures in triplicate. The RK3E transformation assay was performed as described previously (21). Briefly, viral supernatants from a 10-cm plate of PhoeNX cells were diluted and used to infect a 10-cm plate of RK3E cells with LXSH (vector) or the same vector with N-MycWT or N-MycΔMBIV. Cells were placed in selection to measure transfection efficiency or maintained for 3 weeks to allow focus formation. After 3 weeks, cells were fixed in methanol and stained with 0.1% methylene blue. Hygromycin-resistant colonies and foci were counted to determine the relative number of foci formed for two independent experiments. Subcellular fractionation. Myc null cells expressing N-MycWT, N-MycΔMBII, N-MycΔMBIV, and vector control were lysed by Dounce homogenization in hypotonic buffer. Nuclei and cytosol were separated by centrifugation at 1,600 × g. Nuclei were subsequently washed twice, and cytosol was clarified by further centrifugation at 6,000 × g. Nuclei were solubilized in F buffer containing 0.5% Triton. Protein content of the fractions was measured using the Bradford assay, and samples were normalized for protein content. Nuclear and cytosolic material from an equivalent amount of cells was immunoblotted for N-Myc, RNA polymerase II, and tubulin. Coimmunoprecipitation. Plates (with 10- or 15-cm diameters) of subconfluent cells were lysed in 1 or 2 ml of F buffer (52), and extracts were incubated overnight at 4°C with 20 μl anti-FLAG antibody-conjugated beads (Sigma) or 50 μl protein A/G beads with 1 μg of the relevant antibody. Beads were washed five times and resuspended in loading buffer. Immunoprecipitated protein was resolved on a sodium dodecyl sulfate-polyacrylamide gel, transferred to a polyvinylidene difluoride membrane, and blotted. Polyclonal anti-N-Myc antibodies and polyclonal anti-Max antibody were purchased from Santa Cruz Biotech. G2 arrest. Primary human fibroblast cells were transduced with retrovirus generated by transfecting packaging cells with LPCX, LPC-N-MycERTAM, LPC-N-MycΔMBII-ERTAM, or LPC-N-MycΔMBIV-ERTAM. Transduced cells were selected with 0.8 μg/ml puromycin. Resulting lines were not treated or treated for 48 h with 0.8 μM 4-hydroxytamoxifen (OHT). MEFs were transduced with retrovirus generated by transfecting packaging cells with LXSH, LXSH N-Myc, and LXSH N-MycΔMBIV. Cells were cultured in 0.5% FCS for 12 h. Cells were harvested for FACS analysis by trypsinization, fixed with ethanol, and then stained with propidium iodide using standard staining protocols. Samples were analyzed using the single laser FACScan. Resulting files were analyzed using FlowJo software. EMSA. Plates (10-cm diameter) of 293 cells were transfected with 1 μg Cβ S-Max and 1 μg Cβ S FLAG-N-Myc constructs for 2 days and lysed with 1 ml F buffer. Cell extract (2 μl) was mixed with 19 μl electrophoretic mobility shift assay (EMSA) buffer (20 mM Tris, pH 8.4, 50 mM KCl, 3 mM MgCl2, 1 mM dithiothreitol, 1 mM β-mercaptoethanol, 8% glycerol) and 1 μg salmon sperm DNA for 30 min at room temperature. Double-stranded, end-labeled probe (0.2 ng) (GATCCGTAAGACCACGTGGTCGTCAGGATC; bold type indicates the Myc/Max consensus binding site) was added for 30 min at room temperature. Complexes were identified by incubating 0.2 μg of the relevant polyclonal antibody with the reaction mixtures and assaying for a supershift or loss of band. Complexes were separated on 5% acrylamide 0.5× Tris-borate-EDTA-polyacrylamide gels run at 250 V at 4°C and visualized by phosphorimager. Bands were quantitated using ImageQuant software. ChIP. Chromatin immunoprecipitations (ChIPs) were carried out using an Upstate chromatin immunoprecipitation assay kit according to the manufacturer's instructions. PCR was carried out on resultant DNA samples using the following primer pairs: NME1, TGCTGAGAGGGAAAGGAGACAGG and TCAGCAAGCACCGCCGAAGTACC; NPM1, GGCCTACCTCACACTGTTGGAGG and TGAAGGTTGGCAAGAGTCGTAGAGC; CAD, CACTGGAACCAAGCAAACACC and AAGGTTGCTGCTGTGGAACTACC; HSP60, ACGAGACACTCACCATGACTTACG and TAGAAAGTGCTCCCCTTTTCTTC; RUVBL1, ACCCTTGCTGGCTAATGTGATCCT and AGATTGAGGAGGTGAAGAGCACCA; and p27, CGAAGCTTCAGTGATCAAGTGTACTGG and CCTTAAGAGCGCGCTCGCCAGC. IPs were carried out using polyclonal anti-N-Myc antibody (Santa Cruz) and monoclonal anti-CBP antibody (Lab Vision). Microarrays. Human BJ fibroblasts were stably transduced with hygromycin retrovirus constructs encoding LXSH N-MycWT, N-MycΔMBII, N-MycΔMBIV, or empty vector. Polyclonal cultures were expanded for the minimum time to reach two 15-cm dishes of subconfluent, log-phase cells. RNA was harvested by using an RNAeasy kit, and the RNA integrity and concentration were verified by gel electrophoresis. An independent culture of log-phase BJ cells was used to prepare a standard control RNA. The experimental and control RNAs were directly converted to cDNA with either Cy5- or Cy3-modified dCTP using an Agilent Technologies fluorescent direct label kit. Each Cy5-labeled experimental cDNA was mixed with a constant amount of control Cy3-labeled cDNA prepared from asynchronously growing, untransfected BJ fibroblasts and hybridized overnight to Agilent Human 1A version 2 oligonucleotide microarrays. Microarrays were washed and processed according to the supplier. Slides were scanned using a Genepix4000B (Axon Instruments). Only genes with a signal >20% above background and with at least 70% good data across the arrays were considered for further analysis. The data were centered to the average of the two vector-only arrays and filtered for average changes in signal for either N-MycWT or mutants that were above the threshold indicated. The microarray data for this study are fully accessible at https://genome.unc.edu. RESULTS The Myc family proteins have many conserved domains, some of which are conserved in the most distant Drosophila homolog, such as MBII and the DNA binding domain (25). Other domains within the Myc family are conserved only in vertebrates, such as amino acids 317 to 337 of murine N-Myc (Fig. (Fig.1).1
