pmc logo image
Logo of rna
Journal List > RNA > v.12(7); Jul 2006

Formats:
RNA. 2006 July; 12(7): 1161–1167.
doi: 10.1261/rna.2322506.
PMCID: PMC1484437
Copyright © 2006 RNA Society
Post-transcriptional regulation of microRNA expression
Gregor Obernosterer,1,3 Philipp J.F. Leuschner,1,3 Mattias Alenius,2,3 and Javier Martinez1
1Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA), A-1030 Vienna, Austria
2Institute of Molecular Pathology (IMP), A-1030 Vienna, Austria
3These authors contributed equally to this work.
Reprint requests to: Javier Martinez, Institute of Molecular Biotechnology of the Austrian Academy of Sciences, Dr.-Bohr-Gasse 3-5, A-1030 Vienna, Austria; e-mail: javier.martinez/at/imba.oeaw.ac.at; fax: +43 (1) 79044-110.
Received December 12, 2005; Accepted April 24, 2006.
Freely available online through the open access option.
Small right arrow pointing to: This article has been cited by other articles in PMC.
Abstract
microRNAs (miRNAs) are endogenous, noncoding ~22-nucleotide RNA molecules that have recently emerged as fundamental, post-transcriptional regulators of cognate target gene expression. Many mammalian miRNAs are expressed in a tissue-specific manner, a phenomenon that has so far been attributed to transcriptional regulation. We here show by Northern blots and in situ hybridization experiments that the expression of mammalian miRNAs can be regulated at the post-transcriptional level. In particular, miR-138 is spatially restricted to distinct cell types, while its precursor, pre-miR-138-2, is ubiquitously expressed throughout all tissues analyzed. Furthermore, pre-miR-138-2 is exported from the nucleus to the cytoplasm, suggesting that cleavage of this pre-miRNA by Dicer is restricted to certain tissues and cell types. Thus, differential processing of pre-miRNAs might be an alternative mechanism to control miRNA function.
Keywords: microRNAs, post-transcriptional regulation, Dicer, tissue-specific expression
INTRODUCTION
miRNAs are a family of small (~22 nucleotides [nt]), endogenous, noncoding RNAs that, by binding complementary sequences in the 3′ untranslated region (3′ UTR) of messenger RNAs (mRNAs), either mediate translational repression or direct mRNA cleavage (Pillai 2005). miRNAs are transcribed as mono- or polycistronic, long, primary precursor transcripts (pri-miRNAs) that are cleaved into ~70-nt precursor hairpins, known as pre-miRNAs, by the nuclear RNase III-like enzyme Drosha (Lee et al. 2003). Subsequently, pre-miRNA hairpins are exported to the cytoplasm by Exportin-5 (Yi et al. 2003; Bohnsack et al. 2004; Lund et al. 2004), where they are processed by a second RNase III-like enzyme, termed Dicer, into ~22-nt duplexes (Bernstein et al. 2001; Hutvágner et al. 2001; Ketting et al. 2001; Knight & Bass 2001), followed by the asymmetric assembly of one of the two strands into a functional miRNP or miRISC (Khvorova et al. 2003; Schwarz et al. 2003).
More than 800 miRNAs have so far been experimentally discovered in mammals (Lagos-Quintana et al. 2001, 2002; Bentwich et al. 2005) and some of them are highly conserved between invertebrates and vertebrates (Bartel 2004). However, through the development of increasingly sophisticated algorithms based on machine learning techniques, the number of predicted miRNAs currently amounts to a few thousand (Lim et al. 2003; Bentwich et al. 2005; Berezikov et al. 2005). Many mammalian miRNAs are tissue- and/or developmental stage-specifically expressed. Several microarray profiling studies have shown that the expression pattern of a large number of miRNAs can be attributed to regulatory sequences present in their promoters (Babak et al. 2004; Barad et al. 2004; Calin et al. 2004; Liu et al. 2004; Miska et al. 2004; Sempere et al. 2004). Furthermore, host genes harboring miRNA sequences in their intronic sites impose their pattern of expression to the respective miRNAs (Bartel 2004; Rodriguez et al. 2004).
The current view suggests that miRNA expression is mainly controlled at the transcriptional level. For example, the transcription factors MyoD, Mef2, and SRF determine the heart-specific expression of miR-1 (Zhao et al. 2005). A recent study by O'Donnell and colleagues (O'Donnell et al. 2005) shows that the proto-oncogene c-Myc activates the expression of the miR-17-92 cluster. However, like other RNAs, miRNA expression could potentially be controlled at the post-transcriptional level (Pillai 2005). It has been shown in Caenorhabditis elegans that miR-38 is regulated in a temporal manner by differential maturation of pre-miR-38 during development (Ambros et al. 2003). We here provide conclusive evidence that also mammalian miRNA expression can be regulated at the level of miRNA processing.
RESULTS AND DISCUSSION
As a first step in validating targets of a set of brain-specific miRNAs, we isolated total RNA from brain and other mouse tissues, as well as from HeLa cells, and performed Northern blots with miRNA-specific probes. As expected for miR-138, the mature ~23-nt miRNA was detectable only in brain tissue (Fig. (Fig.1A).1AFIGURE 1.). In particular, we found that miR-138 was expressed in the cerebrum, the cerebellum, and the midbrain of adult mice as well as in the murine neuroblastoma cell line N2A (Fig. (Fig.1B).1BFIGURE 1.). Strikingly, its putative ~69-nt precursor was present in all tissues and cells analyzed (Fig. (Fig.1A,1AFIGURE 1., left panel; 1B), suggesting that the ubiquitously expressed precursor is processed into the mature miRNA in a tissue-specific manner.
FIGURE 1.
FIGURE 1.
FIGURE 1.
(A) Northern blot analysis of different brain-specific miRNAs. Thirty micrograms of total RNA from HeLa cells and from different mouse tissues were blotted and probed with a 5′-radiolabeled, LNA-modified oligodeoxynucleotide complementary to the (more ...)
Two putative precursors were recently predicted for miR-138, termed “pre-miR-138-1” and “pre-miR-138-2,” which are encoded on different chromosomal loci and are 62 nt and 69 nt in size, respectively (Lagos-Quintana et al. 2002; Griffiths-Jones 2004; Weber 2005). Multiple sequence alignments (Schwartz et al. 2000) of the two chromosomal regions showed high conservation of the mature miRNA among different vertebrate species, whereas only the locus of miR-138-2 showed an overall conservation pattern in the flanking sequences (Supplemental Material).
To check that (1) the ~69-nt band is indeed a precursor miRNA and, if so, (2) which of the two precursors is ubiquitously expressed, we performed Northern blots with total RNA isolated from HeLa cells and probed against the mature sequence as well as sequences specific for the loop regions of the two different precursors. Interestingly, the probe against the mature miR-138 showed a single band at 69 nt, which was also revealed by a probe against the loop region of pre-miR-138-2 (Fig. (Fig.1C).1CFIGURE 1.). Mismatches in the probes against the sequences of the mature miR-138 and of pre-miR-138-2 abolished detection of the 69-nt band (Supplemental Material), indicating that the ubiquitously expressed ~69-nt band shown in Figure Figure1,1FIGURE 1., ,AAFIGURE 1. and andB,BFIGURE 1., is indeed a precursor of miR-138, and that the mature miR-138 derives from pre-miR-138-2. In agreement with this, we were not able to detect a 62-nt band that would correspond to pre-miR-138-1 (Fig. (Fig.1C)1CFIGURE 1.) either with a mature probe or with a probe against the loop region of pre-miR-138-1.
To further investigate the overall distribution of miR-138 and its precursor, we performed in situ hybridizations with 3′ DIG-labeled LNA oligonucleotide probes on cryo-sections of E17 mouse embryos (Fig. (Fig.2A)2AFIGURE 2.) and adult brain (Fig. (Fig.2B).2BFIGURE 2.). We observed a strong staining in the central nervous system (CNS) for mature miR-138 (Fig. (Fig.2A,2AFIGURE 2., left panel). In particular, miR-138 was primarily localized to most neurons in the hippocampus and to specific regions of the neocortex, but also to the cerebellum (Fig. (Fig.2A,2AFIGURE 2., left panel; 2B, upper panel). This clearly demonstrates that expression of miR-138 is not uniform throughout the brain but restricted to distinct neuronal populations. Surprisingly, miR-138 was also expressed in fetal liver (Fig. (Fig.2A,2AFIGURE 2., left panel; 2C) but not in adult liver (Fig. (Fig.2C),2CFIGURE 2.), indicating that the expression of miR-138 is also developmentally regulated. To confirm the ubiquitous expression observed for pre-miR-138-2 in Northern blots performed with total RNA from adult tissues, we prepared a probe recognizing the loop region of the pre-miR-138-2 hairpin. Like Northern blots, in situ hybridizations showed a broad expression of pre-miR-138-2 in most organs of the embryo (Fig. (Fig.2A,2AFIGURE 2., right panel) as well as in adult brain (Fig. (Fig.2B,2BFIGURE 2., lower panel). To summarize, these data (Northern blots and in situ hybridizations) suggest that pre-miR-138-2 processing is both temporally and spatially regulated.