N-MycΔMBIV is normal for induction of proliferation but defective for apoptosis. Accelerated rates of cell proliferation and apoptosis are well-characterized responses to Myc expression. The myc null fibroblast cell line HO15.19 was used to investigate the ability of N-MycΔMBIV to induce proliferation and apoptosis without the complication of endogenous c-Myc (38). N-MycWT and mutants were introduced into myc null fibroblasts by retroviral infection, and pools were selected. Equivalent amounts of N-MycΔMBIV protein and N-MycWT protein were expressed, demonstrating that this mutation does not affect protein synthesis or turnover rate (Fig. (Fig.2A).2A
The cell proliferation rate was measured by two methods. First, cell counts were made on sequential days (Fig. (Fig.2B).2B The ability of N-MycΔMBIV to induce apoptosis following serum deprivation was also measured. Apoptosis was quantitated by measuring the proportion of cells with sub-G1 DNA content by PI staining and FACS analysis (Fig. (Fig.3).3
N-MycΔMBIV is defective for some transformation assays. Exogenous Myc expression in primed cell systems can induce cell transformation. Since each transformation assay models subtly different aspects of tumorigenesis, we used four different well-established Myc transformation assays to determine the ability of N-MycΔMBIV to induce cell transformation: the REF-based Ras/Myc focus formation assay, the Rat-1a soft agar assay, the Rat-1a focus formation assay, and the RK3E focus formation assay. In the REF-based Ras/Myc focus formation assay, rat embryo fibroblasts are transfected with H-rasG12V and myc. Cooperation between these oncogenes results in foci on the cell monolayer (31). We transfected REFs with H-rasG12V and either vector control, N-mycWT, N-mycΔMBII, or N-mycΔMBIV. After 10 days, foci were counted and normalized for transfection efficiency (Fig. (Fig.4A).4A
In the soft agar assay, Rat-1a fibroblasts are cultured in suspension in soft agar, and fibroblasts expressing exogenous Myc are able to grow into colonies while vector control cells are not (53). We infected Rat-1a fibroblasts with N-mycWT, N-mycΔMBII, N-mycΔMBIV, or vector control and drug selected stable cell lines. Again, we found that expression levels of these proteins were comparable (not shown). When plated in soft agar, N-mycWT and N-mycΔMBIV induced equivalent numbers of colonies larger than 50 μm, whereas N-mycΔMBII was defective (Fig. (Fig.4B).4B Rat-1a cells can also be used for a focus formation assay. At confluence, Rat-1a cells form a tight monolayer, and expression of exogenous Myc allows cells to pile up into foci. We used the same cells as for the soft agar assay and assayed for focus formation when cells expressing N-Myc were plated at low density in a field of nontransformed cells (see Materials and Methods). Surprisingly, we found that N-MycWT-expressing cells formed foci, whereas N-MycΔMBIV-expressing cells did not (Fig. 4E and F In the rat RK3E cell transformation assay, exogenous Myc expression induces E1A-immortalized rat kidney cells to grow in well-defined foci on a monolayer (21). RK3E cells were infected with retroviral vectors expressing either nothing, N-MycWT, or N-MycΔMBIV. As with the myc null fibroblasts, the expression levels of N-MycWT and N-MycΔMBIV were comparable (not shown). Parallel cultures of RK3E cells were either left to grow to confluence and maintained for 3 weeks to allow focus formation or selected for the hygromycin resistance gene on the expression vector to assay for infection efficiency. Cells expressing N-MycWT but not the vector control became transformed, piling up into foci. Expression of N-MycΔMBIV also resulted in focus formation but with only 40% of the efficiency of N-MycWT (Fig. (Fig.4D).4D In summary, N-MycΔMBIV has activity equivalent to N-MycWT in the REF focus and Rat-1a soft agar assays but is defective in the Rat-1a and RK3E focus assays. The differential activities of N-MycΔMBIV in the latter assays suggest that this mutant can transform cells but is defective for some activities demanded by more stringent assays. MycΔMBIV is hyperactive for G2 arrest. Myc is well established as driving proliferation in many cell systems; however, in primary cells, expression of Myc can induce a G2 growth arrest (19). To assess the impact of our Myc mutants on G2 arrest, we created estrogen receptor (ER) fusion proteins for each and stably introduced them into human BJ fibroblasts. In estrogen receptor fusions, MycER is inactive until the addition of the ligand OHT (17, 34). After 48 h of tamoxifen addition, the proportion of cells in each phase of the cell cycle was measured by PI staining and FACS analysis (Fig. (Fig.5A,5A
We also investigated Myc-induced G2 accumulation in mouse embryonic fibroblasts. MEFs were infected with N-mycWT, N-mycΔMBIV, and control vectors. Log-phase cells grown in 10% FCS had equivalent FACS profiles (not shown). After 12 h of serum starvation, N-MycWT-expressing cells had a small but reproducible increase in the proportion of cells in G2. Consistent with the observation in human fibroblasts, N-MycΔMBIV-expressing cells had reproducibly more cells in G2 than MycWT (Fig. (Fig.5B5B N-MycΔMBIV is partially defective for transactivation and repression. N-MycΔMBIV is normal for induction of cell proliferation, defective for induction of apoptosis and in some transformation assays, and hyperactive for G2 arrest. We wanted to understand the modulation of these cell phenotypes in terms of Myc target gene activation and repression. Myc is a transcription factor, and previous studies have shown that the expression of Myc activates and represses a large number of genes by both direct and indirect mechanisms (14, 58). To compare the differential effects of N-MycWT, N-MycΔMBIV, and N-MycΔMBII on gene regulation, we extracted RNA from human BJ fibroblasts stably expressing these proteins and analyzed them by hybridization to Agilent Technologies 21K Oligo microarray (representing 15,463 unique unigene clusters). Equivalent Myc protein expression in these cell lines was established by Western blotting (Fig. (Fig.6A).6A
We found that the cells expressing N-MycWT showed increased expression of ~1,500 genes >1.5-fold and ~390 genes >2-fold. Among the activated genes were many previously described direct Myc targets (www.myc-cancer-gene.org), including ornithine decarboxylase, prothymosin, and nucleolin (see Table S1 in the supplemental material). We also found that many ribosomal protein genes (47 different genes) and genes encoding mitochondrial ribosomal proteins (20 different genes) were upregulated (6). N-MycΔMBIV upregulated significantly fewer genes than MycWT (Fig. (Fig.6B),6B Repression by Myc proteins paralleled activation, with the cells expressing N-MycWT showing decreased expression of a larger number of genes (~1,050 genes >1.5-fold and ~260 genes >2-fold) than the cells expressing N-MycΔMBIV (~500 genes >1.5-fold and ~100 genes >2-fold). Thus, N-MycΔMBIV appears to be equally defective for gene activation and repression. N-MycΔMBIV did not appear to regulate a different set of genes than N-MycWT, because on average 70 to 80% of N-MycΔMBIV-regulated genes were also regulated by N-MycWT. This degree of overlap within this experimental system strongly indicates that N-MycΔMBIV regulates mainly a subset of the N-MycWT-regulated genes. We were interested to know if we could account for the phenotypes of the N-MycΔMBIV and N-MycΔMBII mutants by examining the gene families they regulate. Sorting of the activated and repressed genes for N-MycWT and N-MycΔMBIV into functional categories by GO::TermFinder analysis did not reveal any significant differences between the functions of the regulated genes on a global scale (9). N-MycWT did not regulate additional gene families compared to N-MycΔMBIV; it simply regulated a larger number of genes in each family (data not shown). Clustering of the regulated genes for the arrays revealed the profile of gene activation and repression for each N-Myc protein (Fig. (Fig.6C).6C
The profile for N-MycΔMBII was very different from that of the other N-Myc proteins, indicating a general defect in both activation and repression of cellular genes. N-MycΔMBII activated only 167 genes >1.5-fold and 16 genes >2-fold. Repression was similarly defective, with only 212 genes repressed >1.5-fold and 21 genes repressed >2-fold. These values range from 5 to 20% of the number of N-MycWT-regulated genes. The vast majority of genes activated or repressed by N-MycWT and N-MycΔMBIV were only weakly activated or repressed by N-MycΔMBII. However, from a careful inspection of the profiles it is important to note that most of the genes that were regulated by N-MycWT were also regulated to a limited degree by N-MycΔMBII compared to the vector control, except that the extent of activation or repression was severely blunted and no longer passed the threshold of significance criteria. Even genes that continue to pass the threshold cutoff were almost always activated or repressed to a lesser extent than by MycWT (see Table S3 in the supplemental material). N-MycΔMBIV is defective for DNA binding in vitro. The microarray gene activation profile indicated that a differential effect on cellular gene regulation was the basis for the distinct phenotype of the N-MycΔMBIV mutant. In particular, N-MycΔMBIV was deficient in both activating and repressing approximately 40% of the genes that were responsive to N-MycWT. These data suggested that N-MycΔMBIV might have an altered interaction with chromosomal binding sites and/or nuclear cofactors. To explore these possibilities, we assessed the ability of this mutant to bind to DNA and to recruit nuclear factors. The most direct mechanism by which Myc is known to transactivate gene expression is by binding to the TRRAP complex, thereby recruiting histone acetyltransferase activity to promoters (39, 40). We first investigated whether N-MycΔMBIV could bind to TRRAP by coimmunoprecipitation. As previously published, TRRAP can be coimmunoprecipitated with N-MycWT but not N-MycΔMBII using an anti-Myc antibody (Fig. (Fig.7A).7A