FIGURE 2.
FIGURE 2.
FIGURE 2.
(A) In situ hybridization experiment on cryo-sections of E17 mouse embryos using LNA-modified probes that recognize mature miR-138 (left panel) or pre-miR-138-2 (right panel). The probe against mature miR-138 shows a strong expression in neuronal tissues (more ...)
How is this differential processing achieved? A tempting hypothesis is that the export of pre-miR-138-2 is impaired in all tissues except brain, thus preventing cleavage by Dicer in the cytoplasm. To evaluate this possibility, we isolated cytoplasmic and nuclear RNA from HeLa cells, where pre-miR-138-2 is not processed, and examined its subcellular distribution. Northern blot analysis showed that the precursor is effectively exported to the cytoplasm (Fig. (Fig.2D),2DFIGURE 2.), indicating that cleavage by Dicer could be the regulated step.
We envision that tissue-specific expression could be achieved either by an activator present in tissues that express miR-138 or, alternatively, by an inhibitor acting on tissues that lack expression of miR-138. We were able to show that recombinant Dicer enzyme is able to convert pre-miR-138-2 into mature miR-138, a result that rules out the activator model (Fig. (Fig.3A).3AFIGURE 3.). Thus, we favor the presence of an inhibitory factor, which binds pre-miR-138-2 and prevents its conversion into a mature miR-138 by Dicer in all tissues not expressing miR-138. This hypothesis is fostered by in vitro experiments, where the addition of increasing amounts of HeLa cytoplasmic extracts readily abolished processing of pre-miR-138-2 by recombinant Dicer (Fig. (Fig.3B).3BFIGURE 3.). Importantly, processing of pre-miR-19a, a miRNA that is normally expressed in HeLa cells (Lagos-Quintana et al. 2001), was not abolished by titrating increasing amounts of HeLa cytoplasmic extracts (Fig. (Fig.3C).3CFIGURE 3.). We further analyzed pre-miRNA processing in living cells. For this purpose, we transfected HeLa cells transiently with plasmids encoding either pre-miR-124a or pre-miR-138-2 under the control of the H1 promoter. Northern blots showed that pre-miR-124a was converted into the mature miR-124a, whereas pre-miR-138-2 was not processed (Fig. (Fig.3D3DFIGURE 3., ,E).EFIGURE 3.). This suggests that HeLa cells, and possibly all other tissues and cells that do not express miR-138, may contain a factor that specifically recognizes pre-miR-138-2 and inhibits its processing by Dicer. Thus, tissues and cells that do express miR-138 may lack this factor or may render it inactive, allowing Dicer cleavage to occur (Fig. (Fig.44FIGURE 4.).
FIGURE 3.
FIGURE 3.
FIGURE 3.
(A) Processing reaction of pre-miR-138-2 into mature miR-138 by recombinant Dicer (rDcr) resolved on a 15% denaturing PAGE. (B) As in A. The addition of increasing amounts of HeLa cytoplasmic extract effectively abolishes the processing of pre-miR-138-2. (more ...)
FIGURE 4.
FIGURE 4.
FIGURE 4.
Model depicting how differential processing of an otherwise ubiquitously expressed pre-miRNA mediates tissue- and/or developmental stage-specific expression of the mature miRNA. In both tissues, expressing or not expressing the mature miR-138, its gene (more ...)
In this report we demonstrate that differential processing of precursor miRNAs into mature miRNAs leads to tissue- and developmental-specific miRNA expression in mammals. The presence of an unprocessed miRNA precursor in most tissues of the organism is intriguing. It could be envisioned that the unprocessed precursor might play a different role in the cell, irrespective of the function of the mature miRNA. This novel mechanism could be a more general feature for the regulation of miRNA expression. Obviously, we are left with the question of why cells employ such a complex and energy wasteful method of restricting the function of one particular miRNA to certain cellular populations. Clearly, such regulation allows higher expression stringency, but also an opportunity for quick regulation. The precursor form of the functional miRNA is already expressed, and the cells can quickly produce the mature miRNA by modifying the regulator. This could be very important for fast responses like coupling neuronal processes in time, like LTP gene expression.
MATERIALS AND METHODS
Isolation of total RNA from cells, mouse tissues, and Northern blotting
Isolation of total RNA from cultured cells or tissues and subsequent Northern blotting was performed as previously described (Lagos-Quintana et al. 2001). Twenty micrograms of total RNA were separated in a 15% polyacrylamide gel (20 × 25 cm) containing 8 M urea (SEQUAGEL, National Diagnostics), transferred to a Hybond-N+ membrane (Amersham Biosciences), fixed by ultraviolet cross-linking (2× auto cross-link on a Stratalink 2400 [Stratagene]), and subsequently baked for 1 h at 80°C. Membranes were probed with 10 pmol of 5′ 32P-labeled (T4 polynucleotide kinase [New England Biolabs]) DNA/LNA (locked nucleic acid) modified oligonucleotides (Proligo), complementary to the mature and precursor miRNAs. We used DNA/LNA probes, where every third position was substituted by a LNA nucleotide, in order to obtain an improved miRNA detection (Valoczi et al. 2004). LNA nucleotides are indicated by “*X.” The sequences for the probes were as follows: miR-138, 5′-C*GGC*CTG*ATT*CAC*AAC*ACC*AGC*T-3′. To differentiate between miRNA precursors and mature miRNAs, the following probes against the loop regions of the two different hairpins were designed and labeled: pre-miR-138-1, C*GTT*CTC*TGA*TTG*GCA*A-3′; pre-miR-138-2, 5′-G*GTA*AGA*GGA*TGC*GCT*GCT*CGT-3′. As a control for specificity of the probes, we used mismatch probes against pre-miR-138-2 and miR-138: mismatch-loop, 5′-TAAGAGGATGCGCTGCTAAAAAACCTGATTCACAACACCA-3′, and mismatch-mature, 5′-CGGCCTGATTAAAAAAACCAGCT-3′.
Prehybridization of membranes was carried out in a buffer containing 5× SSC, 20 mM Na2HPO4 (pH 7.2), 7% SDS, 1× Denhardt's solution, and 0.1 mg/mL sonicated salmon sperm DNA (Stratagene). Hybridizations were carried out in the same solution at 80°C. 5′-32P-labeled probes were heated for 1 min at 95°C before addition to the hybridization solution. After hybridization, the membranes were washed twice in 5× SSC, 5% SDS and once in 1× SSC, 1% SDS at 70°C for 1–2 min each. Northern blots were then analyzed by PhosphorImaging (Storm 860, Molecular Dynamics).
Cell culture
HeLa human cervix-carcinoma cells as well as N2A murine neuroblastoma cells were grown in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen) supplemented with 10% fetal calf serum (FCS) (Invitrogen), 100 u/mL penicillin (Sigma-Aldrich), 100 μg/mL penicillin/streptomycin (Sigma-Aldrich), and 20 mM HEPES (pH 7.3) at 37°C in an atmosphere containing 5% CO2 in 15-cm dishes up to 90%–95% confluency.
HeLa cells were transfected with the indicated amounts of pSUPER.neo+GFP plasmid (Oligoengine), where the sequences of pre-miR-124a or pre-miR-138-2 were previously inserted between the BglII and the HindIII restriction sites. For pre-miR-124a, we used 124a-fwd, 5′-GATCCCCGTGTTCACAGCGGACCTTGATTTAAATGTCCATACAATTAAGGCACGCGGTGAATGCCATTTTTA-3′, and 124a-rev, 5′-AGCTTAAAAATGGCATTCACCGCGTGCCTTAATTGTATGGACATTTAAATCAAGGTCCGCTGTGAACACGGG-3′. For pre-miR-138-2, we used 138-2-fwd, 5′-GATCCCCAGCTGGTGTTGTGAATCAGGCCGACGAGCAGCGCATCCTCTTACCCGGCTATTTCACGACACCAGGGTTTTTA-3′, and 138-2-rev, 5′-AGCTTAAAAACCCTGGTGTCGTGAAATAGCCGGGTAAGAGGATGCGCTGCTCGTCGGCCTGATTCACAACACCAGCTGGG-3′. Transfections were perfomed in 6-well plates (Nunc) using the Lipofectamine 2000 reagent (Invitrogen) with concentrations according to the product manual. Total RNA was isolated 6 h after the start of transfection as described above.