Although N-MycΔMBIV is not part of the minimal functional DNA binding domain, it maps closest to this domain along the linear sequence. We therefore assessed whether Max binding and/or DNA binding was compromised in the N-MycΔMBIV mutant. We assayed for Myc-Max binding by coimmunoprecipitation. N-MycWT, N-MycΔMBII, and N-MycΔMBIV were expressed at comparable levels (Fig. (Fig.7B,7B N-MycΔMBIV displays defects in DNA binding to some Myc targets. To establish that N-MycΔMBIV is defective for DNA binding in vivo as well as in vitro, we measured N-MycWT and N-MycΔMBIV binding to the promoters of a group of Myc-regulated genes by using ChIP (8). We measured Myc binding to two genes equivalently upregulated by N-MycWT and N-MycΔMBIV (NME1 and NPM1) and three genes with reduced activation by N-MycΔMBIV (CAD, HSP60, and RUVBL1) (Fig. (Fig.8A).8A
A polyclonal anti-N-Myc antibody was used to immunoprecipitate N-Myc from myc null cells expressing N-MycWT, N-MycΔMBIV, or vector control. We confirmed that this antibody was able to immunoprecipitate both N-Myc proteins equivalently (data not shown). The resultant coprecipitated DNA or DNA from 1% of the IP input material was used as a template for PCR using primers directed to the promoter E-boxes of the Myc-upregulated genes (Fig. (Fig.8B).8B CBP is a c-Myc cofactor which binds to the c-Myc C terminus and is recruited to c-Myc target genes (55). Since N-MycΔMBIV is defective for DNA binding and the deletion maps near where CBP was reported to bind to c-Myc, we wanted to determine whether CBP recruitment to target genes is reduced by this mutant. ChIP was performed using the same cell lines as above, and complexes were immunoprecipitated using an anti-CBP antibody. When PCR was performed on the CBP-coprecipitated promoters, N-MycWT and N-MycΔMBIV were found to stimulate recruitment of CBP to Myc-regulated gene promoters by equivalent amounts (see Fig. S1 in the supplemental material). Therefore, N-MycΔMBIV is not defective for gene activation because it is defective for CBP recruitment. DISCUSSION In this paper, we characterize a previously unstudied domain of Myc that is highly conserved in evolution and which we designate MBIV. Myc protein lacking MBIV is defective for induction of apoptosis and in some transformation assays but is hyperactive for G2 arrest. Although this domain is not part of the previously described minimal DNA binding domain of Myc, we show here that it is required for maximal DNA binding and gene expression. MBIV is well conserved in c-Myc, N-Myc, and L-Myc and across all vertebrates. In particular, the sequence QHNYAA is invariant in all three Myc proteins from humans to fish, implying an important function for the domain. The primary sequence does not readily indicate its function, being a mixture of amino acids from different classes. The MBIV domain is necessary for maximal DNA binding. Since the structure has not been solved for any of the full-length Myc proteins, little can be said about the secondary structure or the position of the MBIV domain in the tertiary structure. Following the observation that c-Myc was a DNA binding protein, the minimal DNA binding domain was deduced from comparison with other bHLH proteins (4, 5). The crystal structure of the Myc/Max DNA binding domains in association with a consensus DNA sequence is known, but the MBIV region was not included (41). Here we demonstrate that although MBIV lies outside this minimal DNA binding domain, it is necessary for full Myc DNA binding activity within the intact protein. The only known protein with a direct role in Myc DNA binding activity is Max, but we find that Max dimerization is unaffected by the MBIV deletion. Since MBIV lies just upstream of the bHLH domain in the primary amino acid sequence, we suggest that this segment may lie close to the DNA binding domain in the tertiary structure. Deletion of MBIV may alter the structure of the DNA binding domain, or it could change the affinity of Myc for a nuclear cofactor that coordinates with Myc to regulate DNA binding. This putative altered structure or cofactor must exist in the nuclear lysates used for EMSA experiments, since these show reduced DNA binding activity for the mutant (Fig. (Fig.7).7 MBIV is required for apoptosis and some transformation assays. Microarray analysis showed that N-MycΔMBIV upregulated and repressed about 60% as many genes as N-MycWT. Despite the large aberration in gene expression, cell proliferation was found to be unaffected by this mutation. Either Myc may induce proliferation by redundant pathways or the major proliferative genes may fall mainly within the gene set that is regulated equivalently between N-MycWT and N-MycΔMBIV. Some transformation assays and apoptosis are defective in cells expressing N-MycΔMBIV and therefore appear to require a more robust Myc target gene response. Either the full complement of Myc target genes required to trigger these pathways is lacking or the genes governing these pathways are not being activated or repressed efficiently enough