Preparation of cellular extracts
HeLa or N2A cells were briefly washed with 1× PBS and harvested in 1 mL of a buffer containing 100 mM KCl, 5 mM MgCl2, 10% glycerol, 30 mM HEPES (pH 7.4), 0.1 mM AEBSF, and 0.5 mM DTT by scraping with a rubber policeman. Cells were effectively lysed by sonication. The remaining cell debris was removed by centrifugation.
Nuclear and cytoplasmic extracts were prepared as previously described (Lehnertz et al. 2003). Briefly, to prepare cytoplasmic extracts, cells were harvested by trypsinization, washed, and pelleted by centrifugation. The pellet was resuspended in 1× PBS and pelleted again by spinning. PBS was removed, and the cell pellet was resuspended in cold buffer A (10 mM HEPES at pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF) by gentle pipetting. After swelling, a 10% solution of Nonidet NP–40 (Fluka) was added and the tube was vigorously vortexed. The homogenate was centrifuged, and the supernatant containing the cytoplasm and the cytoplasmic RNA was transferred to a fresh tube and subsequently used for RNA extraction and Northern blot analysis. Nuclei were prepared by centrifugation of the cells through a cushion of nuclear isolation buffer (20% [v/v] Ficoll-Paque Pharmacia, 80 mM Tris/HCl at pH 7.4, 8 mM MgCl2, 8 mM CaCl2, 1.6% [v/v] NP–40, 1.3% [v/v] Triton X-100, and 0.001% [v/v] DMSO). Nuclear pellets were washed once in ice-cold PBS, snap-frozen in liquid nitrogen, and subsequently used for the preparation of nuclear RNA. To obtain nuclear extracts, nuclei were resuspended in immunoprecipitation (IP) buffer (45 mM HEPES/NaOH at pH 7.5, 0.45 M NaCl, 0.9 mM EDTA, 0.9% [v/v] NP–40, 8.7% [v/v] glycerol, 1 mM NaF, 10 mM β-glycerophosphate, 1 tablet/50 mL protease inhibitor cocktail [Roche, no. 1836145]) and sonicated. After centrifugation, the supernatant was snap-frozen in liquid nitrogen and subsequently used for RNA extraction and Northern blot analysis.
In vitro processing assays
For in vitro processing assays, DNA templates encoding the sequences of various miRNAs were transcribed by T7 polymerase (MEGAshortscript T7, Ambion) in the presence of 32P-α-UTP (Amersham), thus generating radiolabeled, synthetic precursor miRNAs. The DNA templates were annealed to a T7 runoff DNA oligonucleotide (AATTTAATACGACTCACTATAGG) that spans the T7 promoter site. The sequences used were as follows: pre-miR-19a, 5′-TCAGTTTTGCATAGATTTGCACAACTACATTCTTCTTGTAGTGCAACTATGCAAAACCTATAGTGAGTCGTATTAA-3′; pre-miR-138-2, 5′-AACCCTGGTGTCGTGAAATAGCCGGGTAAGAGGATGCGCTGCTCGTCGGCCTGATTCACAACACCAGCCTATAGTGAGTCGTATTAA-3′. These synthetic precursors were folded into their hairpin-shaped structure by heating for 1 min at 95°C and cooling slowly to room temperature. Processing with recombinant Dicer was performed as previously described (Zhang et al. 2002). Precursors were used at a concentration of 10 nM and were pretreated for 10 min at 30°C with increasing amounts of HeLa cytoplasmic extract (2, 4, 6, 8, 16, 24, and 32 μg protein for pre-miR-138-2; 2, 6, 16, and 32 μg protein for pre-miR-19a). After 2 min incubation at 37°C, the reaction products were separated on a 15% denaturing PAGE and visualized by autoradiography.
In situ hybridizations
All mice were maintained at the animal facility at the IMP, under pathogen-free conditions. C57BL/6 mice were mated to generate embryos for analyses and the morning of the vaginal plug was considered as E0.5. Embryos, livers, and brains were post-fixed in 4% paraformaldehyde, cryoprotected (30% sucrose in PBS), embedded in Tissue-Tek OCT compound, and cryosectioned. Ten-micron cryosections were pretreated, hybridized with LNA digoxygenin-labeled probes (Exiqon), and washed according to Schaeren-Wiemers and Gerfin-Moser (1993), with some modifications. Probe sequences were as follows: miR-122a, 5′-ACAAACACCATTGTCACACTCCA-3′; miR-138, 5′-CGGCCTGATTCACAACACCAGCT-3′; and pre-miR-138-2, 5′-GGTAAGAGGATGCGCTGCTCGT-3′. Briefly, sections were fixed in 4% paraformaldehyde for 10 min, acetylated, and treated with 5 μg/mL proteinase K (Roche) in PBS for 5 min, washed, and prehybridized for 4 h at room temperature. Hybridization with 22-nt LNA probes (Tm ~ 80°C) was performed at 55°C overnight. Slides were then washed at 60°C and incubated with alkaline phophatase-conjugated goat anti-DIG Fab fragments (1:2000 [Roche]) at 4°C overnight. Fluorescent detection was performed using a Fast Red reaction (Dako Cytomation) for 1 h at room temperature. Sections were analyzed with a with a Zeiss Axioplan-2 microscope and photographed with a digital camera (Coolsnap HQ, Photometrics). A subset of images was adjusted for levels, brightness, contrast, hue, and saturation with Adobe Acrobat 7.0 imaging software to optimally visualize the expression patterns.
SUPPLEMENTAL MATERIAL
Supplemental Material can be found at http://www.imba.oeaw.ac.at/index.php?id=142.
ACKNOWLEDGMENTS
We thank Stefan Ameres, Stefan Weitzer, and the members of the laboratory for encouragement and suggestions during the completion of this work, and Prof. Renée Schroeder for critically reading the manuscript. J.M. is a Junior Group Leader at IMBA. P.J.F.L. is funded by the Boehringer Ingelheim Fonds Ph.D. Scholarship. M.A. was supported by an EMBO long-term fellowship and a Marie Curie fellowship.
Footnotes
Article published online ahead of print. Article and publication date are at http://www.rnajournal.org/cgi/doi/10.1261/rna.2322506.
REFERENCES
  • Ambros V., Lee R.C., Lavanway A., Williams P.T., Jewell D. MicroRNAs and other tiny endogenous RNAs in C. elegans . Curr. Biol. 2003;13:807–818. [PubMed]
  • Babak T., Zhang W., Morris Q., Blencowe B.J., Hughes T.R. Probing microRNAs with microarrays: Tissue specificity and functional inference. RNA. 2004;10:1813–1819. [PubMed]
  • Barad O., Meiri E., Avniel A., Aharonov R., Barzilai A., Bentwich I., Einav U., Gilad S., Hurban P., Karov Y., et al. MicroRNA expression detected by oligonucleotide microarrays: System establishment and expression profiling in human tissues. Genome Res. 2004;14:2486–2494. [PubMed]
  • Bartel D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–297. [PubMed]
  • Bentwich I., Avniel A., Karov Y., Aharonov R., Gilad S., Barad O., Barzilai A., Einat P., Einav U., Meiri E., et al. Identification of hundreds of conserved and nonconserved human microRNAs. Nat. Genet. 2005;37:766–770. [PubMed]
  • Berezikov E., Guryev V., van de Belt J., Wienholds E., Plasterk R.H., Cuppen E. Phylogenetic shadowing and computational identification of human microRNA genes. Cell. 2005;120:21–24. [PubMed]
  • Bernstein E., Caudy A.A., Hammond S.M., Hannon G.J. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 2001;409:363–366. [PubMed]
  • Bohnsack M.T., Czaplinski K., Gorlich D. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA. 2004;10:185–191. [PubMed]
  • Calin G.A., Liu C.G., Sevignani C., Ferracin M., Felli N., Dumitru C.D., Shimizu M., Cimmino A., Zupo S., Dono M., et al. MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc. Natl. Acad. Sci. 2004;101:11755–11760. [PubMed]
  • Griffiths-Jones S. The microRNA registry. Nucleic Acids Res. 2004;32:D109–D111. [PubMed]
  • Hutvágner G., McLachlan J., Bálint, É., Tuschl T., Zamore P.D. A cellular function for the RNA interference enzyme Dicer in small temporal RNA maturation. Science. 2001;93:834–838.