by N-MycΔMBIV. The N-Myc MBIV domain contrasts with a recently characterized nearby domain, MBIII (28). A Myc MBIII deletion increases apoptosis but decreases transformation. We are currently testing individual genes which are upregulated or downregulated by N-MycWT but not N-MycΔMBIV for the ability to contribute to apoptosis or transformation. However, the coordinated expression of a number of genes may be required to drive these phenotypes. MycΔMBIV is not a general Myc loss-of-function mutant. Unlike MycΔMBII, which has been demonstrated here and elsewhere to have a loss of function for almost all Myc phenotypes (18, 19, 23, 29, 53), MycΔMBIV exhibits a gain of function for inducing G2 arrest in primary fibroblasts. No genes appear to be activated or repressed by MycΔMBIV above the levels seen for a MycWT, and therefore the superinduction of a G2 arrest does not appear to be due to simple hyperactivation or repression of a Myc target gene(s). This suggests that the most likely explanation for the exaggerated G2 arrest phenotype is that Myc regulates genes which both drive and oppose G2 arrest. In the case of MycΔMBIV, the genes which oppose G2 arrest may be muted, leaving the genes that drive G2 arrest to dominate. Myc can induce a complex set of phenotypes in many different cell backgrounds. It remains unclear if the distinct phenotypes are a response to different target genes or a cell context-dependent response to a common target gene set. In the present study, we show that mutation of an evolutionarily conserved Myc domain results in the loss of a subset of target genes which correlates with enhancement and inhibition of different Myc phenotypes. This is in contrast with previously described Myc mutations, which either have no effect on or inhibit Myc phenotypes. The fact that this mutant can reduce Myc-induced apoptosis and transformation but enhance Myc-induced G2 arrest argues that the distinct target genes are involved in different phenotypes. Further analysis may allow the identification of the specific gene or genes involved in transformation or apoptosis. [Supplemental material]
Acknowledgments We thank Iulia Kotenko and Ruth Kilburn for technical assistance and Steve Fiering for providing valuable resources. We also thank the members of the Cole lab for input into the manuscript. This work was supported by a grant from the National Cancer Institute to M.D.C. M.L.W. was supported by Howard Hughes Medical Institute Biomedical Research Support Award 76200-560801 to Dartmouth College, American Cancer Society Institutional Award IRG-82-003-17 to the Norris Cotton Cancer Center, and a grant from the V Foundation for Cancer Research. M.L.W. is a V Scholar of the V Foundation for Cancer Research. Footnotes †Supplemental material for this article may be found at http://mcb.asm.org/. REFERENCES 1. Armelin, H. A., M. C. Armelin, K. Kelly, T. Stewart, P. Leder, B. H. Cochran, and C. D. Stiles. 1984. Functional role for c-myc in mitogenic response to platelet-derived growth factor. Nature 310:655-660. [PubMed] 2. Askew, D. S., R. A. Ashmun, B. C. Simmons, and J. L. Cleveland. 1991. Constitutive c-myc expression in an IL-3-dependent myeloid cell line suppresses cell cycle arrest and accelerates apoptosis. Oncogene 6:1915-1922. [PubMed] 3. Bhatia, K., K. Huppi, G. Spangler, D. Siwarski, R. Iyer, and I. Magrath. 1993. Point mutations in the c-Myc transactivation domain are common in Burkitt's lymphoma and mouse plasmacytomas. Nat. Genet. 5:56-61. [PubMed] 4. Blackwell, T. K., L. Kretzner, E. M. Blackwood, R. N. Eisenman, and H. Weintraub. 1990. Sequence-specific DNA binding by the c-Myc protein. Science 250:1149-1151. [PubMed] 5. Blackwood, E. M., and R. N. Eisenman. 1991. Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc. Science 251:1211-1217. [PubMed] 6. Boon, K., H. N. Caron, R. van Asperen, L. Valentijn, M. C. Hermus, P. van Sluis, I. Roobeek, I. Weis, P. A. Voute, M. Schwab, and R. Versteeg. 2001. N-myc enhances the expression of a large set of genes functioning in ribosome biogenesis and protein synthesis. EMBO J. 20:1383-1393. [PubMed] 7. Bouchard, C., O. Dittrich, A. Kiemaier, K. Dohmann, A. Menkel, M. Eilers, and B. Luscher. 2001. Regulation of cyclin D2 gene expression by the Myc/Max/Mad network: Myc-dependent TRRAP recruitment and histone acetylation at the cyclin D2 promoter. Genes Dev. 15:2042-2047. [PubMed] 8. Boyd, K. E., and P. J. Farnham. 1997. Myc versus USF: discrimination at the cad gene is determined by core promoter elements. Mol. Cell. Biol. 17:2529-2537. [PubMed] 9. Boyle, E. I., S. Weng, J. Gollub, H. Jin, D. Botstein, J. M. Cherry, and G. Sherlock. 2004. GO::TermFinder—open source software for accessing gene ontology information and finding significantly enriched gene ontology terms associated with a list of genes. Bioinformatics 20:3710-3715. [PubMed] 10. Bush, A., M. Mateyak, K. Dugan, A. Obaya, S. Adachi, J. Sedivy, and M. Cole. 1998. c-myc null cells misregulate cad and gadd45 but not other proposed c-Myc targets. Genes Dev. 12:3797-3802. [PubMed] 11. Cole, M. D. 1986. The myc oncogene: its role in transformation and differentiation. Annu. Rev. Genet. 20:361-385. [PubMed] 12. Coller, H. A., C. Grandori, P. Tamayo, T. Colbert, E. S. Lander, R. N. Eisenman, and T. R. Golub. 2000. Expression analysis with oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and adhesion. Proc. Natl. Acad. Sci. USA 97:3260-3265. [PubMed] 13. Conzen, S. D., K. Gottlob, E. S. Kandel, P. Khanduri, A. J. Wagner, M. O'Leary, and N. Hay. 2000. Induction of cell cycle progression and acceleration of apoptosis are two separable functions of c-Myc: transrepression correlates with acceleration of apoptosis. Mol. Cell. Biol. 20:6008-6018. [PubMed] 14. Dang, C. V. 1999. c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol. Cell. Biol. 19:1-11. [PubMed] 15. Dang, C. V., H. van Dam, M. Buckmire, and W. M. F. Lee. 1989. DNA-binding domain of human c-Myc produced in Escherichia coli. Mol. Cell. Biol. 9:2477-2486. [PubMed] 16. Eberhardy, S. R., and P. J. Farnham. 2002. Myc recruits P-TEFb to mediate the final step in the transcriptional activation of the cad promoter. J. Biol. Chem. 277:40156-40162. [PubMed] 17. Eilers, M., D. Picard, K. R. Yamamoto, and J. M. Bishop. 1989. Chimaeras of myc oncoprotein and steroid receptors cause hormone-dependent transformation of cells. Nature 340:66-68. [PubMed] 18. Evan, G. I., A. H. Wyllie, C. S. Gilbert, T. D. Littlewood, H. Land, M. Brooks, C. M. Waters, L. Z. Penn, and D. C. Hancock. 1992. Induction of apoptosis in fibroblasts by c-myc protein. Cell 69:119-128. [PubMed] 19. Felsher, D. W., A. Zetterberg, J. Zhu, T. Tlsty, and J. M. Bishop. 2000. Overexpression of MYC causes p53-dependent G2 arrest of normal fibroblasts. Proc. Natl. Acad. Sci. USA 97:10544-10548. [PubMed] 20. Fernandez, P. C., S. R. Frank, L. Wang, M. Schroeder, S. Liu, J. Greene, A. Cocito, and B. Amati. 2003. Genomic targets of the human c-Myc protein. Genes Dev. 17:1115-1129. [PubMed] 21. Foster, K. W., S. Ren, I. D. Louro, S. M. Lobo-Ruppert, P. McKie-Bell, W. Grizzle, M. R. Hayes, T. R. Broker, L. T. Chow, and J. M. Ruppert. 1999. Oncogene expression cloning by retroviral transduction of adenovirus E1A-immortalized rat kidney RK3E cells: transformation of a host with epithelial features by c-MYC and the zinc finger protein GKLF. Cell Growth Differ. 10:423-434. [PubMed] 22. Frank, S. R., M. Schroeder, P. Fernandez, S. Taubert, and B. Amati. 2001. Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation. Genes Dev. 15:2069-2082. [PubMed] 23. Freytag, S. O., C. V. Dang, and W. M. F. Lee. 1990. Definition of the activities and properties of c-myc required to inhibit cell differentiation. Cell Growth Differ. 1:339-343. [PubMed] 24. Frye, M., C. Gardner, E. R. Li, I. Arnold, and F. M. Watt. 2003. Evidence that Myc activation depletes the epidermal stem cell compartment by modulating adhesive interactions with the local microenvironment. Development 130:2793-2808. [PubMed] 25. Gallant, P., Y. Shiio, P. F. Cheng, S. M. Parkhurst, and R. N. Eisenman. 1996. Myc and Max homologs in Drosophila. Science 274:1523-1527. [PubMed] 26. Gregory, M. A., and S. R. Hann. 2000. c-Myc proteolysis by the ubiquitin-proteasome pathway: stabilization of c-Myc in Burkitt's lymphoma cells. Mol. Cell. Biol. 20:2423-2435. [PubMed] 27. Guo, Q. M., R. L. Malek, S. Kim, C. Chiao, M. He, M. Ruffy, K. Sanka, N. H. Lee, C. V. Dang, and E. T. Liu. 2000. Identification of c-myc responsive genes using rat cDNA microarray. Cancer Res. 60:5922-5928. [PubMed] 28. Herbst, A., M. T. Hemann, K. A. Tworkowski, S. E. Salghetti, S. W. Lowe, and W. P. Tansey. 2005. A conserved element in Myc that negatively regulates its proapoptotic activity. EMBO Rep. 6:177-183. [PubMed] 29. Kenney, A. M., M. D. Cole, and D. H. Rowitch. 2003. Nmyc upregulation by sonic hedgehog signaling promotes proliferation in developing cerebellar granule neuron precursors. Development 130:15-28. [PubMed] 30. Kim, S. Y., A. Herbst, K. A. Tworkowski, S. E. Salghetti, and W. P. Tansey. 2003. Skp2 regulates Myc protein stability and activity. Mol. Cell 11:1177-1188. [PubMed] 31. Land, H., L. F. Parada, and R. A. Weinberg. 1983. Tumorigenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature 304:596-602. [PubMed] 32. Landay, M., S. K. Oster, F. Khosravi, L. E. Grove, X. Yin, J. Sedivy, L. Z. Penn, and E. V. Prochownik. 2000. Promotion of growth and apoptosis in c-myc nullizygous fibroblasts by other members of the myc oncoprotein family. Cell Death Differ. 7:697-705. [PubMed] 33. Li, Z., S. Van Calcar, C. Qu, W. K. Cavenee, M. Q. Zhang, and B. Ren. 2003. A global transcriptional regulatory role for c-Myc in Burkitt's lymphoma cells. Proc. Natl. Acad. Sci. USA 100:8164-8169. [PubMed] 34. Littlewood, T. D., D. C. Hancock, P. S. Danielian, M. G. Parker, and G. I. Evan. 1995. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res. 23:1686-1690. [PubMed] 35. Lutterbach, B., and S. R. Hann. 1994. Hierarchical phosphorylation at N-terminal transformation-sensitive sites in c-Myc protein is regulated by mitogens and in mitosis. Mol. Cell. Biol. 14:5510-5522. [PubMed] 36. Malynn, B. A., I. M. de Alboran, R. C. O'Hagan, R. Bronson, L. Davidson, R. A. DePinho, and F. W. Alt. 2000. N-myc can functionally replace c-myc in murine development, cellular growth, and differentiation. Genes Dev. 14:1390-1399. [PubMed] 37. Mao, D. Y., J. D. Watson, P. S. Yan, D. Barsyte-Lovejoy, F. Khosravi, W. W. Wong, P. J. Farnham, T. H. Huang, and L. Z. Penn. 2003. Analysis of Myc bound loci identified by CpG island arrays shows that Max is essential for Myc-dependent repression. Curr. Biol. 13:882-886. [PubMed] 38. Mateyak, M. K., A. J. Obaya, S. Adachi, and J. M. Sedivy. 1997. Phenotypes of c-Myc-deficient rat fibroblasts isolated by targeted homologous recombination. Cell Growth Differ. 8:1039-1048. [PubMed] 39. McMahon, S. B., H. A. Van Buskirk, K. A. Dugan, T. D. Copeland, and M. D. Cole. 1998. The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell 94:363-374. [PubMed] 40. McMahon, S. B., M. A. Wood, and M. D. Cole. 2000. The essential cofactor TRRAP recruits the histone acetyltransferase hGCN5 to c-Myc. Mol. Cell. Biol. 20:556-562. [PubMed] 41. Nair, S. K., and S. K. Burley. 2003. X-ray structures of Myc-Max and Mad-Max recognizing DNA. Molecular bases of regulation by proto-oncogenic transcription factors. Cell 112:193-205. [PubMed] 42. Nikiforov, M. A., S. Chandriani, B. O'Connell, O. Petrenko, I. Kotenko, A. Beavis, J. M. Sedivy, and M. D. Cole. 2002. A functional screen for Myc-responsive genes reveals serine hydroxymethyltransferase, a major source of the one-carbon unit for cell metabolism. Mol. Cell. Biol. 22:5793-5800. [PubMed] 43. Nikiforov, M. A., S. Chandriani, J. Park, I. Kotenko, D. Matheos, A. Johnsson, S. B. McMahon, and M. D. Cole. 2002. TRRAP-dependent and TRRAP-independent transcriptional activation by Myc family oncoproteins. Mol. Cell. Biol. 22:5054-5063. [PubMed] 44. Nikiforov, M. A., I. Kotenko, O. Petrenko, A. Beavis, L. Valenick, I. Lemischka, and M. D. Cole. 2000. Complementation of Myc-dependent cell proliferation by cDNA expression library screening. Oncogene 19:4828-4831. [PubMed] 45. Obaya, A. J., I. Kotenko, M. D. Cole, and J. M. Sedivy. 2002. The proto-oncogene c-myc acts through the cyclin-dependent kinase (Cdk) inhibitor p27(Kip1) to facilitate the activation of Cdk4/6 and early G(1) phase progression. J. Biol. Chem. 277:31263-31269. [PubMed] 46. O'Connell, B. C., A. F. Cheung, C. P. Simkevich, W. Tam, X. Ren, M. K. Mateyak, and J. M. Sedivy. 2003. A large scale genetic analysis of c-Myc-regulated gene expression patterns. J. Biol. Chem. 278:12563-12573. [PubMed] 47. Oster, S. K., D. Y. Mao, J. Kennedy, and L. Z. Penn. 2003. Functional analysis of the N-terminal domain of the Myc oncoprotein. Oncogene 22:1998-2010. [PubMed] 48. Prescott, J. E., R. C. Osthus, L. A. Lee, B. C. Lewis, H. Shim, J. F. Barrett, Q. Guo, A. L. Hawkins, C. A. Griffin, and C. V. Dang. 2001. A novel c-Myc-responsive gene, JPO1, participates in neoplastic transformation. J. Biol. Chem. 276:48276-48284. [PubMed] 49. Schreiber-Agus, N., D. Stein, K. Chen, J. S. Goltz, L. Stevens, and R. A. DePinho. 1997. Drosophila Myc is oncogenic in mammalian cells and plays a role in the diminutive phenotype. Proc. Natl. Acad. Sci. USA 94:1235-1240. [PubMed] 50. Schuhmacher, M., F. Kohlhuber, M. Holzel, C. Kaiser, H. Burtscher, M. Jarsch, G. W. Bornkamm, G. Laux, A. Polack, U. H. Weidle, and D. Eick. 2001. The transcriptional program of a human B cell line in response to Myc. Nucleic Acids Res. 29:397-406. [PubMed] 51. Sears, R., F. Nuckolls, E. Haura, Y. Taya, K. Tamai, and J. R. Nevins. 2000. Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability. Genes Dev. 14:2501-2514. [PubMed] 52. Sommer, A., K. Bousset, E. Kremmer, M. Austen, and B. Luscher. 1998. Identification and characterization of specific DNA-binding complexes containing members of the Myc/Max/Mad network of transcriptional regulators. J. Biol. Chem. 273:6632-6642. [PubMed] 53. Stone, J., T. de Lange, G. Ramsay, E. Jakobovits, J. M. Bishop, H. Varmus, and W. Lee. 1987. Definition of regions in human c-myc that are involved in transformation and nuclear localization. Mol. Cell. Biol. 7:1697-1709. [PubMed] 54. Trumpp, A., Y. Refaeli, T. Oskarsson, S. Gasser, M. Murphy, G. R. Martin, and J. M. Bishop. 2001. c-Myc regulates mammalian body size by controlling cell number but not cell size. Nature 414:768-773. [PubMed] 55. Vervoorts, J., J. M. Luscher-Firzlaff, S. Rottmann, R. Lilischkis, G. Walsemann, K. Dohmann, M. Austen, and B. Luscher. 2003. Stimulation of c-MYC transcriptional activity and acetylation by recruitment of the cofactor CBP. EMBO Rep. 4:484-490. [PubMed] 56. von der Lehr, N., S. Johansson, S. Wu, F. Bahram, A. Castell, C. Cetinkaya, P. Hydbring, I. Weidung, K. Nakayama, K. I. Nakayama, O. Soderberg, T. K. Kerppola, and L. G. Larsson. 2003. The F-box protein Skp2 participates in c-Myc proteosomal degradation and acts as a cofactor for c-Myc-regulated transcription. Mol. Cell 11:1189-1200. [PubMed] 57. Watson, J. D., S. K. Oster, M. Shago, F. Khosravi, and L. Z. Penn. 2002. Identifying genes regulated in a Myc-dependent manner. J. Biol. Chem. 277:36921-36930. [PubMed] 58. Zeller, K. I., A. G. Jegga, B. J. Aronow, K. A. O'Donnell, and C. V. Dang. 2003. An integrated database of genes responsive to the Myc oncogenic transcription factor: identification of direct genomic targets. Genome Biol. 4:R69. [PubMed] 59. Zhang, X. Y., L. M. Desalle, J. H. Patel, A. J. Capobianco, D. Yu, A. Thomas-Tikhonenko, and S. B. McMahon. 2005. Metastasis-associated protein 1 (MTA1) is an essential downstream effector of the c-MYC oncoprotein. Proc. Natl. Acad. Sci. USA 102:13968-13973. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||
Nature. 1984 Aug 23-29; 310(5979):655-60.
[Nature. 1984]Nature. 1989 Jul 6; 340(6228):66-8.
[Nature. 1989]Annu Rev Genet. 1986; 20():361-84.
[Annu Rev Genet. 1986]Oncogene. 1991 Oct; 6(10):1915-22.
[Oncogene. 1991]Cell. 1992 Apr 3; 69(1):119-28.
[Cell. 1992]Genes Dev. 2001 Aug 15; 15(16):2042-7.
[Genes Dev. 2001]Genes Dev. 2001 Aug 15; 15(16):2069-82.
[Genes Dev. 2001]Cell. 1998 Aug 7; 94(3):363-74.
[Cell. 1998]Mol Cell Biol. 2000 Jan; 20(2):556-62.
[Mol Cell Biol. 2000]Mol Cell. 2003 May; 11(5):1177-88.
[Mol Cell. 2003]Annu Rev Genet. 1986; 20():361-84.
[Annu Rev Genet. 1986]Mol Cell Biol. 2002 Jul; 22(14):5054-63.
[Mol Cell Biol. 2002]Genes Dev. 2000 Jun 1; 14(11):1390-9.
[Genes Dev. 2000]Proc Natl Acad Sci U S A. 1997 Feb 18; 94(4):1235-40.
[Proc Natl Acad Sci U S A. 1997]Nature. 2001 Dec 13; 414(6865):768-73.
[Nature. 2001]Mol Cell Biol. 2002 Jul; 22(14):5054-63.
[Mol Cell Biol. 2002]Cell Growth Differ. 1999 Jun; 10(6):423-34.
[Cell Growth Differ. 1999]J Biol Chem. 1998 Mar 20; 273(12):6632-42.
[J Biol Chem. 1998]Science. 1996 Nov 29; 274(5292):1523-7.
[Science. 1996]Cell Growth Differ. 1997 Oct; 8(10):1039-48.
[Cell Growth Differ. 1997]Cell Death Differ. 2000 Aug; 7(8):697-705.
[Cell Death Differ. 2000]Cell Growth Differ. 1997 Oct; 8(10):1039-48.
[Cell Growth Differ. 1997]Genes Dev. 1998 Dec 15; 12(24):3797-802.
[Genes Dev. 1998]Oncogene. 2000 Oct 5; 19(42):4828-31.
[Oncogene. 2000]J Biol Chem. 2002 Aug 23; 277(34):31263-9.
[J Biol Chem. 2002]Nature. 1983 Aug 18-24; 304(5927):596-602.
[Nature. 1983]Mol Cell Biol. 2002 Jul; 22(14):5054-63.
[Mol Cell Biol. 2002]Mol Cell Biol. 1987 May; 7(5):1697-709.
[Mol Cell Biol. 1987]Cell Growth Differ. 1999 Jun; 10(6):423-34.
[Cell Growth Differ. 1999]Proc Natl Acad Sci U S A. 2000 Sep 12; 97(19):10544-8.
[Proc Natl Acad Sci U S A. 2000]Nature. 1989 Jul 6; 340(6228):66-8.
[Nature. 1989]Nucleic Acids Res. 1995 May 25; 23(10):1686-90.
[Nucleic Acids Res. 1995]Mol Cell Biol. 1999 Jan; 19(1):1-11.
[Mol Cell Biol. 1999]Genome Biol. 2003; 4(10):R69.
[Genome Biol. 2003]EMBO J. 2001 Mar 15; 20(6):1383-93.
[EMBO J. 2001]Bioinformatics. 2004 Dec 12; 20(18):3710-5.
[Bioinformatics. 2004]J Biol Chem. 2001 Dec 21; 276(51):48276-84.
[J Biol Chem. 2001]Proc Natl Acad Sci U S A. 2005 Sep 27; 102(39):13968-73.
[Proc Natl Acad Sci U S A. 2005]Mol Cell Biol. 2002 Aug; 22(16):5793-800.
[Mol Cell Biol. 2002]Cell. 1998 Aug 7; 94(3):363-74.
[Cell. 1998]Mol Cell Biol. 2000 Jan; 20(2):556-62.
[Mol Cell Biol. 2000]Mol Cell Biol. 1997 May; 17(5):2529-37.
[Mol Cell Biol. 1997]Curr Biol. 2003 May 13; 13(10):882-6.
[Curr Biol. 2003]EMBO Rep. 2003 May; 4(5):484-90.
[EMBO Rep. 2003]Science. 1990 Nov 23; 250(4984):1149-51.
[Science. 1990]Science. 1991 Mar 8; 251(4998):1211-7.
[Science. 1991]Cell. 2003 Jan 24; 112(2):193-205.
[Cell. 2003]Mol Cell Biol. 1989 Jun; 9(6):2477-86.
[Mol Cell Biol. 1989]EMBO Rep. 2005 Feb; 6(2):177-83.
[EMBO Rep. 2005]Cell. 1992 Apr 3; 69(1):119-28.
[Cell. 1992]Proc Natl Acad Sci U S A. 2000 Sep 12; 97(19):10544-8.
[Proc Natl Acad Sci U S A. 2000]Cell Growth Differ. 1990 Jul; 1(7):339-43.
[Cell Growth Differ. 1990]Development. 2003 Jan; 130(1):15-28.
[Development. 2003]Mol Cell Biol. 1987 May; 7(5):1697-709.
[Mol Cell Biol. 1987]