  • Ketting R.F., Fischer S.E., Bernstein E., Sijen T., Hannon G.J., Plasterk R.H. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans . Genes & Dev. 2001;15:2654–2659. [PubMed]
  • Khvorova A., Reynolds A., Jayasena S.D. Functional siRNAs and miRNAs exhibit strand bias. Cell. 2003;115:209–216. [PubMed]
  • Knight S.W., Bass B.L. A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in C. elegans . Science. 2001;2:2.
  • Lagos-Quintana M., Rauhut R., Lendeckel W., Tuschl T. Identification of novel genes coding for small expressed RNAs. Science. 2001;294:853–858. [PubMed]
  • Lagos-Quintana M., Rauhut R., Yalcin A., Meyer J., Lendeckel W., Tuschl T. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 2002;12:735–739. [PubMed]
  • Lee Y., Ahn C., Han J., Choi H., Kim J., Yim J., Lee J., Provost P., Radmark O., Kim S., et al. The nuclear RNase III Drosha initiates microRNA processing. Nature. 2003;425:415–419. [PubMed]
  • Lehnertz B., Ueda Y., Derijck A.A., Braunschweig U., Perez-Burgos L., Kubicek S., Chen T., Li E., Jenuwein T., Peters A.H. Suv39h-mediated histone H3 lysine 9 methylation directs DNA methylation to major satellite repeats at pericentric heterochromatin. Curr. Biol. 2003;13:1192–1200. [PubMed]
  • Lim L.P., Glasner M.E., Yekta S., Burge C.B., Bartel D.P. Vertebrate microRNA genes. Science. 2003;299:1540. [PubMed]
  • Liu C.G., Calin G.A., Meloon B., Gamliel N., Sevignani C., Ferracin M., Dumitru C.D., Shimizu M., Zupo S., Dono M., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. 2004;101:9740–9744. [PubMed]
  • Lund E., Guttinger S., Calado A., Dahlberg J.E., Kutay U. Nuclear export of microRNA precursors. Science. 2004;303:95–98. [PubMed]
  • Miska E.A., Alvarez-Saavedra E., Townsend M., Yoshii A., Sestan N., Rakic P., Constantine-Paton M., Horvitz H.R. Microarray analysis of microRNA expression in the developing mammalian brain. Genome Biol. 2004;5:R68. [PubMed]
  • O'Donnell K.A., Wentzel E.A., Zeller K.I., Dang C.V., Mendell J.T. c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005;435:839–843. [PubMed]
  • Pillai R.S. MicroRNA function: Multiple mechanisms for a tiny RNA? RNA. 2005;11:1753–1761. [PubMed]
  • Rodriguez A., Griffiths-Jones S., Ashurst J.L., Bradley A. Identification of mammalian microRNA host genes and transcription units. Genome Res. 2004;14:1902–1910. [PubMed]
  • Schaeren-Wiemers N., Gerfin-Moser A. A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: In situ hybridization using digoxigenin-labelled cRNA probes. Histochemistry. 1993;100:431–440. [PubMed]
  • Schwartz S., Zhang Z., Frazer K.A., Smit A., Riemer C., Bouck J., Gibbs R., Hardison R., Miller W. PipMaker–A web server for aligning two genomic DNA sequences. Genome Res. 2000;10:577–586. [PubMed]
  • Schwarz D.S., Hutvagner G., Du T., Xu Z., Aronin N., Zamore P.D. Asymmetry in the assembly of the RNAi enzyme complex. Cell. 2003;115:199–208. [PubMed]
  • Sempere L.F., Freemantle S., Pitha-Rowe I., Moss E., Dmitrovsky E., Ambros V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 2004;5:R13. [PubMed]
  • Valoczi A., Hornyik C., Varga N., Burgyan J., Kauppinen S., Havelda Z. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 2004;32:e175. [PubMed]
  • Weber M.J. New human and mouse microRNA genes found by homology search. FEBS J. 2005;272:59–73. [PubMed]
  • Yi R., Qin Y., Macara I.G., Cullen B.R. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes & Dev. 2003;17:3011–3016. [PubMed]
  • Zhang H., Kolb F.A., Brondani V., Billy E., Filipowicz W. Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATP. EMBO J. 2002;21:5875–5885. [PubMed]
  • Zhao Y., Samal E., Srivastava D. Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature. 2005;436:214–220. [PubMed]
Articles from RNA are provided here courtesy of
The RNA Society
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph